ID: 919761706

View in Genome Browser
Species Human (GRCh38)
Location 1:201102217-201102239
Sequence GGCAGGCTCCAGACTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 1, 2: 4, 3: 48, 4: 388}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919761696_919761706 6 Left 919761696 1:201102188-201102210 CCTGGAGTCCAGTGCCTGGTGAA 0: 1
1: 0
2: 1
3: 22
4: 209
Right 919761706 1:201102217-201102239 GGCAGGCTCCAGACTGGGCAGGG 0: 1
1: 1
2: 4
3: 48
4: 388
919761699_919761706 -2 Left 919761699 1:201102196-201102218 CCAGTGCCTGGTGAAGTGTGGGG 0: 1
1: 0
2: 5
3: 35
4: 508
Right 919761706 1:201102217-201102239 GGCAGGCTCCAGACTGGGCAGGG 0: 1
1: 1
2: 4
3: 48
4: 388
919761702_919761706 -8 Left 919761702 1:201102202-201102224 CCTGGTGAAGTGTGGGGCAGGCT 0: 1
1: 0
2: 1
3: 7
4: 168
Right 919761706 1:201102217-201102239 GGCAGGCTCCAGACTGGGCAGGG 0: 1
1: 1
2: 4
3: 48
4: 388
919761695_919761706 9 Left 919761695 1:201102185-201102207 CCTCCTGGAGTCCAGTGCCTGGT 0: 1
1: 0
2: 0
3: 38
4: 252
Right 919761706 1:201102217-201102239 GGCAGGCTCCAGACTGGGCAGGG 0: 1
1: 1
2: 4
3: 48
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919761706 Original CRISPR GGCAGGCTCCAGACTGGGCA GGG Intronic
900122330 1:1054177-1054199 GGCAGGCTCCGGGCAGGGCCGGG - Intronic
900461803 1:2805317-2805339 GGCAGCCTGCAGGCAGGGCAGGG + Intergenic
901078664 1:6571361-6571383 GGCAGGAACCACGCTGGGCAGGG - Intronic
901148472 1:7084520-7084542 GGGAGGCTCCCGTCTGTGCAGGG - Intronic
901207798 1:7507376-7507398 TGCAGGCTGCAGGCTGGGGAGGG + Intronic
901211357 1:7527868-7527890 GGCAGGTTCCAGAAAGGGCAGGG - Intronic
901636929 1:10674856-10674878 GGTCAGCTCCAGACTGGGCCTGG - Intronic
901758256 1:11454443-11454465 GGCAGGGTCCAGGCTGGGACTGG - Intergenic
901883107 1:12205374-12205396 GGCAGGCTCCAGATCAGACAGGG + Intronic
902038174 1:13472888-13472910 GGCATGAGCCAGGCTGGGCATGG - Intergenic
902823715 1:18958290-18958312 GGCAGTGTCCAGACTGGGTTGGG - Intergenic
902980638 1:20120332-20120354 GGCAGGTTCCTGGCTGGGCACGG + Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904274300 1:29370199-29370221 GGCTGGCTCTAGGCTGGGCCAGG + Intergenic
905037284 1:34926430-34926452 AGCAGCCTTCAGACTGGGGAGGG + Intronic
905269903 1:36781034-36781056 GGCAGGCCCCAGCCCGGGCTGGG + Intergenic
905481346 1:38264127-38264149 GTTAGACTCCACACTGGGCAAGG + Intergenic
905708404 1:40080131-40080153 GGCAGGTTGCTGACTGGGCGAGG - Intronic
905876072 1:41432855-41432877 GGCAGGCTCCCTGCTGGCCATGG + Intergenic
906613736 1:47221083-47221105 GGCAGGGTCCAGACTCCACAGGG + Intronic
906778663 1:48552766-48552788 GGCAGGATCTTGACTGGGAAGGG + Intronic
907384759 1:54118779-54118801 GGCAGCCGCCAGTCTGGGAAGGG - Intergenic
907487271 1:54786754-54786776 GGCTGGGGCCAGACTGGGTATGG + Intronic
907753978 1:57291611-57291633 GGCAGGCATCAGAGGGGGCATGG + Intronic
909482693 1:76142552-76142574 GTGTGGCTCCTGACTGGGCAGGG + Intronic
910619959 1:89242601-89242623 GGCAAGATCCAGGCTGGGCGCGG - Intergenic
915031933 1:152887033-152887055 TGGAGTCTCCAGGCTGGGCAGGG - Intergenic
915300480 1:154948540-154948562 TCCTGCCTCCAGACTGGGCAGGG - Intronic
915448302 1:155987445-155987467 GTTCGGCTCCAGGCTGGGCATGG + Intronic
918103925 1:181400423-181400445 GGGAGGCTGCAGACTGGCCGTGG + Intergenic
918775885 1:188629702-188629724 GGCAAGCTCCTGACTGGGATGGG + Intergenic
919123871 1:193373330-193373352 CTCAGACTCCAGGCTGGGCATGG - Intergenic
919738378 1:200967921-200967943 GGCCAGCTGCAGACTGGGCAGGG - Intergenic
919761706 1:201102217-201102239 GGCAGGCTCCAGACTGGGCAGGG + Intronic
920043189 1:203117137-203117159 GGCTGGCCCTCGACTGGGCATGG - Intronic
920074436 1:203326148-203326170 GGCATGCTCCAGGCTGGGCCAGG + Intergenic
920312661 1:205057865-205057887 GCCAGGCTCCAGCCAGGCCAAGG + Intronic
920789904 1:209080227-209080249 AGCAGGCAACACACTGGGCAGGG - Intergenic
922974394 1:229771488-229771510 GGCAGGCCCCAGTGGGGGCAAGG + Intergenic
923975279 1:239255790-239255812 GGTGGGCACCACACTGGGCACGG - Intergenic
924196243 1:241610173-241610195 GGCAGTTTGCAGCCTGGGCATGG - Intronic
