ID: 919761465

View in Genome Browser
Species Human (GRCh38)
Location 1:201100647-201100669
Sequence CTGACTAGACAGAGGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 237}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919761461_919761465 -8 Left 919761461 1:201100632-201100654 CCAGACACACCAGGGCTGACTAG 0: 1
1: 0
2: 2
3: 6
4: 109
Right 919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG 0: 1
1: 0
2: 1
3: 34
4: 237
919761450_919761465 25 Left 919761450 1:201100599-201100621 CCAGGGAACCAAGCTCCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 173
Right 919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG 0: 1
1: 0
2: 1
3: 34
4: 237
919761454_919761465 17 Left 919761454 1:201100607-201100629 CCAAGCTCCCTCAGGTCTGGGTG 0: 1
1: 1
2: 4
3: 27
4: 247
Right 919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG 0: 1
1: 0
2: 1
3: 34
4: 237
919761449_919761465 30 Left 919761449 1:201100594-201100616 CCTTACCAGGGAACCAAGCTCCC 0: 1
1: 0
2: 1
3: 17
4: 124
Right 919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG 0: 1
1: 0
2: 1
3: 34
4: 237
919761457_919761465 10 Left 919761457 1:201100614-201100636 CCCTCAGGTCTGGGTGGGCCAGA 0: 1
1: 0
2: 2
3: 32
4: 271
Right 919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG 0: 1
1: 0
2: 1
3: 34
4: 237
919761458_919761465 9 Left 919761458 1:201100615-201100637 CCTCAGGTCTGGGTGGGCCAGAC 0: 1
1: 0
2: 0
3: 20
4: 230
Right 919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG 0: 1
1: 0
2: 1
3: 34
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919761465 Original CRISPR CTGACTAGACAGAGGGACAA TGG Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900757317 1:4445338-4445360 ATGACTAGAAAGAAGGAGAAGGG - Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904105039 1:28073055-28073077 TTGACTATAAAGAGGCACAAGGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
906340573 1:44976891-44976913 CTTACTAGAAAGAAGCACAAAGG + Intronic
906340609 1:44977343-44977365 TTGACTAGAAAGAAGTACAAAGG - Intronic
907153800 1:52313615-52313637 CTTACCAGCCAGAGTGACAAAGG + Intronic
907869312 1:58428932-58428954 CTGACTACAAAGGGGCACAAGGG + Intronic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
908679766 1:66647751-66647773 CTGCATAAACAGAGGGACACTGG - Intronic
909774105 1:79462875-79462897 CTGAGTAGACACAGAGAGAATGG - Intergenic
912168060 1:107063470-107063492 CAGCCTAGAGAGAGAGACAAAGG - Intergenic
915006369 1:152640964-152640986 CAGACTAGACAGAGACACATAGG + Intergenic
916086591 1:161274807-161274829 CTGGCTAGAAAGAGGGAAGAGGG + Intronic
916520763 1:165561521-165561543 CTGACTAGAAAGAGGTACAGAGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918041763 1:180917956-180917978 CTGAGTAAATAGAGGGACCATGG - Intronic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920301387 1:204991248-204991270 ATGGCCAGACAGAGGGAGAAAGG - Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922450537 1:225733699-225733721 TTGACTAGAGAGAGGCAGAAAGG - Intergenic
923144398 1:231187735-231187757 CTGGGTAGCCAGAGGGACAGCGG + Intronic
923879516 1:238088053-238088075 CTGGCAAGAGAGAGGGAGAAGGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924464995 1:244291650-244291672 GTGAGTGGACAGTGGGACAAAGG + Intergenic
1063332099 10:5170056-5170078 CTCACTAGACATGGGGGCAAAGG + Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1065047853 10:21759862-21759884 CAGAGTAGAGAAAGGGACAAAGG - Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068964893 10:62902072-62902094 CTGACAAGACAAAGGAAAAAGGG - Intronic
1070378547 10:75858173-75858195 CTGAGTAGACAGAGGGGCCAGGG - Intronic
1071713423 10:88071995-88072017 GTGAGTGGACAGAGGGGCAAGGG - Intergenic
