ID: 919762091

View in Genome Browser
Species Human (GRCh38)
Location 1:201104353-201104375
Sequence GGTTTTCAAGGGATTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 513}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919762091_919762100 -8 Left 919762091 1:201104353-201104375 CCCTCCCCAATCCCTTGAAAACC 0: 1
1: 0
2: 5
3: 48
4: 513
Right 919762100 1:201104368-201104390 TGAAAACCACTGACCTAGGAGGG No data
919762091_919762099 -9 Left 919762091 1:201104353-201104375 CCCTCCCCAATCCCTTGAAAACC 0: 1
1: 0
2: 5
3: 48
4: 513
Right 919762099 1:201104367-201104389 TTGAAAACCACTGACCTAGGAGG 0: 1
1: 0
2: 10
3: 92
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919762091 Original CRISPR GGTTTTCAAGGGATTGGGGA GGG (reversed) Intronic
901176563 1:7304043-7304065 AGTTCTCAAGGGCTGGGGGAGGG + Intronic
901301304 1:8201658-8201680 TGTGTTCAGGGGTTTGGGGAGGG + Intergenic
901386894 1:8916263-8916285 GGTTGTCAAGGGATGGGGAGGGG + Intergenic
903341487 1:22657568-22657590 GGTTGTCAGGGGCTGGGGGAAGG + Intronic
904799815 1:33084267-33084289 GGGTCTCAAGGGATGAGGGAGGG + Intronic
904884222 1:33724387-33724409 GGCTTTCGAGAGATGGGGGATGG - Intronic
905123510 1:35701099-35701121 GTTTTTCAACGGACTGGGGGAGG - Intergenic
906242164 1:44248810-44248832 TGTTTTCCTGGGGTTGGGGAAGG + Intronic
907131637 1:52102560-52102582 GGTTTCCAGGGCCTTGGGGAGGG - Intergenic
907132196 1:52107055-52107077 AATTTTCATGGGATTGGGAAAGG + Intergenic
907897897 1:58709912-58709934 TGATTTCAGGGAATTGGGGAGGG - Intergenic
908070313 1:60453339-60453361 GGATTTTAAGGAAATGGGGAGGG - Intergenic
908443781 1:64182295-64182317 AGAGTTGAAGGGATTGGGGATGG - Intergenic
909070219 1:70984968-70984990 GGTTTCCATGAGAGTGGGGAGGG - Intronic
909198629 1:72659413-72659435 GCTGTCCAAGGGATTGGGGGTGG - Intergenic
912062586 1:105691040-105691062 ATTTTTCATGGGATAGGGGAGGG - Intergenic
912434220 1:109648461-109648483 GGTTTTCAGGGGATCGGGAGAGG + Intergenic
912749068 1:112270448-112270470 GGTTGGCAAGGAATTGGGGGAGG + Intergenic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915614893 1:157029972-157029994 GGTTTTCAGGGGTTAGGGGAAGG + Intronic
915996042 1:160564737-160564759 TGTTTTTCAGGGACTGGGGAAGG + Intronic
916073727 1:161187824-161187846 GGACTGCTAGGGATTGGGGAAGG - Exonic
916471656 1:165129549-165129571 GGTTGTCAGGGGATATGGGAGGG - Intergenic
916667470 1:166979319-166979341 GGTTTTGAAGGTATGGAGGATGG - Intronic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
918096240 1:181336731-181336753 GGTTGCCAAGGGCTGGGGGAGGG - Intergenic
918412767 1:184277433-184277455 GGTTTCCAGGGGTTGGGGGATGG + Intergenic
918676610 1:187294288-187294310 GGTTGTCAGGGGTTTGGGAAAGG + Intergenic
918699436 1:187589470-187589492 GTTTTTCCATGGATGGGGGATGG - Intergenic