924796333 1:247295316-247295338 GGCATGCTCCTTGCTGGGCAAGG - Intergenic
1063173650 10:3532721-3532743 GGCAGGCACCATCCTGGCCAGGG - Intergenic
1065072498 10:22040368-22040390 GGCAGGACTCAGACTGGACATGG + Intergenic
1065726222 10:28670098-28670120 GTCAGACTGCAGCCTGGGCAGGG - Intergenic
1065845381 10:29738745-29738767 GGCAGAGGGCAGACTGGGCAAGG - Intergenic
1066407065 10:35127708-35127730 GGCAGTCTCCGGAGTGGGAAGGG + Intronic
1066488780 10:35874069-35874091 TGCAGGGTCCAGGCTGGGCATGG - Intergenic
1067238049 10:44468212-44468234 GGCAGGCTGCATACTGACCATGG + Intergenic
1067474463 10:46556732-46556754 GGCAGGCTCCAGAGTGGCACGGG - Intergenic
1069598329 10:69687043-69687065 GGCAGGCACCAGGCTCAGCAGGG - Intronic
1070420310 10:76229748-76229770 GGGAGGATCCAGTCTGGGCTTGG + Intronic
1071385056 10:85111556-85111578 CTCAGGGTTCAGACTGGGCAGGG + Intergenic
1072163524 10:92789773-92789795 AGCAGGGGCCAGGCTGGGCATGG - Intergenic
1072248931 10:93566758-93566780 GGCTTGCTCCAGGCTGCGCAAGG - Exonic
1072257068 10:93630714-93630736 GGCACGCTGCAGCCTGGGGAAGG - Intronic
1075564580 10:123494243-123494265 GCCAGGCTCCATGCTGGGCTCGG + Intergenic
1076053984 10:127356568-127356590 GGCAGGCCCCACACCAGGCAGGG + Intronic
1076118624 10:127918695-127918717 GCCAGGATGCTGACTGGGCAGGG - Intronic
1076514017 10:131033096-131033118 GGCAGGCTGCTGAGTGGCCAAGG + Intergenic
1076842079 10:133050629-133050651 AGCCGGCTCCAGGCTGGGGAGGG - Intergenic
1077404216 11:2375645-2375667 GGCTGGCTGCTGGCTGGGCATGG + Intergenic
1077480226 11:2811137-2811159 GACAGGCTCCAGACAGGACACGG - Intronic
1078438546 11:11345284-11345306 GGCAGGGTCCAGAAGTGGCAGGG - Intronic
1080625676 11:34028605-34028627 GGCAGGCTACAGCCTGGACTAGG - Intergenic
1080940156 11:36907549-36907571 TGATGGCTCCAGACTGGTCAGGG - Intergenic
1082012023 11:47456483-47456505 AGCAAGCTGCAGACTGGGCGTGG + Intergenic
1082785175 11:57312834-57312856 GACTGGCTCCAGGATGGGCAAGG + Exonic
1083340360 11:61955242-61955264 CCCAGGCTCCAGACAGGCCAGGG + Intronic
1083391269 11:62352293-62352315 GGAAGCCTCAAGGCTGGGCACGG + Intronic
1083895180 11:65616229-65616251 CTCAGGCGCCAGACGGGGCATGG + Exonic
1084329907 11:68424204-68424226 CTCAGGCTCCAAACTGAGCACGG + Intronic
1084402812 11:68955157-68955179 TGCAGGCTCCATGCTGGGCTTGG + Intergenic
1084684194 11:70684272-70684294 GGCACACTCCTGGCTGGGCACGG + Intronic
1084746739 11:71175253-71175275 GGCAGGTTCCTGGATGGGCATGG + Intronic
1085130211 11:74031837-74031859 GCCAGGATCCAGGATGGGCAAGG + Intronic
1087153555 11:94879930-94879952 GGCAGGGGTCAGACTGTGCAGGG - Intergenic
1087192452 11:95269249-95269271 GACAGGGTCCAGATTGTGCAGGG - Intergenic
1088593869 11:111425308-111425330 GGCAGGCTCCATGCTGATCATGG + Intronic
1089093243 11:115896456-115896478 TGCAGAGTCCAGACTGGACACGG + Intergenic
1089467944 11:118697634-118697656 GCCCTGCTCCAGACTTGGCAAGG + Intergenic
1089598874 11:119600881-119600903 GGCTGGCCCCAGGCTGGGCTAGG + Intergenic
1089607359 11:119649088-119649110 AGCAGGCTCCAGGCCGGGCACGG + Intronic
1089710508 11:120311164-120311186 AGCAGGGGCCAGACTGTGCAGGG + Intronic
1091361351 11:134980891-134980913 GGGAGGTCCCAGGCTGGGCAAGG + Intergenic
1091452354 12:581268-581290 GACAGGCTACAGACAAGGCAGGG + Intronic
1091595067 12:1872744-1872766 GGCAGCCTCCACTCTGTGCAGGG - Intronic
1092106129 12:5922739-5922761 GGCAGGGTCCAGAGGGGGCCAGG - Exonic
1094089121 12:26628738-26628760 GCAAGGCTCCAGACTGTGCTAGG + Intronic
1096679841 12:53248353-53248375 GGGAGACTCCTGTCTGGGCATGG - Intergenic
1096809787 12:54161937-54161959 GACAGGCTCCAGGCTGAGCAAGG + Intergenic
1097422710 12:59400112-59400134 GTCAGGCTCCAGGCAGAGCATGG - Intergenic
1101970725 12:109310099-109310121 GGCTGGCTCCAGGCGGGGCGGGG - Intergenic
1102964088 12:117112868-117112890 GGCAGGTTCCTGTCTGGGCGTGG + Intergenic
1103281478 12:119761343-119761365 GGCAGACTCCAGAATGAGAAGGG + Intronic
1103301787 12:119933276-119933298 GGCAGATTCCAGGCTGGGCCTGG + Intergenic
1103449316 12:121017014-121017036 TGCAGAATCCAGGCTGGGCACGG + Intergenic