1073480858 10:103785343-103785365 CTGACTGGACAGAGGGTCCCCGG - Intronic
1073942438 10:108713876-108713898 CTGAAAAGACACAGGGCCAAAGG + Intergenic
1076470220 10:130713555-130713577 CTGTGTGGACAGAAGGACAAGGG + Intergenic
1076823354 10:132953225-132953247 GTGACCAGCCAGAGAGACAAGGG - Intergenic
1077310400 11:1886411-1886433 TTGAATGGATAGAGGGACAATGG - Intronic
1078159190 11:8826197-8826219 GTGACTAGCAGGAGGGACAAAGG - Intronic
1080877282 11:36288416-36288438 CTTATGAGACAGACGGACAACGG + Intronic
1081429510 11:42961219-42961241 CTCACAAGACAGAGAGAAAATGG + Intergenic
1081429732 11:42963271-42963293 CTTACAAGACAGAGAGAAAATGG + Intergenic
1084495248 11:69499666-69499688 CTGAGTAGACAGAGTGAAAGGGG - Intergenic
1084652522 11:70497570-70497592 CTGACCAGGCACAGGGAAAAGGG + Intronic
1085597687 11:77824720-77824742 TTGACTAGAAAGGGGCACAAGGG + Intronic
1086895155 11:92303742-92303764 ATGGCTAGTCAGAGGAACAATGG + Intergenic
1089235617 11:117022196-117022218 TTGACTGGAAAGAGGCACAAGGG + Intronic
1089256900 11:117198980-117199002 CTGGCTGGAGAGAGGGGCAAGGG - Intergenic
1089940250 11:122409097-122409119 CTGACTAGACAGATGAAATAAGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095846456 12:46751046-46751068 CTGACAAGCCAGAGGGAAAATGG + Intergenic
1096456240 12:51789473-51789495 CTTTCTAGAGATAGGGACAAAGG - Intronic
1097195195 12:57239150-57239172 CTGGCTGCACAGAGGGTCAAAGG + Intronic
1097562102 12:61220321-61220343 CTTACTACACAGAGGAACAAAGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1099107711 12:78517654-78517676 CTGACAAAACACAGGGACATGGG + Intergenic
1099872440 12:88366816-88366838 GTGACTAGAGAAAGAGACAATGG - Intergenic
1100808179 12:98309891-98309913 CTGACTGGAAGGAGGCACAAGGG + Intergenic
1100893568 12:99154361-99154383 CTGTCCAAACAGTGGGACAATGG - Exonic
1103081402 12:118026866-118026888 CTGTGTAGACAGAGGGGGAAAGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1105205645 13:18221390-18221412 GTGACTACACTGAGGGACCAGGG - Intergenic
1106148138 13:27070318-27070340 CTGACCAGAAGGAGGAACAAGGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107014254 13:35695897-35695919 CTGCCTACCCAGAGAGACAAGGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107461241 13:40605726-40605748 CTGACTAGAGAGGTGGAAAAGGG - Intronic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1111373056 13:87342364-87342386 CTGACTAGAAGAAAGGACAATGG - Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115374375 14:32657153-32657175 CTGATTTGACATAGGGAAAAAGG + Intronic
1118223129 14:63873937-63873959 GTGACTTGACAGAGGTACATAGG + Intronic
1119251979 14:73164126-73164148 CTGACTAGACAGAGGTACTAAGG + Intronic
1119456212 14:74757792-74757814 GTGACTAGAAGGAGGCACAAAGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122855780 14:104559486-104559508 CAGACCAGGAAGAGGGACAAAGG - Intronic
1123185859 14:106516260-106516282 CTTATAAGACAGAGGGACACAGG + Intergenic
1125513668 15:40306424-40306446 CTGACTGGGCAGAGGGTCACAGG - Intronic
1126087730 15:45024900-45024922 CTGAGCAGATAGAGGGCCAAGGG - Intronic
1129140471 15:73593448-73593470 GTGACTAGACACAGGGAAATGGG - Intronic
1129304235 15:74647312-74647334 GTGCCTAGACAGAGTGAGAAAGG - Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1137913835 16:52406673-52406695 CTAACTATACAGAGGAAAAATGG + Intergenic
1140715960 16:77725963-77725985 CATACTGGACAAAGGGACAAAGG - Intronic
1141097556 16:81173712-81173734 CTTACCAGACACAGGGACACAGG + Intergenic
1141951716 16:87343999-87344021 CCGACCAGACAGAGGGAAAGGGG + Intronic
1143103233 17:4515301-4515323 CTTACCAGATACAGGGACAAAGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1148289265 17:46429064-46429086 CTCTCTAGACTGAGGGATAAAGG + Intergenic