919591070 1:199503396-199503418 GGTTTCCAAGGGCTTGAGGGAGG + Intergenic
919653000 1:200168714-200168736 GGCTGTTTAGGGATTGGGGAGGG - Intronic
919759594 1:201089190-201089212 GGCTTGCAAGGGAGTGGGGAGGG - Intronic
919762091 1:201104353-201104375 GGTTTTCAAGGGATTGGGGAGGG - Intronic
919887038 1:201942162-201942184 TGTTAGCAGGGGATTGGGGAGGG - Intronic
920027547 1:203010860-203010882 GGTTTCCAAGGGCTGGAGGAGGG - Intronic
920739862 1:208570365-208570387 GGTTATCAGGGGCTAGGGGAAGG - Intergenic
921123400 1:212156276-212156298 GGGGTTCAAGGGAATGAGGAAGG - Intergenic
922213496 1:223502662-223502684 GGCTTTCAGGGGAATGGGGAAGG + Intergenic
923090132 1:230734370-230734392 GGTTTCCAGGGGCTGGGGGAGGG + Intergenic
924530511 1:244889812-244889834 TTTTTTTAAGAGATTGGGGATGG + Intergenic
924556685 1:245124854-245124876 GGTTTTTAAGGGTTTGGGAGTGG - Intronic
1062972718 10:1661081-1661103 GGTATTTAAGGGTTTAGGGAGGG - Intronic
1063169219 10:3491541-3491563 GGTTGGCAAGGGGTTGGGGAAGG + Intergenic
1064187163 10:13172263-13172285 GGGTCTCAAGGTATTGGGGCAGG + Intronic
1064828788 10:19438125-19438147 GGTTTTTAAGGGTTGGGGGAGGG - Intronic
1065207830 10:23374081-23374103 GGTTTTCAAGGGGTTTGGAGTGG - Intergenic
1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG + Intronic
1066072223 10:31829314-31829336 GGTTACCAAGGGCTGGGGGATGG + Intronic
1067179816 10:43976383-43976405 GGTTTCCAAGGGCTGGGGGGAGG - Intergenic
1067254084 10:44618119-44618141 GGTTATCAGGGGATGGGTGAAGG + Intergenic
1067647118 10:48118342-48118364 GGTTTCCAGGGGATAGAGGAAGG + Intergenic
1068771877 10:60830880-60830902 GGTTATCATGGGATTGGGACTGG - Intergenic
1069814966 10:71188082-71188104 GGTTGCCAAGGAATTGGAGAGGG - Intergenic
1069891554 10:71655613-71655635 GGTTTTCAGTGGCGTGGGGAAGG - Intronic
1070186478 10:74067813-74067835 GGTTATCAGGGGACGGGGGAAGG + Intronic
1070670657 10:78375169-78375191 GGTTTGCAAGGGGTGGGGGCAGG - Intergenic
1070829921 10:79411911-79411933 GGTGCTCCAGGGACTGGGGACGG - Intronic
1071998029 10:91165421-91165443 TGTTTTCCAGGCAGTGGGGAGGG - Intronic
1072341194 10:94452447-94452469 GGTTTCCAGGGGATTGGAGGAGG - Intronic
1072863531 10:99032461-99032483 GGTTTGAAAGGGATGGGGCAGGG - Intronic
1073039212 10:100588814-100588836 GGTTGCCAAGGGTTTGGGGGAGG + Intergenic
1073569543 10:104565308-104565330 GGTTGCCAAGGGCTAGGGGAGGG - Intergenic
1075710604 10:124528657-124528679 GATTTTAAAGGCAGTGGGGAAGG - Intronic
1076451019 10:130557014-130557036 GGTTATCATGGGAGTGGGGCTGG + Intergenic
1078880556 11:15444805-15444827 GGTTTTGTGGGGAATGGGGAGGG - Intergenic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079211354 11:18463250-18463272 GGTTATCAGGGGAGTGGGAATGG + Intronic
1079469650 11:20766107-20766129 GCTATTCAAGGGAGTGAGGAAGG + Intronic
1079479901 11:20868366-20868388 GGTTTTCAAGTGCTGGGGGGAGG + Intronic