1104411310 12:128560345-128560367 GGTAAGGTCCAGAGTGGGCAGGG - Intronic
1104574979 12:129958450-129958472 GACAGGAGCCAGGCTGGGCACGG - Intergenic
1104919092 12:132281284-132281306 GGGAAGCTCCAGGCTGGGCGTGG + Intronic
1105719833 13:23102115-23102137 GGCAGGGTCCAGAGTAGGAAGGG + Intergenic
1106556231 13:30810668-30810690 GGCAGGCCCCAGACATGCCATGG - Intergenic
1106719999 13:32427536-32427558 GGCTGGCCCCAGGCGGGGCACGG + Intronic
1114211613 14:20620384-20620406 GCCATGCCCCAGTCTGGGCATGG - Intergenic
1114222940 14:20713310-20713332 GGCAGTCTCCAGACTCTCCAGGG + Intergenic
1115284923 14:31705880-31705902 GGCAGGCCCTGCACTGGGCATGG - Intronic
1115940540 14:38603581-38603603 GGAAGACTGCAGACTGGTCAAGG - Intergenic
1118255446 14:64201437-64201459 GGCCGGCTGCAGCCTGGCCATGG + Intronic
1118634350 14:67734111-67734133 GGCAGATCCCAGGCTGGGCATGG + Exonic
1119175387 14:72564658-72564680 GCCAGGCTGCAGACAGGGCAGGG + Intronic
1119348353 14:73944354-73944376 GGCTGGCTCCAGAATGGACTTGG + Exonic
1119774125 14:77238013-77238035 AGCAGACACCAGACTGGTCAAGG - Intronic
1120552927 14:85893387-85893409 AGTAGGATCCAGACTGGGTAGGG - Intergenic
1121146008 14:91582937-91582959 GGCAGGCTCAGGGCTGAGCAAGG + Intronic
1121238534 14:92411426-92411448 GGCAGGTCTCACACTGGGCATGG - Intronic
1121654029 14:95581894-95581916 GGGAGGACCCAGAGTGGGCACGG - Intergenic
1122082405 14:99274680-99274702 GGCCGGCTCAAGGCTGGGCAGGG - Intergenic
1122232918 14:100316023-100316045 GCCAGGCCCCACGCTGGGCAGGG - Intergenic
1122410945 14:101525929-101525951 GGCAGCGTCCAGACTGGGCCAGG - Intergenic
1122412765 14:101534407-101534429 GGCAGGACCCAGGCTGGGCCGGG + Intergenic
1122556819 14:102585083-102585105 GGCAGGCTCTGTGCTGGGCACGG + Intergenic
1122880135 14:104687113-104687135 GGGAGGCTCCAGGCAGGCCATGG + Intergenic
1123071056 14:105642741-105642763 GGCATGCCCCCGAGTGGGCATGG + Intergenic
1123076016 14:105667782-105667804 GGCATGCCCCCGAGTGGGCATGG + Intergenic
1123443698 15:20306814-20306836 GCCAGGGTCAAGACTGGGCCAGG - Intergenic
1123991733 15:25688430-25688452 GGCAGGCTCCTGCCTGTCCATGG - Intronic
1124656882 15:31516101-31516123 AGGAGGCTCCATGCTGGGCATGG - Intronic
1126166329 15:45657243-45657265 TGCAGGCTCCACACGGGCCAGGG - Intronic
1128145144 15:65328877-65328899 GGCAGGCTCCAGAGGGTGGACGG - Exonic
1128543703 15:68553829-68553851 GGCAGGGCCCAGACCGTGCAGGG + Intergenic
1128809766 15:70562252-70562274 GTCAGGCTCCGGAAAGGGCATGG - Intergenic
1129232844 15:74206233-74206255 TGCCCGCACCAGACTGGGCAGGG - Intronic
1132467218 16:82906-82928 GGCAGGATGGAGACGGGGCAAGG + Intronic
1132605309 16:791240-791262 GGCCGGCTCAACACTGGGCCTGG - Exonic
1132774656 16:1586373-1586395 GAGAGGCACCAGACTGGGCGAGG - Intronic
1132831961 16:1932819-1932841 GGCAGGCCACAGGCTGGGCTAGG + Intergenic
1132840330 16:1975723-1975745 CGCAGCCTCCAGACTGAGCAAGG - Intronic
1132897150 16:2234477-2234499 GGCTGGGTCAAGACTGAGCATGG - Intronic
1136268301 16:29133439-29133461 GGCCAGCTCCAGCCTGGGCACGG - Intergenic
1136378517 16:29879593-29879615 GGCAGGCTGGAGAGTGGGCAGGG - Intronic
1136504561 16:30694683-30694705 GGCATGATCCAGGCCGGGCACGG - Intergenic
1136651838 16:31679638-31679660 GGCAGGATCCAGGCAGAGCATGG - Intergenic
1136671474 16:31862385-31862407 GGCAGGATCCCGACAGAGCATGG - Intergenic
1137248670 16:46727397-46727419 GGCAGGCACCAGCCTAAGCAAGG + Intronic
1137266496 16:46873363-46873385 GGCATGCTCAAGAGAGGGCATGG + Intergenic
1137427441 16:48391506-48391528 AGCAGGCTCAAGGCTGGGCAAGG + Intronic
1138562100 16:57807405-57807427 GCCAGGCTCCTCAGTGGGCATGG + Intronic
1141002108 16:80317830-80317852 GGCAGGCGCCAGTGTGGGCAAGG + Intergenic
1141101746 16:81202562-81202584 GGCCGGCTCCTGACTGGGACAGG + Intergenic
1141538446 16:84699862-84699884 GGCAGGCTCCAGGCGGGGCAGGG + Intergenic
1141627364 16:85268423-85268445 GGCAGGGGCCAGACGGGGAAGGG - Intergenic
1142071609 16:88093773-88093795 GGCCAGCTCCAGCCTGGGCAGGG - Intronic
1142274942 16:89113456-89113478 GGCAGGCCCCAAGCTGAGCAGGG + Intronic
1142402752 16:89869470-89869492 CGCAGGTCCCAGACTGGGGAGGG + Intronic