1148311434 17:46646636-46646658 CTCTCTAGACTGAGGGATAAAGG + Intronic
1148479770 17:47952552-47952574 CTTACTGGACACAGGGTCAAGGG - Exonic
1150253020 17:63719800-63719822 CTGACAAGGAAGAGGGACATAGG - Intronic
1152990697 18:361326-361348 ATGACTAGAGAGAGGGACCATGG - Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG + Intergenic
1160622594 18:80181281-80181303 CTGACTTGGCTGAGGGACCAGGG - Intronic
1161303813 19:3556267-3556289 CAGGCTAGACAGACTGACAAAGG + Intronic
1161863223 19:6814732-6814754 AAGACAAGACAGAGGGAAAAAGG - Intronic
1166518405 19:43463766-43463788 TGGACTAGGGAGAGGGACAAGGG + Exonic
925970592 2:9104012-9104034 CTCAGTAGACAGAGAGACCAGGG - Intergenic
926429023 2:12767163-12767185 GTTATTACACAGAGGGACAAGGG - Intergenic
926838468 2:17051232-17051254 CTCACAAGACAGAGTGAGAAAGG + Intergenic
927153118 2:20206905-20206927 CTGTCTAGAAAGAGGGTGAAAGG + Intronic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929876859 2:45804040-45804062 CTTACTAGACAGAGGGTCCTGGG + Intronic
930115923 2:47718155-47718177 CTGACTAGAAACAGGTAGAAGGG + Intronic
931405522 2:61973907-61973929 TTGACTAGGAAGAGGCACAAGGG - Intronic
931421654 2:62133638-62133660 GTGACTAGACATAGGAAGAAGGG + Intronic
931939387 2:67235141-67235163 CAGACTAGGCAGGGGAACAAAGG - Intergenic
932626836 2:73303276-73303298 CTGACTGGAAAAAGGTACAAGGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
935546676 2:104406697-104406719 ATGACCAGAGAGAGGGACAGAGG + Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
936375748 2:111939971-111939993 CTGATTAGACAGAGGCAGAAGGG - Intronic
936681180 2:114773224-114773246 CTGACTAAAAAGGGGCACAAGGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938883924 2:135623977-135623999 CTGTCTATACAGAGAGACATGGG + Intronic
941115694 2:161469744-161469766 CTGAATAGAAGGAGGGAAAATGG + Intronic
942078714 2:172380812-172380834 CTGGCCAGGCAGAGGGGCAAGGG - Intergenic
942931303 2:181496548-181496570 TTGCCTATACAGAGGGACATAGG - Intronic
944709628 2:202324097-202324119 ATGAAAAGACAGAGGGGCAAAGG + Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
947951452 2:234151214-234151236 CTGACTCAACCGAGGAACAAAGG - Intergenic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1169494624 20:6102776-6102798 CTGACTAGACAGGGAGAAACAGG - Intronic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1174503347 20:51001427-51001449 CTCACTTGAGAGAGGGACAAAGG - Intergenic
1175356894 20:58375615-58375637 CTGACTAGTCAGAAGGACAGTGG + Intergenic
1175899295 20:62353731-62353753 CTGACCTGTCAGAGGGACTAGGG - Intronic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178488284 21:33032462-33032484 CTGACTAGGGAGAGGGACGTGGG + Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180760321 22:18197325-18197347 GTGACTACACTGAGGGACCAGGG + Intergenic
1180770634 22:18381623-18381645 GTGACTACACTGAGGGACCAGGG + Intergenic
1180775348 22:18427371-18427393 GTGACTACACTGAGGGACCAGGG - Intergenic
1180808419 22:18738425-18738447 GTGACTACACTGAGGGACCAGGG - Intergenic
1180828577 22:18884581-18884603 GTGACTACACTGAGGGACCAGGG + Intergenic
1181071346 22:20343390-20343412 GTGACTACACTGAGGGACCAGGG - Intergenic
1181194419 22:21172340-21172362 GTGACTACACTGAGGGACCAGGG - Intergenic
1181215023 22:21320438-21320460 GTGACTACACTGAGGGACCAGGG + Intergenic
1182358940 22:29735384-29735406 CTGGGTGGCCAGAGGGACAATGG + Intronic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1184880214 22:47299843-47299865 CTGAGAAGACAGTAGGACAAGGG - Intergenic
1203232469 22_KI270731v1_random:122795-122817 GTGACTACACTGAGGGACCAGGG + Intergenic
1203278671 22_KI270734v1_random:110570-110592 GTGACTACACTGAGGGACCAGGG + Intergenic
