ID: 919759515

View in Genome Browser
Species Human (GRCh38)
Location 1:201088551-201088573
Sequence TAATTCTGGATTGGAGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919759503_919759515 12 Left 919759503 1:201088516-201088538 CCCCACCCCCACAATAGGCGGCG 0: 1
1: 0
2: 0
3: 27
4: 327
Right 919759515 1:201088551-201088573 TAATTCTGGATTGGAGCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 145
919759502_919759515 13 Left 919759502 1:201088515-201088537 CCCCCACCCCCACAATAGGCGGC 0: 1
1: 0
2: 2
3: 49
4: 586
Right 919759515 1:201088551-201088573 TAATTCTGGATTGGAGCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 145
919759507_919759515 6 Left 919759507 1:201088522-201088544 CCCCACAATAGGCGGCGTCATAT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 919759515 1:201088551-201088573 TAATTCTGGATTGGAGCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 145
919759506_919759515 7 Left 919759506 1:201088521-201088543 CCCCCACAATAGGCGGCGTCATA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 919759515 1:201088551-201088573 TAATTCTGGATTGGAGCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 145
919759500_919759515 14 Left 919759500 1:201088514-201088536 CCCCCCACCCCCACAATAGGCGG 0: 1
1: 0
2: 1
3: 25
4: 287
Right 919759515 1:201088551-201088573 TAATTCTGGATTGGAGCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 145
919759504_919759515 11 Left 919759504 1:201088517-201088539 CCCACCCCCACAATAGGCGGCGT 0: 1
1: 0
2: 0
3: 1
4: 61
Right 919759515 1:201088551-201088573 TAATTCTGGATTGGAGCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 145
919759505_919759515 10 Left 919759505 1:201088518-201088540 CCACCCCCACAATAGGCGGCGTC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 919759515 1:201088551-201088573 TAATTCTGGATTGGAGCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 145
919759508_919759515 5 Left 919759508 1:201088523-201088545 CCCACAATAGGCGGCGTCATATT 0: 1
1: 0
2: 0
3: 1
4: 14
Right 919759515 1:201088551-201088573 TAATTCTGGATTGGAGCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 145
919759509_919759515 4 Left 919759509 1:201088524-201088546 CCACAATAGGCGGCGTCATATTG 0: 1
1: 0
2: 0
3: 1
4: 12
Right 919759515 1:201088551-201088573 TAATTCTGGATTGGAGCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919759515 Original CRISPR TAATTCTGGATTGGAGCCAG GGG Intronic
900001423 1:16894-16916 CAGTTCTGGAATGGTGCCAGGGG + Intergenic
900021143 1:187416-187438 CAGTTCTGGAATGGTGCCAGGGG + Intergenic
902808115 1:18873307-18873329 GAATTCTGGCTAGGAACCAGGGG - Intronic
902893551 1:19462714-19462736 TTCTTCTGGATAGGAGCCAGAGG - Intronic
903420633 1:23216290-23216312 GAGCTCTGGTTTGGAGCCAGGGG + Intergenic
903794761 1:25920354-25920376 TAACCCTGGATTTGAGACAGGGG + Intergenic
904629799 1:31832247-31832269 TCATGCTGCATTAGAGCCAGGGG + Intergenic
904903276 1:33874732-33874754 TGATTCTGTCTGGGAGCCAGAGG - Intronic
904916834 1:33976428-33976450 CAATGGTGGGTTGGAGCCAGCGG - Intronic
909769152 1:79398450-79398472 GAATTCTGCCTTGGAGCCAGGGG + Intergenic
910007813 1:82420533-82420555 TAATGCTGAATTGGAGTAAGAGG + Intergenic
910203387 1:84723365-84723387 TAATTCAAGATTGTAGCCACTGG + Intergenic
910429498 1:87147205-87147227 AAATTCTGGGCTGGACCCAGTGG - Intronic
910974355 1:92890911-92890933 GAATTCTGCAGTGGAGCCATTGG + Intronic