1142525084 17:534625-534647 AACATGCTCCGGACTGGGCATGG + Intronic
1142667547 17:1471361-1471383 GGCAGGCTGCTGACTGGGGTGGG - Intronic
1142706620 17:1699119-1699141 GGCAGACTCTAGGCTGGGCACGG - Intergenic
1143324620 17:6090646-6090668 GACAGGCTCCTGGCAGGGCAGGG + Intronic
1143455585 17:7065521-7065543 GGCAGGATGAAGGCTGGGCATGG + Intergenic
1143701924 17:8666929-8666951 GTCAGACTCCAGACTGAGGAGGG - Intergenic
1145361028 17:22212533-22212555 GGCAGGCTGCACACTGGGCTTGG + Intergenic
1145746742 17:27325544-27325566 GACAGGGTCCAGACAGGGGAGGG - Intergenic
1146686422 17:34844437-34844459 GGCAGGCCCCAGACAGGCTATGG - Intergenic
1146719740 17:35115577-35115599 GAAAGGCTAGAGACTGGGCATGG + Intronic
1147419360 17:40314489-40314511 GGCAGGCTGCAGTGGGGGCAGGG + Intronic
1147674898 17:42198404-42198426 AGCCAGCTCCAGGCTGGGCATGG + Intergenic
1147698876 17:42379046-42379068 GGCTGACACCAGACTGGGCAGGG + Intronic
1148090222 17:45018935-45018957 GGCAGGGGCCAGACAGCGCAGGG + Intergenic
1148773412 17:50079679-50079701 GGGAGCCTCCAGACAGAGCAGGG + Intronic
1150248940 17:63695548-63695570 GCCAGGCCCCACCCTGGGCAAGG - Exonic
1150647427 17:66987923-66987945 GGCATGCTCGAGACTGGGCATGG + Intronic
1151499460 17:74479795-74479817 GTCAGGCTCCAGGCAGGGCAAGG - Intronic
1151540889 17:74764056-74764078 GGGAGGCGCCAGGCTTGGCAGGG - Intronic
1151814452 17:76464553-76464575 GGCATGGTACACACTGGGCAGGG + Intronic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152083841 17:78205391-78205413 GCCAGGCTCCAGGCGGAGCAAGG - Intronic
1152528486 17:80903143-80903165 GGCCGGCTCCAGGCTCCGCAGGG - Intronic
1153499114 18:5730359-5730381 GGCAGGCCCAAGGCTGGGCTGGG - Intergenic
1154493948 18:14942033-14942055 GGGAGGTGCCAGGCTGGGCAAGG - Intergenic
1155067336 18:22279293-22279315 GCCAAGCTCCAGTCTGGGGAGGG + Intergenic
1155537572 18:26832970-26832992 GGCAGGCACCAGAAATGGCAAGG - Intergenic
1156473693 18:37392992-37393014 GTCAGGCCCCATGCTGGGCATGG - Intronic
1157322308 18:46644140-46644162 GGCAGCCTGCAGGCTGGGCTGGG - Intronic
1157437853 18:47686456-47686478 GGCAGGCTTCAGGATTGGCAGGG + Intergenic
1158592490 18:58789575-58789597 GGAAGGCTCTGGGCTGGGCAGGG - Intergenic
1158951551 18:62499736-62499758 GGCAGGCTGCAGATGGGACAGGG + Intergenic
1160492213 18:79347958-79347980 GGCAGGGTCCAGGAAGGGCAGGG + Intronic
1161051300 19:2165146-2165168 GCCACGCTCCGGGCTGGGCAGGG + Intronic
1161333423 19:3698976-3698998 TGCCAGCTCCAGACTGAGCATGG - Intronic
1161363938 19:3867993-3868015 GGAAGTTTCCCGACTGGGCAGGG - Intronic
1161402780 19:4075764-4075786 GGCAGGCTCAAGGCTGGGCGCGG + Intergenic
1161535673 19:4817412-4817434 GACCGGCTCCAGAATAGGCAAGG + Exonic
1161728936 19:5947021-5947043 AGCAAGCTCCAGGCCGGGCACGG + Intronic
1161911442 19:7197492-7197514 GGCAGGTTCCAGAGTGGGAGTGG + Intronic
1162067765 19:8136573-8136595 CCCAGGCTCCAGACTGGGGCGGG - Intronic
1162651295 19:12091031-12091053 TGCAGGCTCCAGGCTGGTCTTGG - Intergenic
1162998166 19:14349621-14349643 TCCTGGCTCCAGACTCGGCATGG - Intergenic
1163313237 19:16526286-16526308 GGCAAACTCCAGCTTGGGCAGGG + Intronic
1163404522 19:17113814-17113836 GGCAGGCAGGAGACGGGGCAGGG + Intronic
1163756834 19:19111339-19111361 GGCTGGCCCCATCCTGGGCAGGG - Exonic
1163862696 19:19750437-19750459 GGCATGCTCCTGGCTGGCCAGGG - Intergenic
1165692917 19:37877701-37877723 GGAATGCTTTAGACTGGGCATGG + Intergenic
1165856831 19:38883970-38883992 GGCAGGGGCCAGGCTGGGCATGG + Intronic
1165962928 19:39550598-39550620 GGCAGACTGCAGACTGGGGGAGG - Intergenic
1166141896 19:40809680-40809702 GGGAGGCTGCAGTCTGGGGATGG - Intronic
1166233018 19:41436665-41436687 AGTAATCTCCAGACTGGGCAGGG - Intronic
1167141076 19:47651193-47651215 GGAGGGCTCCGGACAGGGCAGGG - Intronic
1167477030 19:49706982-49707004 TCCAAACTCCAGACTGGGCATGG + Intronic
1167499817 19:49839191-49839213 GGCAGGCCCAACACTGGGAAAGG + Intergenic
1167685405 19:50952841-50952863 AGCAGCCTCCAGACAGGGCAAGG + Exonic
925308748 2:2867092-2867114 GGCAGACTCCAGGCTCGGCGGGG + Intergenic
925389842 2:3487238-3487260 GGCAGCCTCCAGAATGGGGAGGG - Intergenic