1080073161 11:28114142-28114164 GGTTGTCAGGGGCTGGGGGAAGG - Intronic
1081643882 11:44776885-44776907 TGTTTTAAAGGGATTGGGTTTGG + Intronic
1081836484 11:46159815-46159837 TGTTTTCAAGGAAGTGGGGGTGG + Intergenic
1081956038 11:47094295-47094317 TGGTTTCCAGGGATTGGGGAAGG + Intronic
1082904996 11:58298054-58298076 AGTATTCAAGTGATTGGAGAGGG - Intergenic
1082991183 11:59208293-59208315 TGTTTTTAAGTGGTTGGGGAGGG - Exonic
1083744576 11:64728258-64728280 GGTTAACAAAGGATTGGAGAAGG - Intronic
1084273922 11:68042431-68042453 GGTGGCCAAGGGACTGGGGAGGG + Intronic
1084433529 11:69124364-69124386 GGTTTTCACTGCATGGGGGAGGG - Intergenic
1084443917 11:69192473-69192495 TGTTTTCTAGGGAGTGGGAAAGG + Intergenic
1084728188 11:71055762-71055784 GGTTTTCTAGGGGCTGGGGGAGG + Intronic
1084841925 11:71859817-71859839 TGGTTTCCAGGGACTGGGGAGGG + Intergenic
1085780573 11:79404434-79404456 GGCTGCCAGGGGATTGGGGAAGG + Intronic
1086958676 11:92960093-92960115 GGTTTTCCAGGCATTGAGAAAGG + Intergenic
1087097671 11:94335350-94335372 GGTTTCCAGGGGCTGGGGGAAGG - Intergenic
1087633119 11:100673879-100673901 GGTTGACAAGGGATTAGGGAAGG + Intergenic
1088682056 11:112251935-112251957 GGTTTTAAAGGGATTGGGGGTGG - Intronic
1089165471 11:116472794-116472816 GGTTTTCAGGGGAGGAGGGAGGG - Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1090178921 11:124676311-124676333 GGCTTTCCAGGGGTTGGGGCAGG - Intronic
1090500527 11:127256450-127256472 GGTTTTTCAGGGCTAGGGGAGGG + Intergenic
1091434432 12:461417-461439 GGTTTTCAACGTACTGTGGATGG + Intronic
1091861176 12:3785467-3785489 GGTTGCCAAGGGCTGGGGGAGGG - Intergenic
1092058281 12:5524737-5524759 CATTTTCAAGGAATTGGGGTGGG + Intergenic
1092721110 12:11441488-11441510 GGGTGTCAAGGGCTGGGGGAAGG + Intronic
1093903918 12:24666612-24666634 AGATTTCAAAGGATTTGGGATGG + Intergenic
1094105748 12:26809661-26809683 GGTTTTCAGGGGCTTGGCGGGGG + Intronic
1094360904 12:29629648-29629670 GGTTATCAGGGGATGGAGGAGGG + Intronic
1095277121 12:40299565-40299587 GGTTGTCAGGGGTTAGGGGAGGG + Intronic
1095621856 12:44265763-44265785 TGTTTTCCAGGGCCTGGGGAAGG - Intronic
1095869649 12:47012326-47012348 GTCTTTCAAGGGACTGGGAAAGG + Intergenic
1096008548 12:48193001-48193023 TGGATGCAAGGGATTGGGGATGG - Intergenic
1096291919 12:50351004-50351026 GGCTTTCCAGGGGCTGGGGACGG + Exonic
1096713070 12:53471987-53472009 AGTTTTCAAGGGGTTGGTGGGGG + Intronic
1097431665 12:59516137-59516159 GGTTTTCAAGGCACTGATGATGG + Intergenic
1097506741 12:60482929-60482951 GGTTATCAAGGGCTGGGAGAGGG + Intergenic
1097609580 12:61802585-61802607 GGTTATCAAGAGACTGGGAAGGG + Intronic
1097808432 12:63990953-63990975 GTTTTTTAATGGATTTGGGAAGG - Intronic
1098832162 12:75375983-75376005 GTTTTGCAAGGTATTGGTGAAGG + Intronic
1098894078 12:76037688-76037710 GGTTTACAGAGGATTTGGGAAGG - Exonic