911563350 1:99433214-99433236 TAATTTTGGATTGGAGAGATAGG - Intergenic
912207749 1:107526990-107527012 TTATTCTGGAGAGGAGCCAGAGG - Intergenic
912601677 1:110941331-110941353 TAATGTTGGATTGGAGTAAGAGG - Intergenic
914387165 1:147180891-147180913 TAAGTCTGGAGTGGGGCCTGAGG + Intronic
915322295 1:155062517-155062539 TAAGTCCGGCTTGGAGGCAGCGG - Exonic
915946403 1:160155335-160155357 TAATTAGGGATTTGGGCCAGAGG - Intronic
919759515 1:201088551-201088573 TAATTCTGGATTGGAGCCAGGGG + Intronic
921882744 1:220272657-220272679 TCATTCTGGCTTTTAGCCAGAGG + Intergenic
923641018 1:235760811-235760833 TATTTCTGGATTTGGGCTAGAGG + Intronic
1069882613 10:71603137-71603159 CATTGCTGGATTGGAGCCAGAGG + Intronic
1070270764 10:74952373-74952395 AGATTCTGGAGTGGTGCCAGTGG + Intronic
1073543772 10:104332722-104332744 TAATTTGGGAGTGGAGTCAGAGG - Intronic
1075992893 10:126853119-126853141 GAGTTCTGGATAGGAGCCTGGGG - Intergenic
1077627368 11:3784755-3784777 TATTTCTAGAATGGAGCCTGGGG - Intronic
1078202186 11:9193450-9193472 CAATCCTGGATTGGGGCCAGAGG + Intronic
1088446286 11:109932366-109932388 GAATTCTGCATGGAAGCCAGAGG - Intergenic
1089866170 11:121634156-121634178 TAAGTCAGGATTGGAGGCTGTGG + Intergenic
1091374509 12:17009-17031 CAGTTCTGGAATGGTGCCAGGGG + Intergenic
1097578592 12:61426024-61426046 TAGTTCTGATTTGCAGCCAGAGG - Intergenic
1100662831 12:96718643-96718665 TAAGAATGGGTTGGAGCCAGAGG + Intronic
1100974678 12:100110241-100110263 AAATTCTGGTTTGGAGTCAGTGG - Intronic
1102649384 12:114427557-114427579 TGATTCTGGATTGGTGGGAGTGG + Intergenic
1106819810 13:33452159-33452181 GATTTCTGGAATGGACCCAGGGG + Intergenic
1106869138 13:34000074-34000096 TAATTCTGGTTGGCAGCCCGGGG + Intergenic
1110400343 13:75082393-75082415 TAATTTTGGGTTGGAAACAGTGG - Intergenic
1112176873 13:97034530-97034552 TTATTCTGGGTTCCAGCCAGTGG - Intergenic
1112542250 13:100326325-100326347 TGCTTCTGAATTGGTGCCAGAGG + Intronic
1112620993 13:101053368-101053390 TCATTCTGCAGTGAAGCCAGGGG - Intergenic
1112849787 13:103691374-103691396 CAAATCTGGATTTGACCCAGTGG - Intergenic
1113054767 13:106256326-106256348 TACCCCTGGATTAGAGCCAGGGG - Intergenic
1114615284 14:24065004-24065026 TTCTTCTGGAGTGGAGGCAGCGG - Exonic
1114796669 14:25723166-25723188 TGGTTCTGGATTGGAGTCAAAGG + Intergenic
1116054623 14:39848250-39848272 GTATTCGGGATTGGAGCAAGAGG + Intergenic
1117640909 14:57798753-57798775 TGCTTCTCTATTGGAGCCAGCGG + Intronic
1119733805 14:76967966-76967988 TAGTTCTGGATTGTGGTCAGAGG - Intergenic
1123177685 14:106437149-106437171 TAGCCCTGGACTGGAGCCAGCGG + Intergenic
1126279995 15:46935825-46935847 TAATTCTGGTCTGAAGCCTGTGG - Intergenic
1129125288 15:73435337-73435359 TAGTTTTGGACTGGAGCCTGGGG - Intergenic
1131745290 15:95440888-95440910 TCATTCTGGAAAGTAGCCAGTGG - Intergenic
1132370365 15:101293670-101293692 CAATTCTGAATTGGAGCTGGGGG - Intronic
1132452085 15:101974044-101974066 CAGTTCTGGAATGGTGCCAGGGG - Intergenic
1132454808 16:16577-16599 CAGTTCTGGAATGGTGCCAGGGG + Exonic
1133664491 16:7952939-7952961 TGATTCTGGATTGCACACAGAGG - Intergenic
1135772982 16:25231498-25231520 TCATTCTGCAGAGGAGCCAGTGG + Intergenic
1137573660 16:49583893-49583915 AAATTATGGACTGGAGCTAGGGG + Intronic
1143449831 17:7029472-7029494 TAATTCTGCAGTGGGGCCATGGG - Exonic
1145777799 17:27541392-27541414 TAATGCTGGCTTAGAGCCAGGGG + Intronic
1147025221 17:37576556-37576578 TTATTCTGAATCGGAGGCAGGGG - Intronic