926728723 2:16018483-16018505 GGCAGAATCTAGGCTGGGCATGG - Intergenic
926813247 2:16775111-16775133 GGAAGACTGCAGACTGGGGAAGG - Intergenic
926892540 2:17650445-17650467 GCCAGGCTCCAGGCTGGGTCTGG - Intronic
926945771 2:18185908-18185930 AGCTGGCTCCAGTCTGGGGAAGG + Intronic
927026947 2:19078124-19078146 GGCAGGCTGCAGGCTGGGCATGG + Intergenic
927189744 2:20509425-20509447 GTCAGGCTCCAGGCAGGGCCTGG - Intergenic
927717617 2:25362755-25362777 GCCAGGATCCAGGCTGTGCACGG + Intergenic
927948178 2:27149804-27149826 AGCAGGATTCAGATTGGGCATGG + Intronic
928123999 2:28603790-28603812 GGCAGGCTTCAGGCCTGGCAGGG - Intronic
929486759 2:42361554-42361576 GGCGGGCTCCAGGCGGGGCCTGG + Exonic
929965142 2:46529014-46529036 GGCAGCCTCCAGAGGGGCCAAGG + Intronic
931370129 2:61654669-61654691 TGCAGGCTCCAGAGTGAGTAGGG + Intergenic
932267270 2:70378476-70378498 TTAAGGCTCCAGTCTGGGCATGG - Intergenic
932329384 2:70889084-70889106 GGCGGGTTCCGGACTGGGCTCGG - Intergenic
932405796 2:71512025-71512047 GGCAGCCTCCAACCTGGGGAGGG - Intronic
933767570 2:85720503-85720525 GGCAGGGGCTAGATTGGGCAGGG + Intergenic
934925516 2:98379538-98379560 GGCAAGCTCCAGGCAGGGCCGGG + Intronic
934929739 2:98412027-98412049 GGCAGCCTGCAGGCAGGGCAGGG + Intergenic
935070009 2:99685894-99685916 GACAGGATCCAGGCCGGGCATGG + Intronic
935127905 2:100240111-100240133 GGCAGCCTCCAGGCTGAGCTGGG - Intergenic
937524334 2:122748585-122748607 GGCAGGCCACAAACTGGGCTTGG - Intergenic
938422380 2:131155391-131155413 GGGAGGCTCCAGAAGGTGCAGGG - Intronic
939211874 2:139185886-139185908 AAAAGGCTCCAGACTGGGCGTGG - Intergenic
940355497 2:152737629-152737651 GGCAGGCAAGAGACTGTGCAGGG + Intronic
944240464 2:197480747-197480769 GGCAGTCACCAGACTGGGTGAGG + Intergenic
946415740 2:219538860-219538882 GGCAGGCCCCAGCAGGGGCAGGG + Intergenic
946676077 2:222161222-222161244 TGCAGGCTCCATGCTGGGAAAGG + Intergenic
947050049 2:226031504-226031526 GGCTGCGTCCAGACAGGGCATGG + Intergenic
947872135 2:233445101-233445123 GGTAGCCTCCAGACTGAGGATGG + Intronic
948568513 2:238901684-238901706 GGCTGGGTCCAGACTCGGCAGGG + Intronic
948694371 2:239725794-239725816 TGCAGCCTCCAGCCTGGGCCTGG + Intergenic
948920311 2:241063278-241063300 CGCAGGCTCCAGGGAGGGCAAGG + Intronic
1169217535 20:3802176-3802198 GGCAGGTGGCAGCCTGGGCATGG + Intronic
1169574370 20:6941845-6941867 GGCAGGCTGCACAGGGGGCAAGG + Intergenic
1171035021 20:21707180-21707202 GGAGGGCTCCACACTGGCCAGGG + Intronic
1171189074 20:23145532-23145554 GTCAGTCTGCAGACTTGGCATGG + Intergenic
1172233563 20:33353671-33353693 GACAGGCTTCAGATTGGACAAGG + Intergenic
1172240227 20:33408214-33408236 GGCAGGTCCCAGACTCGGAATGG + Exonic
1172778186 20:37420194-37420216 GGCAGGGGCCAGACGGGGCCTGG - Intergenic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173009547 20:39169399-39169421 GACAGGCAGCAGACTGTGCAGGG - Intergenic
1173706049 20:45111043-45111065 GGCAGGGCCCAGACCAGGCATGG - Intronic
1174092940 20:48063797-48063819 GGCAGGCTGGAGCCTGGGGAGGG + Intergenic
1174517097 20:51101050-51101072 GAAAGGCTCCAGGCTGGGCACGG + Intergenic
1174563367 20:51446888-51446910 GTCAGACTCCAGACAGGGCTGGG - Intronic
1175369173 20:58475723-58475745 TGCAGACTCCAGACTGGGAAAGG - Intronic
1175503787 20:59468164-59468186 GGCAGGCGCATGACAGGGCATGG + Intergenic
1175660213 20:60805962-60805984 TGCTGGCTCCAGACATGGCAGGG + Intergenic
1175709601 20:61208820-61208842 GGCAGGCTCTAGGCTGGTCTGGG + Intergenic
1175835205 20:61989307-61989329 GGGAAGCTGCAGAGTGGGCAGGG + Intronic
1175878171 20:62240256-62240278 GGCAGGCACTGGGCTGGGCAGGG - Intronic
1176072818 20:63235740-63235762 GGCAGACACCAGCCTGGGGAGGG + Intergenic
1176111750 20:63414058-63414080 CCCAGGCTCCCGGCTGGGCAGGG + Intronic
1176289900 21:5038218-5038240 GGATGGCTGCAGCCTGGGCAGGG - Intronic
1176866849 21:14058722-14058744 GCCAGGGTCCAGGCTGGGCCAGG + Intergenic
1178137610 21:29645488-29645510 GGCGGGCTCCATATTGGGAAAGG + Intronic
1178895060 21:36551074-36551096 GGCAGCCACCAGAGTGGGGAGGG + Intronic
1179890949 21:44334831-44334853 GGCGGGCAGCAGGCTGGGCACGG + Intronic