1098915199 12:76250072-76250094 GGTTTTAGGGGGATGGGGGAGGG + Intergenic
1098945198 12:76581911-76581933 AGTTTCCAAGGGCTGGGGGAAGG + Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1100472432 12:94905455-94905477 TTTTTTCAAAGGATTGGTGATGG - Intronic
1100647970 12:96551277-96551299 GGTTTTTTTGGGTTTGGGGAGGG - Intronic
1100743537 12:97620874-97620896 GACTTTCAAGAGACTGGGGAAGG - Intergenic
1101262460 12:103046773-103046795 GTTTTTCCACGGACTGGGGAAGG - Intergenic
1101496541 12:105259854-105259876 GGTTATCCAGGGAGTAGGGAAGG - Intronic
1101922193 12:108942005-108942027 GGTTGCCAAGGGGCTGGGGATGG - Intronic
1102447281 12:113013223-113013245 GGTTTTTAAGGGTTTGGGAGTGG + Intergenic
1102631847 12:114287912-114287934 ATTTTCCAAGGGATTTGGGATGG + Intergenic
1102757233 12:115352085-115352107 GGTTTTCAGGGGCTAGTGGAGGG - Intergenic
1102907086 12:116685038-116685060 GGTTGTCATGGGATTGGGGCTGG + Intergenic
1103282927 12:119775365-119775387 GGTTGTCACGTGATTGGGAAGGG - Intronic
1103364830 12:120374301-120374323 GGTTGTCAGGGGTTGGGGGAGGG - Intergenic
1103368348 12:120399437-120399459 TCTTTTCAAGGGGGTGGGGAAGG - Intergenic
1105282254 13:18973289-18973311 GGTTGTCAGGGGCTGGGGGAAGG + Intergenic
1105356973 13:19667527-19667549 GGTTGTCAGGGGCTGGGGGAGGG - Intronic
1106663469 13:31826825-31826847 GGTTTTTAAGGGTTTTGGGGTGG - Intergenic
1108259269 13:48640798-48640820 GGTTTTCAGGGGTTTGAGAAGGG + Intergenic
1108266367 13:48712951-48712973 GGGTCTTCAGGGATTGGGGATGG - Intergenic
1108409352 13:50131153-50131175 GCTTTAAAAGGGATGGGGGATGG - Intronic
1108637973 13:52354837-52354859 GGTTGTCAGGGGTTTGGGAAGGG - Intergenic
1109836733 13:67868506-67868528 GGTTATCAAAGGCTTGCGGAAGG + Intergenic
1110086204 13:71383849-71383871 GGTTTCCAGGGACTTGGGGAGGG - Intergenic
1110879861 13:80558539-80558561 AGTTTTCAATAGATTGGGGAGGG + Intergenic
1111839623 13:93433748-93433770 GGTTTTCCAGGGGTTGGTGGAGG + Intronic
1111885425 13:94014699-94014721 GGTTGTCAGGGGATGGGGCAAGG - Intronic
1111927085 13:94475511-94475533 GGTTACCAGGGGATGGGGGAGGG + Intronic
1114201783 14:20527948-20527970 GGTTTTCAACTTATTTGGGAGGG - Intergenic
1114616572 14:24071738-24071760 GGTGGTGAAGGGATTGGGCAGGG - Intronic
1115273349 14:31579103-31579125 GCTTTTCCAGGGTTTGGAGAAGG - Intronic
1115316390 14:32029241-32029263 AGTTTTCAAGGATTTGGCGAAGG - Intergenic
1116003588 14:39269346-39269368 GGTTGTCAAGGGATGAGGGGTGG - Intronic
1116531701 14:45980151-45980173 GTTTTACAAGGTATTGGTGAAGG + Intergenic
1117312692 14:54543973-54543995 GGTTGTCAGGGGCTGGGGGAGGG - Intergenic
1117898464 14:60510402-60510424 TGTTTTCAAAGCATTAGGGAGGG - Intronic
1118012023 14:61619182-61619204 GGTTGCCAGGGGATGGGGGAAGG + Intronic
1118654901 14:67936262-67936284 GATTTCCAAGGGCTTGGGGAAGG - Intronic