1147133309 17:38421186-38421208 TGATTCTGTAATGGAGCCAAGGG - Intergenic
1153938960 18:9960260-9960282 TAATTTTGAATTGGACCAAGTGG + Intergenic
1157081463 18:44529906-44529928 TATTTCTGGATTCGAACCTGAGG + Intergenic
1159838216 18:73366734-73366756 TGTTTCTGGATTGGAGCCTGGGG + Intergenic
1161684358 19:5695692-5695714 TCATTCTGGGTGGGAGCCACAGG + Intronic
1165608988 19:37134072-37134094 TGATTCTGGATTGGATGCTGTGG + Intronic
1167285884 19:48598825-48598847 GAATTCAGGGTTGGAGGCAGAGG + Intronic
1167428534 19:49441775-49441797 AAAATCTGGGTAGGAGCCAGGGG - Intronic
926634056 2:15162152-15162174 AAACACTGGATTGGAGTCAGGGG - Intergenic
927231915 2:20832394-20832416 AAATTCAGTATTAGAGCCAGTGG - Intergenic
931127737 2:59296499-59296521 TTACTCTGGAGTGAAGCCAGGGG - Intergenic
931568702 2:63644611-63644633 GAATTCAGCATTGGAGCCATTGG + Intronic
936568302 2:113596520-113596542 CAGTTCTGGAATGGTGCCAGGGG - Intergenic
939902409 2:147866382-147866404 TAAATCTGGAGTGGGGCCTGAGG + Intronic
941568212 2:167135687-167135709 TAATTCAGAAGTGGAACCAGTGG + Intronic
941659771 2:168183811-168183833 CCATTCTGGATTGAACCCAGTGG - Intronic
941766080 2:169298082-169298104 TTAATCTGTCTTGGAGCCAGAGG - Intronic
942110468 2:172677539-172677561 TTGCTCTGGATTGCAGCCAGAGG + Intergenic
943105206 2:183537680-183537702 TCTTTCTGGATTGGAGACATAGG + Intergenic
944195326 2:197047305-197047327 TAATTCTGGGCTGGATGCAGTGG - Intronic
944867788 2:203879595-203879617 AAACTGTGGATTGGAGCCAGTGG - Intergenic
945029469 2:205650001-205650023 TAAATCTGGGTTGGGGGCAGAGG + Intergenic
1168851625 20:980984-981006 AAGTTCTGGAATGGGGCCAGAGG + Intronic
1172335560 20:34112640-34112662 AAATTCTGAGTTGGAGCTAGAGG + Intergenic
1175151228 20:56936259-56936281 TAATTCTTGATTTTGGCCAGAGG - Intergenic
1177988319 21:28006540-28006562 TAATTCTGGATTGGAAATAAAGG - Intergenic
1178893386 21:36539047-36539069 TCATTCTGGAGTGGGGTCAGCGG - Intronic
1178906917 21:36644082-36644104 TAAGTCTGCAGTGAAGCCAGGGG - Intergenic
1181371770 22:22424677-22424699 GAATGTTGGATGGGAGCCAGAGG - Intergenic
951679608 3:25281206-25281228 AAATTTGGGAATGGAGCCAGTGG + Intronic
953606145 3:44414627-44414649 TACATGTGGAATGGAGCCAGCGG + Intergenic
955196330 3:56807803-56807825 TAAATCTAGACTGGAGTCAGTGG - Intronic
956044201 3:65177699-65177721 TAATTCTTTGTTGGAGGCAGGGG - Intergenic
956677762 3:71752210-71752232 TAGTTCTGGAATGGGGCCGGAGG - Intronic
958096813 3:88956352-88956374 TCAGCCTGGATTGGAGCCTGTGG + Intergenic
958474276 3:94561042-94561064 TAATTCTGGATAACAGGCAGAGG + Intergenic
962471563 3:135713502-135713524 TAATACTGGGCTGCAGCCAGTGG - Intergenic
963040728 3:141067787-141067809 GAAGTCTGGATTGGTGCTAGTGG - Intronic
965837659 3:172869049-172869071 TTCTTCTGGATAGGAGCCAATGG + Intergenic
970295707 4:14627134-14627156 AAAGTCTGGTTTGGAGCCAGAGG - Intergenic
970575104 4:17419503-17419525 TGATTCTGATTTGTAGCCAGAGG - Intergenic
972082173 4:35166589-35166611 TCATTCTGGATCTTAGCCAGGGG - Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
978698876 4:111618375-111618397 TAAATCTGCATTCAAGCCAGAGG - Intergenic
984863940 4:184264453-184264475 AAAATCTGAATGGGAGCCAGTGG - Intergenic
986112488 5:4733697-4733719 GATCTCTGGACTGGAGCCAGCGG + Intergenic
991578122 5:68126248-68126270 CAATTCTGAAGTGGAGCTAGAGG - Intergenic
993159869 5:84276258-84276280 TAAAACTGGATTGCAGCAAGAGG - Intronic