1179958503 21:44754615-44754637 GCCAGGCTGCAGGCTGTGCAAGG - Intergenic
1181107397 22:20583247-20583269 GGTAGGCTGCAGCCAGGGCAGGG + Exonic
1181276141 22:21688500-21688522 GGCAGGCCCCAGGCGGGGCTGGG + Intronic
1181951569 22:26557555-26557577 GGCAAGCTCTAGACTGTGCCAGG + Intronic
1181974527 22:26719545-26719567 GGCAGGATTCCGGCTGGGCACGG + Intergenic
1182147819 22:28007679-28007701 GGCAGGTTCCAGGCAGGTCAGGG - Intronic
1182557421 22:31136811-31136833 GGCAGGCTCAGGCCGGGGCAGGG + Intronic
1182697640 22:32207326-32207348 GGCTGGCTGCTGCCTGGGCAAGG + Intergenic
1182772182 22:32803587-32803609 GGCAGCCTGAAGACTGGGGAGGG + Intronic
1182799989 22:33024195-33024217 AGCACCCTCCAGACTGGGTATGG + Intronic
1183405340 22:37627783-37627805 GGCAGCCTGCAGCCTGGGCCTGG + Intronic
1183411551 22:37657880-37657902 GGCAGGATCCAGAATGGTCGTGG - Intronic
1183708032 22:39487082-39487104 AGCAGGCTGCAGAGGGGGCAGGG + Intronic
1184257590 22:43295989-43296011 GGCAGGGCCCAGACAGGGAAGGG + Intronic
1184335064 22:43848131-43848153 GCCAGGCTCCAGGCTGGCCCAGG + Intronic
1184421699 22:44385986-44386008 GGCAGGGCCCAGACTGGGTGTGG - Intergenic
1184629138 22:45762532-45762554 GGCATGCTCCTGTCTGGCCAGGG + Intronic
1184648277 22:45907921-45907943 GGCTGGGTCCAGAGTGTGCAGGG - Intergenic
1185301425 22:50083212-50083234 GTCAGGGTCCAGCCTGGGGACGG - Intronic
1185371767 22:50464296-50464318 TGCAGGCTCCAGCCGGGCCAGGG - Intronic
950021257 3:9789385-9789407 AGCAGACAGCAGACTGGGCAGGG + Intronic
950116303 3:10452356-10452378 GGCTGGCCCTAGACTGGGGAGGG - Intronic
950890634 3:16400948-16400970 GGCAGGTTCCAGGCAGGGCGAGG - Intronic
951235932 3:20236352-20236374 TGGAGGCTGCAGGCTGGGCACGG - Intergenic
952385544 3:32839075-32839097 AGGAGGCTCAAGGCTGGGCATGG - Intronic
953680095 3:45032603-45032625 GGCAGGCACTATGCTGGGCAGGG - Intronic
954441183 3:50523005-50523027 GTCAGCCTCAAGGCTGGGCACGG + Intergenic
954858713 3:53669280-53669302 GCCAGGCACCATGCTGGGCAGGG - Intronic
954924048 3:54217038-54217060 GGCAGCCTCCTGACTGAGGAAGG + Intronic
955203713 3:56876219-56876241 GGCAGGGGCCAGACGGTGCAAGG + Intronic
955509638 3:59666373-59666395 GGAATGCCACAGACTGGGCAAGG + Intergenic
956727071 3:72164854-72164876 GGCAGGAGCCAGACTGGGAGAGG + Intergenic
956894242 3:73643439-73643461 TGCAGGCTGCAGTCTGGGCCTGG + Intergenic
957393241 3:79606479-79606501 GTCAGAGTCCAGCCTGGGCAGGG - Intronic
958802276 3:98770212-98770234 GGCAGGATCCAGACTTAGCTGGG - Intronic
959012922 3:101099101-101099123 GACAGGGACCAGACTGTGCAGGG - Intergenic
959655954 3:108805469-108805491 GGCAGGGTCCAGACTCTGCAGGG + Intergenic
960937888 3:122914317-122914339 GGGAGGCTGCAGACTGGAAAGGG - Intronic
961318699 3:126057659-126057681 GGTAGGATCCACACTGGGGAGGG - Intronic
961384926 3:126517932-126517954 GGCAGGCTTCACAGTGGGGAGGG + Intergenic
961623593 3:128243799-128243821 GGCTGGGTCCCCACTGGGCAGGG + Intronic
962919019 3:139934977-139934999 GGCCCGGTCCCGACTGGGCAGGG + Intergenic
963721783 3:148869720-148869742 CCCAGGGCCCAGACTGGGCATGG - Intronic
964623729 3:158739411-158739433 GGCAGGCTTCAGATGGGTCACGG - Intronic
965605515 3:170494434-170494456 GGCAGGCTCCTGATTGAGGAAGG + Intronic
967792952 3:193568479-193568501 GCCAGGCTCTAGAATGGGCTAGG + Intronic
968261012 3:197324155-197324177 GGCAGGAGCCAGGCTGGGAATGG + Intergenic
968438417 4:608358-608380 TGCAGACTCCAGACTGTGGAGGG - Intergenic
968828147 4:2914797-2914819 GGCAGGCTGCAGGCAGGGCGGGG - Intronic
969302374 4:6304650-6304672 GGCAGAGTCCAGAATGGGCATGG + Intergenic
970601227 4:17642329-17642351 CACAGGCTCCAGCCTGGGCGGGG - Intronic
972264321 4:37444411-37444433 GGCAGGCTCCAGACCAGCCCTGG + Exonic
972746149 4:41934767-41934789 GACAGGCTCCATACTTGGCACGG - Intergenic
974011740 4:56613372-56613394 GGCAGGCATCAGGCTGGGTATGG + Intergenic
975620471 4:76291324-76291346 GGCAGAACCCACACTGGGCATGG - Intronic
980021405 4:127714446-127714468 GGCAGGGTCCTGACTGGGCATGG - Intronic
985496567 5:210351-210373 GACAGGCTACAGACTGGGAGAGG + Intronic
985972060 5:3386123-3386145 GGCCAGCTCCAGAGTGCGCAGGG + Intergenic