1118682475 14:68257180-68257202 GGTTTCCAGGAGCTTGGGGAAGG + Intronic
1119321657 14:73735084-73735106 GGTTACCAAGGGTTAGGGGATGG + Intronic
1120715447 14:87836386-87836408 GGTTTTGAAGTGAAAGGGGATGG - Intergenic
1121688884 14:95860541-95860563 GGTCTTCCAGGTAATGGGGATGG - Intergenic
1123478742 15:20612139-20612161 GGTTCTGAAGGGAGTGAGGATGG + Intergenic
1123639271 15:22388246-22388268 GGTTCTGAAGGGAGTGAGGATGG - Intergenic
1124043022 15:26122297-26122319 GGTTTCCAAGAGCTTGGGGAGGG - Intergenic
1124134645 15:27023473-27023495 TGGTTTCCAGGGACTGGGGAAGG - Intronic
1124622828 15:31286210-31286232 GGTTTCCAAGGGCTAGAGGAAGG + Intergenic
1124826954 15:33106778-33106800 GTTGGCCAAGGGATTGGGGAGGG - Intronic
1124836700 15:33202455-33202477 CCTTTTCAAGGCACTGGGGATGG + Intergenic
1124998891 15:34751741-34751763 TGTTTACTAGGGATGGGGGATGG - Exonic
1125821357 15:42634855-42634877 GGTTTTCCAGGATTTAGGGATGG + Exonic
1126751351 15:51880501-51880523 GGTTGTCAAGGGCTAGGGAATGG - Intronic
1126973388 15:54146311-54146333 GGCTCTCAACTGATTGGGGATGG - Intronic
1127379517 15:58419021-58419043 GGTTTTCCTGGGAGTGGGGTAGG + Intronic
1127440948 15:59007231-59007253 TGTCTTCAAGGGATGGGGAAAGG - Intronic
1127500300 15:59548565-59548587 GGTATTTAAGGGTTTAGGGAGGG - Intergenic
1128794284 15:70453514-70453536 GGTTATCAGGGGTTTGGGGGAGG - Intergenic
1129467866 15:75733985-75734007 GGTTTTAAAGGTCATGGGGAGGG + Intergenic
1129611885 15:77067020-77067042 GGTTTTCATGGGAATGGGACTGG - Intronic
1130374472 15:83316189-83316211 GGTTTTCAAGAGCTGGGGGTGGG - Intergenic
1130505093 15:84532370-84532392 GGATTGCAAGGTTTTGGGGAAGG - Intergenic
1130569027 15:85023908-85023930 GGTTGCCAAGGGATCAGGGATGG + Intronic
1130795187 15:87200297-87200319 GGTGTTCAAGGGAATAGGCAAGG + Intergenic
1131016754 15:89064015-89064037 GGTTGTCAGGGGCTTGGGGGAGG - Intergenic
1131019916 15:89088867-89088889 GGTCTTCAGGGGCCTGGGGAGGG + Intronic
1131768444 15:95706674-95706696 GGATTTCAAGGGAATAGTGAAGG + Intergenic
1132841051 16:1978707-1978729 GGTTTTCCAGGGGTTCAGGATGG - Exonic
1133006655 16:2885471-2885493 GGTTATCTCGGGATTGGGGTGGG - Intronic
1133530727 16:6652743-6652765 GGTTTTCAGGGGCTCTGGGAGGG + Intronic
1134798103 16:17060064-17060086 GGTTTCCAGGGGCTTGGGGAAGG + Intergenic
1135067427 16:19322305-19322327 GGTTTTCAATGGATTGGATAAGG - Intergenic
1135070503 16:19347566-19347588 GGTTATCAGGGGCTTGGGGGAGG - Intergenic
1135815721 16:25631142-25631164 GGTTGTCAAGGGCTGGGGGTTGG + Intergenic
1136144634 16:28309223-28309245 GGGCTTCAAAGGATCGGGGAAGG - Intronic
1137588150 16:49676819-49676841 GGTTTAGAAAGGAGTGGGGATGG + Intronic
1138550071 16:57742938-57742960 GGTTGGCAAGGGATGGGGGTTGG - Intronic
1140040009 16:71400783-71400805 GGTTGTCAAGGGGTTAGGGGTGG + Intergenic