950003791 3:9678181-9678203 CTGAGAGGACAGAGGGCCAAAGG - Intronic
951554029 3:23902803-23902825 CTGTCTAGACTGTGGGATAAAGG + Intronic
953488271 3:43323936-43323958 ATGACTACACAGAGGCACAAAGG + Intronic
953884737 3:46708828-46708850 CTGACTAGACTGAGAGTCACTGG - Intronic
953957894 3:47245643-47245665 CAGACCAGACAAAAGGACAAAGG + Intronic
954361670 3:50125596-50125618 CTGACTTCACTGGGGGACAATGG + Intergenic
955042774 3:55333190-55333212 CTGCCTGGACAGTGGGGCAAAGG - Intergenic
956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG + Intronic
957167127 3:76689814-76689836 CTGACTACACACAGAGAGAACGG - Intronic
958801455 3:98761071-98761093 GTGACTACAAAGAGGAACAAAGG + Intronic
962390300 3:134966069-134966091 CTGGGTACACAGAGGGGCAAGGG + Intronic
962514638 3:136139097-136139119 CTGACTATTTACAGGGACAAAGG - Intronic
962604403 3:137021230-137021252 TTCAATAGACAGAGAGACAAAGG - Intergenic
962980797 3:140487713-140487735 CAGCCTAAACAGAGGGACAAGGG - Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
967782627 3:193456723-193456745 CTGATGAGACAGAGGCACTAAGG + Intronic
969077518 4:4591875-4591897 GTGACAAGACAAAGGGAAAAAGG - Intergenic
969173508 4:5382536-5382558 CTGACCACAGAGAGGGACCAGGG - Intronic
970763734 4:19521684-19521706 CAGACTATTCTGAGGGACAAAGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971907445 4:32745538-32745560 CTCACATGACAAAGGGACAAAGG + Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
972761902 4:42114707-42114729 CTGGCTACACAGAGGCCCAATGG + Exonic
973713850 4:53655645-53655667 CAGATTTGATAGAGGGACAAGGG - Intronic
974883260 4:67785334-67785356 ATGAGAAGACAGAGGGTCAAAGG - Intergenic
976540918 4:86274698-86274720 CTGATTAGGCAGAGGAACAGAGG + Intronic
978843932 4:113249486-113249508 CTGTGTGGACAGAGGGTCAATGG - Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981655269 4:147105380-147105402 CTGACCAGAAAGAGGAAAAATGG + Intergenic
983279667 4:165664810-165664832 CTGAATAGACTGAGGGACCATGG + Intergenic
986057736 5:4155129-4155151 ATGAGCAGAGAGAGGGACAAGGG - Intergenic
987352934 5:17037298-17037320 GGGACTAGACAGAGGGAGATGGG - Intergenic
988123607 5:26999591-26999613 CTCATTTGACAAAGGGACAAAGG + Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
992150260 5:73895543-73895565 CTGAAGTGACAGTGGGACAAAGG + Intronic
994244703 5:97466702-97466724 CTGAAGAGAGAGAGGAACAAAGG - Intergenic
996978132 5:129459714-129459736 CTGACCAGAAAAAGGGACCAAGG - Intergenic
997210544 5:132074464-132074486 CTGACTACAGAGAGGCACAGAGG + Intronic
998158532 5:139799840-139799862 CTGACTAGAGATAGGGAGAGTGG + Intronic
1000428652 5:161123461-161123483 TTGACTGGACAGAGGCAAAAGGG + Intergenic
1002360887 5:178669907-178669929 CGGAATAGACTAAGGGACAAAGG + Intergenic
1004233243 6:13851487-13851509 CTGAGGAGGCAGAAGGACAAAGG - Intergenic
1004277282 6:14249448-14249470 TTGACTAGAAAGAGGGAAAAGGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004526603 6:16414792-16414814 TTGAGTAGAAAGAAGGACAAAGG - Intronic
1005416480 6:25605332-25605354 CTAAGAAGTCAGAGGGACAAGGG - Intronic
1007079498 6:39088938-39088960 CTCACTAGACTGAGAGAAAAGGG - Intergenic
1007719504 6:43876788-43876810 CTGTCCAGGCAGAGAGACAAAGG - Intergenic
1008958178 6:57238918-57238940 GTGACTAGACAGCACGACAAAGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011749917 6:90445013-90445035 CAGAATAGAAAGAGAGACAAAGG + Intergenic
1012958198 6:105593350-105593372 GTGACTTGTCAGATGGACAATGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018269742 6:162064267-162064289 CTGACTAGAAAAAGAGATAAGGG + Intronic
1021799696 7:24292230-24292252 CATATTAGACAGAGGGATAAAGG - Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025751552 7:64298229-64298251 CTGGCTAGACTTAGGGACACAGG - Intergenic