986859124 5:11905025-11905047 CTCAAGTTCCAGACTGGGCAAGG - Intergenic
989686370 5:44092149-44092171 TGCAGGATACAGGCTGGGCATGG - Intergenic
989957340 5:50372850-50372872 GGGGGGCTCCATACTGGGGATGG - Intergenic
992086778 5:73284622-73284644 AGCCAGCTCCAGACTGGGCAGGG + Intergenic
996151421 5:120040639-120040661 GGTAGGCTCAAGGCTGGGCTAGG - Intergenic
998984470 5:147740491-147740513 ACCAGGTTCCAGCCTGGGCAAGG - Intronic
999699186 5:154212676-154212698 CACAGGCTCCAGGCCGGGCATGG + Intronic
999756816 5:154670672-154670694 CACTGGCTCCAGACTAGGCAAGG - Intergenic
999776462 5:154816202-154816224 GGCAGGCACCAGACTGGGCAGGG - Exonic
999790735 5:154937671-154937693 GGCGCGCACCAGGCTGGGCAGGG + Intronic
1002102060 5:176862574-176862596 GCCAGGGGCCAGACTGGGCAGGG - Intronic
1002103477 5:176868719-176868741 GGCAGGGGCCACTCTGGGCAGGG + Intronic
1002419372 5:179137709-179137731 GGCAGGCCCTAGGGTGGGCAGGG - Intronic
1003173494 6:3738025-3738047 GCCAGGCCCCGGGCTGGGCAGGG - Intronic
1004112973 6:12738570-12738592 AGCAGGAGCCAGGCTGGGCATGG + Intronic
1005471549 6:26166351-26166373 AGCAGGCACCAGACTGAGCAGGG - Intronic
1005512338 6:26521955-26521977 GGCAGGGTCCGGACTGGGAGAGG - Intergenic
1005826213 6:29632976-29632998 TCCAGGCTCCAGCCTGGCCAGGG + Exonic
1005897461 6:30190359-30190381 GGCAGAGGCCAGACTGCGCAGGG + Intronic
1006072855 6:31509355-31509377 GGCAGGGCCCACAGTGGGCAGGG + Intronic
1006192313 6:32217171-32217193 GGAAGGCTCCAGGCTGGTCCTGG + Exonic
1007720862 6:43884796-43884818 GGCAGGCACCAGGCATGGCAGGG - Intergenic
1007720874 6:43884841-43884863 GGCAGGCACCAGGCATGGCAGGG - Intergenic
1007764541 6:44152836-44152858 GCCAGGCCCCAGACTGAGCCAGG - Intronic
1009833887 6:68972407-68972429 GCCAGGCTCCCGAATGGGGAGGG + Intronic
1011285534 6:85718679-85718701 TGGAGGCTCCTGGCTGGGCATGG + Intergenic
1018186320 6:161267939-161267961 GCCAGGCTCTGCACTGGGCATGG + Intronic
1018261397 6:161974278-161974300 GGCAGACTCCAGATGGGGCTGGG - Intronic
1018925804 6:168206300-168206322 GTCAGGCTTCAGGCTGGGCAGGG + Intergenic
1019314286 7:377339-377361 GGCAGGGACCTGACTTGGCACGG + Intergenic
1019347041 7:536175-536197 GGAAGGCCCCAGACTTGGCAAGG - Intergenic
1019409274 7:899570-899592 GGCAGGGCCCAGACTGGCCCGGG + Intronic
1019492061 7:1318908-1318930 GGCAGCCCCCAGACAGGCCATGG + Intergenic
1019907314 7:4074568-4074590 GGCAGGGCCCAGGCTGGGCGTGG + Intronic
1021909339 7:25368682-25368704 GGCAGCATCAAGACGGGGCACGG - Intergenic
1023210902 7:37804010-37804032 TGCTGCCACCAGACTGGGCAAGG + Intronic
1023939014 7:44758187-44758209 AGCAGGCTTCTGGCTGGGCATGG + Intronic
1025082498 7:55995766-55995788 GGCAGGCACCAGAGTGTGAATGG + Intronic
1025250590 7:57348907-57348929 GGAAGGCCCCAGACTGGACCAGG - Intergenic
1026127981 7:67596432-67596454 AGCAGACTGCAGACTGGGAATGG - Intergenic
1026292977 7:69025387-69025409 GCCACGCTGCAGAGTGGGCATGG - Intergenic
1026382620 7:69814563-69814585 GAGCGGCTCCAGACTGTGCAGGG - Intronic
1026826007 7:73582057-73582079 GGCAGGCTCCTGGGTGGGGATGG - Intergenic
1029244977 7:99192697-99192719 ACAAGGCTCAAGACTGGGCATGG - Intronic
1029456111 7:100673433-100673455 GGGTGGCTCCAGACTGGGAAGGG - Intergenic
1029608950 7:101616354-101616376 GACAGGCACAAGGCTGGGCAGGG + Intronic
1030187767 7:106780161-106780183 AGCTGGCTCCTGACTGTGCAAGG - Intergenic
1032055807 7:128683342-128683364 GGGAGGCTCCAGTTTGGGAAAGG + Exonic
1032080528 7:128856383-128856405 GGCAGGGGCCAGGCTGGGCATGG + Intronic
1032091576 7:128914167-128914189 GGCAGGGGCCAGGCTGGGCATGG - Intergenic
1032388360 7:131539759-131539781 TGCAGCACCCAGACTGGGCACGG - Intronic
1034241257 7:149612924-149612946 TGCAGCCTCCAGACTCGCCATGG + Intergenic
1034896141 7:154877743-154877765 GGCAGGTTCTGGAATGGGCAGGG - Intronic
1035023038 7:155809890-155809912 GGCAGGCGGCGGACTGGGGATGG + Intronic
1035190552 7:157164049-157164071 GGCAGTTTCCAGACTGGAGAAGG + Intronic
1037748987 8:21667727-21667749 GGCAGGATCCAGGCAGGGCAGGG + Intergenic
1038052208 8:23824688-23824710 GGCAGGTACCAGCCTGGGGAAGG - Intergenic