1003357377 6:5386473-5386495 TAATTCTGCAATGTGGCCAGTGG + Intronic
1005614396 6:27558786-27558808 AAACTCTGGACTGGAGCTAGAGG + Intergenic
1007676630 6:43601169-43601191 TAATTAAGGACTGGAGCCAGGGG + Intronic
1008623024 6:53290480-53290502 GAGTTCAGGACTGGAGCCAGGGG - Intronic
1008766882 6:54928140-54928162 TGATTCAGGACTGAAGCCAGGGG - Intronic
1009877851 6:69528610-69528632 TAATTCTGTATTGGAGGTGGAGG + Intergenic
1010054774 6:71552105-71552127 CAATTCTGACTAGGAGCCAGAGG - Intergenic
1010432046 6:75788723-75788745 TCATTCTGGACCGGAGGCAGTGG - Intronic
1011806514 6:91078951-91078973 TAAATCAGGATAGGAGGCAGTGG - Intergenic
1011832698 6:91392624-91392646 GAATTCTAGATTGGAGTCAAAGG + Intergenic
1013766933 6:113585452-113585474 AAATTCTGTATTGTTGCCAGAGG - Intergenic
1017381092 6:153831115-153831137 TGATTCTGGCTTGGATGCAGGGG - Intergenic
1017722218 6:157251627-157251649 TAATTCTGCATTAGTGGCAGTGG - Intergenic
1017806143 6:157947115-157947137 TAATTCTGGAGAGAAGCCACTGG + Intergenic
1017929828 6:158942089-158942111 TAACTCTGCATTGCACCCAGAGG + Intergenic
1021478395 7:21088550-21088572 TAAAACTGCATTGGAACCAGTGG - Intergenic
1022300494 7:29098075-29098097 TTATTCTGGGCTGAAGCCAGGGG - Intronic
1024491763 7:49994089-49994111 TAATTCTGGGCTGTCGCCAGTGG - Intronic
1024999839 7:55306710-55306732 TCATTCTGCATTTGAGCAAGTGG + Intergenic
1028242853 7:88442521-88442543 GTTTTCTGGATTGGACCCAGGGG - Intergenic
1028328042 7:89550618-89550640 CAATGCTGGATTGGAGGCATCGG - Intergenic
1033366438 7:140675530-140675552 TCAGTGTGGATTGGAGGCAGAGG + Intronic
1034151040 7:148915529-148915551 TATTTCTGCAGTGGAGCCCGAGG - Intergenic
1034408438 7:150922260-150922282 TGATCCTGGATTGCAGCTAGTGG + Intergenic
1035957400 8:4096386-4096408 TATGTCTGGATTAGAGCCATAGG - Intronic
1036642871 8:10594967-10594989 TAGTTCTGGTTTAGAGCCTGGGG - Intergenic
1037497740 8:19456653-19456675 CACTTCAGGACTGGAGCCAGAGG + Intronic
1038120442 8:24608407-24608429 TGATGGTGGATTGGAGCAAGGGG + Intergenic
1041844361 8:62310919-62310941 TAATCCTGGATTGAAACCTGAGG - Intronic
1049039505 8:140101384-140101406 TAATTCTAGCTGGGAGGCAGAGG - Intronic
1049124270 8:140772469-140772491 GAATTCTGGACTGGAGGCTGGGG + Intronic
1049836897 8:144741444-144741466 TAATTTTGGAGTGGAGACTGTGG - Intronic
1049884228 9:17005-17027 CAGTTCTGGAATGGTGCCAGGGG + Intergenic
1051037135 9:12761954-12761976 TAATTCAAAATTGGAGCTAGAGG + Intergenic
1052052918 9:23868156-23868178 TTATCCAGGGTTGGAGCCAGAGG - Intergenic
1052375133 9:27710510-27710532 TAATTCAGCATTGAAGCCATTGG + Intergenic
1054797953 9:69320225-69320247 TAAGTCTGTCTTGGGGCCAGAGG + Intergenic
1054964092 9:71002334-71002356 TAAATCGAAATTGGAGCCAGCGG + Intronic
1055033481 9:71793772-71793794 TGATTCTGGATAGTAGACAGTGG + Intronic
1055128383 9:72746444-72746466 TAATTGTGGATTGTAGTAAGTGG + Intronic
1056725830 9:89115502-89115524 TAATTCTCTATTGGTGGCAGTGG - Intronic
1058887095 9:109329855-109329877 TAAAGCTGGAATGGAGCCTGCGG + Intergenic
1061978433 9:134085586-134085608 TACTGCTGGAATGGGGCCAGAGG + Intergenic
1189022198 X:37352062-37352084 TAATTCCTGTTAGGAGCCAGAGG - Intronic
1189117197 X:38355513-38355535 AGGTTATGGATTGGAGCCAGAGG + Intronic
1189716419 X:43871144-43871166 TTATCCTGGATTGAAGCAAGAGG + Intronic
1196668832 X:118345097-118345119 AAAGGCTGGATTGGAGCCAGGGG - Intergenic
1199035703 X:143048279-143048301 TAATTCAGCAGTGGAGCCATTGG + Intergenic