1026993704 7:74602346-74602368 ATTGCTAGAGAGAGGGACAAAGG - Exonic
1028729606 7:94130739-94130761 CAGAGAAGACAGAGGGACAGAGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028859841 7:95636775-95636797 CTGTCTAGGCAGAGAGACAAAGG - Intergenic
1029897184 7:103995463-103995485 CTGACTGGGCATAGGGATAAAGG + Intergenic
1030359090 7:108576539-108576561 CAGAATAGACAGAGGGGCAATGG + Intergenic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035957686 8:4100381-4100403 CTGACTAGACACAGGGAAGGTGG - Intronic
1037425187 8:18747936-18747958 CTGGCAAGAGAGAGGGAGAAAGG + Intronic
1037449453 8:19001990-19002012 TTGACTAGACAAGGGGAGAAGGG + Intronic
1038291136 8:26250934-26250956 TTGACTGCACAGAGGCACAAAGG + Intergenic
1038313732 8:26465435-26465457 CTTAATAGTCAGAGGGACCAGGG - Intronic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1042209462 8:66365130-66365152 CTGAATACAGAGAGGAACAAAGG - Intergenic
1042276056 8:67006699-67006721 TTTACTTTACAGAGGGACAAGGG - Intronic
1044687053 8:94836249-94836271 CTGACTAGAAAAAAGGGCAAAGG - Intronic
1046950966 8:120019429-120019451 CTGACTTGAAAGAGGCACAAGGG - Intronic
1048025066 8:130578503-130578525 CTGGCTTGGCAGAGGGACCAGGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050023753 9:1311552-1311574 CTGACAGGACAGAGAGATAATGG + Intergenic
1051530502 9:18097066-18097088 CTGACTAGGAAGGTGGACAAGGG - Intergenic
1052223250 9:26053167-26053189 CTGACTAGGCAGAGGGAAAGGGG + Intergenic
1053619742 9:39802977-39802999 GTGACCAGGCAGAGGGACAATGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053894740 9:42732073-42732095 GTGACTAGGCAGAGGGGCAATGG - Intergenic
1054264417 9:62904466-62904488 GTGACCAGGCAGAGGGACAATGG - Intergenic
1055029995 9:71764436-71764458 CTGACTGGAAACAGGGACAAAGG + Intronic
1055763411 9:79634627-79634649 CTGACTACAAAGAGTAACAAGGG - Intronic
1056143708 9:83708387-83708409 CAGAGTAGACAGAGAGGCAAGGG - Intergenic
1057150408 9:92791545-92791567 GTGACCAGGCAGAGGGGCAATGG + Intergenic
1057828967 9:98392806-98392828 ATGAGTAGACAGATGGACAGTGG - Intronic
1058111267 9:101032953-101032975 CTGACAAGAAAGGGGGAAAAGGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059607968 9:115856842-115856864 CTGACTAGGAAGATGGACATTGG + Intergenic
1060288592 9:122278347-122278369 CTTACTAGAAAGAAGCACAAAGG - Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060530556 9:124345022-124345044 CTGAGATGTCAGAGGGACAAGGG - Intronic
1060578799 9:124724766-124724788 CTGGCCAGATAGAGGGTCAAAGG - Intronic
1060900382 9:127252040-127252062 ATGACTAGACAAAGGAAAAAGGG - Intronic
1062550140 9:137082379-137082401 CTGACCAGAGAAAGGGGCAAGGG - Intronic
1186412499 X:9356337-9356359 CTGACGGGACTGAGGGACAAAGG + Intergenic
1187429787 X:19211467-19211489 CTGACTGGACAGGGGGTCCAAGG + Intergenic
1188576950 X:31663156-31663178 CTGCCAAGACAGAGAGAGAAGGG - Intronic
1188971424 X:36620878-36620900 CTGTCTAGATAGAGGTACAGGGG - Intergenic
1192607134 X:72529968-72529990 CAGTCTTGGCAGAGGGACAAAGG - Intronic
1194845488 X:98802201-98802223 GTCACTAGACAGAGAAACAATGG + Intergenic
1194894031 X:99416421-99416443 CTGACTAGACGAAGTCACAAGGG - Intergenic
1195091999 X:101469701-101469723 TTGACTAGAAACAGGCACAAAGG - Intronic
1196060461 X:111402892-111402914 CTATCTTGACAGGGGGACAAAGG + Intronic
1196527344 X:116741524-116741546 CTGGGTATAGAGAGGGACAACGG - Intergenic
1196919344 X:120569707-120569729 ATTACAAGACAGAGTGACAAAGG + Intronic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197857064 X:130925752-130925774 CTGACTGCACAGGGGCACAAGGG - Intergenic
1200207135 X:154324589-154324611 CTGACTGGAAGGAGGCACAAGGG + Intronic