1038855135 8:31322551-31322573 AGCAGGCACCACATTGGGCAGGG - Intergenic
1040676036 8:49750988-49751010 AGAAGTCTCCAGGCTGGGCAAGG - Intergenic
1040903519 8:52441374-52441396 TGGAGATTCCAGACTGGGCATGG + Intronic
1041169569 8:55127541-55127563 GTTAGGCACCAGGCTGGGCATGG - Intronic
1042092564 8:65174775-65174797 GGAAGGATGCAGACTGGGCTGGG - Intergenic
1043515630 8:80992236-80992258 GTCTGGGTCCAGGCTGGGCAGGG + Intronic
1045392900 8:101732892-101732914 AAAATGCTCCAGACTGGGCATGG - Intronic
1046026016 8:108724967-108724989 GGCAGAGGCCAGACTGTGCAGGG - Intronic
1046365827 8:113229989-113230011 GGCAGGTTCCATACTGGACATGG - Intronic
1047309084 8:123677065-123677087 GGCATCCTCCAGAGTGGGCCAGG - Intergenic
1048119630 8:131564546-131564568 TACAGTCCCCAGACTGGGCAGGG + Intergenic
1048571762 8:135662682-135662704 GGCTGGCTCCCACCTGGGCAAGG + Intergenic
1049062310 8:140285968-140285990 GCCAGGCTCCACAATAGGCACGG + Intronic
1049209743 8:141380254-141380276 GGGAGGCTGGAGACAGGGCAGGG + Intergenic
1049492375 8:142912249-142912271 GGCAGGATTCAGTCTGGGCCTGG - Intronic
1049675153 8:143885959-143885981 GGGGGGCTCCAGGCTGGGGAGGG - Intergenic
1049695563 8:143982850-143982872 GACAGGCCACAGACTTGGCAAGG + Intronic
1049743271 8:144251039-144251061 GGGAGACTCCATGCTGGGCAAGG + Intronic
1049831610 8:144704637-144704659 AGCAGGCCCCAGGCTGGGAATGG - Intergenic
1051156751 9:14156616-14156638 GGCAGGGTCCACAGTGGCCATGG + Intronic
1053079405 9:35162050-35162072 GGCAGGCTGGGGACTGGGCGCGG - Exonic
1053432538 9:38052624-38052646 GGGAGGCTCTAAGCTGGGCATGG - Intronic
1053446678 9:38158462-38158484 GGCAGGTTCCCCCCTGGGCAGGG - Intergenic
1053786048 9:41653658-41653680 GGCAGGCTTCCCACTGGGCCAGG - Intergenic
1055102587 9:72480486-72480508 GGCAGGCCCCACACTGGGAGTGG - Intergenic
1057312678 9:93951830-93951852 GGCAGGCCCCAGACGGGGTGGGG + Exonic
1059194671 9:112359511-112359533 GACAGGTTTCAGGCTGGGCACGG + Intergenic
1059344018 9:113616190-113616212 GGGGGACTCCAGACTGGGGAAGG + Intergenic
1059359964 9:113734512-113734534 GGCAGGGTCCAGACCAGACAGGG - Intergenic
1060410605 9:123397663-123397685 TGCAGGATAAAGACTGGGCATGG + Intronic
1060872396 9:127053258-127053280 GGCAGGCTCCAAACTGTCCTTGG + Intronic
1061003869 9:127917300-127917322 AGCAGGCTCCTGCCTGGGCGAGG + Intergenic
1061055528 9:128220525-128220547 GGCAGGTCCCAGACAGGGAAAGG - Intronic
1061277855 9:129579692-129579714 GGCAGGTGCCAGGCCGGGCAGGG + Intergenic
1061297951 9:129687106-129687128 GGCAGGCTGCAGGCCGGGCATGG + Intronic
1061480488 9:130895631-130895653 GCCTGGCTCCTGCCTGGGCAGGG + Intergenic
1061565695 9:131438277-131438299 GGCAGGCTGGAGACTGGTCCTGG + Intronic
1061885903 9:133591026-133591048 GGCAGGCTCTGGATAGGGCAGGG + Intergenic
1061922349 9:133789030-133789052 GGCGGGCACCAGGCTGGGCTGGG - Intronic
1062081013 9:134623421-134623443 GGCTGGCTCCAGCCTGGCCCCGG - Intergenic
1062287751 9:135780674-135780696 GGCAGGCTCCAGGGTGGGCTTGG - Intronic
1062309812 9:135929651-135929673 TGGATGCTGCAGACTGGGCAGGG - Intergenic
1062313415 9:135952411-135952433 GGCAGGCTCCATGCTCGGCACGG + Intronic
1062526585 9:136980339-136980361 GGCAGTCTCCTGACTGGGGGAGG + Intronic
1186350382 X:8733062-8733084 GGCAGGATCCTGGCTGGGGAGGG - Intergenic
1187432311 X:19236367-19236389 GGTTGGGTCCAGACTGGGCATGG - Intergenic
1187738667 X:22330853-22330875 AGCATGATCCAGGCTGGGCACGG - Intergenic
1190756391 X:53405460-53405482 GTCCAGCTCCAGCCTGGGCAAGG + Intronic
1192168124 X:68838612-68838634 GGCAGGTTCCTGAGTGGGAAGGG + Exonic
1196913852 X:120512144-120512166 GGCAGGTTCCAGAGTGAGCAGGG - Intergenic
1197563094 X:128048059-128048081 AGCAGACTCCAGACTGGGCTGGG - Intergenic
1198738740 X:139817486-139817508 GGCAGGAGCCAGACTGTGCAGGG + Intronic
1200080256 X:153572711-153572733 GGTAGTCACCAGGCTGGGCAGGG - Intronic
1200229965 X:154438922-154438944 GTCAGGCTCCAGAGGAGGCACGG + Intronic
1201416063 Y:13750793-13750815 GGCAGGATCCTGGCTGGGGAGGG + Intergenic
1202369858 Y:24189164-24189186 GGCAGGCTGCAGACTGGAGGAGG - Intergenic
1202500926 Y:25480953-25480975 GGCAGGCTGCAGACTGGAGGAGG + Intergenic