1141439694 16:84021962-84021984 GGTTATCATGGGAGTGGGGCTGG - Intronic
1141850662 16:86643275-86643297 GGTTTTCAAGGGGTGGCAGAAGG - Intergenic
1143796885 17:9344165-9344187 GTTTTTCAATTGATTTGGGAAGG + Intronic
1144662893 17:17082774-17082796 GGGTTTCCAGGGGCTGGGGAAGG - Intronic
1145836800 17:27960532-27960554 GTGTTTCAAAGGCTTGGGGATGG + Intergenic
1146071075 17:29682281-29682303 GGTTTTCAAGGGAGGGGGTCAGG + Intronic
1146315972 17:31807087-31807109 ATTTTTCAATGGATTGGGGGTGG - Intergenic
1147580584 17:41625272-41625294 GGATTTCTAGGGATGGGGCAGGG - Intergenic
1148564043 17:48622790-48622812 TGTATTCAAGTGAATGGGGAAGG - Exonic
1149984011 17:61333494-61333516 GGTTTGCACGGGATTGGCAAGGG - Intronic
1150276514 17:63901313-63901335 GGTTTCCCAGGGATGGGAGAAGG + Intergenic
1150453901 17:65291904-65291926 GTTTCTCTAGGAATTGGGGAGGG - Intergenic
1151279525 17:73062729-73062751 GTTTTTCCACGGATTGGGGGTGG + Intronic
1151383243 17:73739912-73739934 GGTTGCCCAGGGATTGTGGAAGG - Intergenic
1152025759 17:77808060-77808082 GGTTGTCAAGTGATTGCAGAGGG + Intergenic
1152098214 17:78285241-78285263 GGTTGTCAGGGGCTGGGGGAGGG + Intergenic
1152589179 17:81203047-81203069 GGTCTTGCGGGGATTGGGGATGG - Intronic
1153802652 18:8684798-8684820 GGTTTTTAAGGGTTTGGAGTGGG + Intergenic
1153833739 18:8945790-8945812 GGTTTTTAAGGGTTTGGAGTGGG - Intergenic
1155150008 18:23115731-23115753 GGTTGCCAGGGGCTTGGGGAAGG - Intergenic
1155294620 18:24373818-24373840 AGTTCTTAAGGGAGTGGGGAGGG - Intronic
1156028951 18:32690296-32690318 GGGTTTTAAGGGATTGAGAATGG + Intronic
1156847800 18:41689203-41689225 GGTTTTCTAGAGATTAAGGAAGG - Intergenic
1157509039 18:48254721-48254743 GGTTTTTAAGGGCTTTGGAATGG - Intronic
1157546424 18:48549829-48549851 TGTTTGCAAGGAAGTGGGGAAGG + Intronic
1157703771 18:49783278-49783300 GGTTGTCAGGGGATGGGGGATGG + Exonic
1158411138 18:57207005-57207027 GGCTTTCAAAGGATTGGGTGAGG + Intergenic
1158684159 18:59597970-59597992 GAATTTCAAGGGAATGGGGAGGG + Intronic
1160574505 18:79844381-79844403 GGTTGCCAGGGGATTGGGGGTGG + Intergenic
1160611846 18:80094858-80094880 GGTTTTCAGGGACTGGGGGAAGG + Intronic
1161113460 19:2483144-2483166 GGTTGTCAGGGGTTGGGGGAGGG - Intergenic
1161160489 19:2758962-2758984 GGTTGTCAGGGGATAGGAGAGGG + Intronic
1162978049 19:14220095-14220117 GGTTGCCAGGGGATGGGGGATGG + Intergenic
1163120189 19:15212765-15212787 GGTGTTCAAGCGATTGAGAAAGG + Intergenic
1163466190 19:17469844-17469866 GGGCTTGAACGGATTGGGGAGGG + Intronic
1164553881 19:29234892-29234914 GCTTTTCTAGGGATAGGGGTGGG - Intergenic
1164794038 19:31012080-31012102 GTTTTTCAACAGATGGGGGAGGG - Intergenic
1165249405 19:34517200-34517222 GGTTATGGAGGGGTTGGGGAGGG - Intergenic
1165717424 19:38055484-38055506 AGTTTGCAGGGGATGGGGGATGG - Intronic
1168252680 19:55149369-55149391 GGTTGGCATGGGGTTGGGGAGGG - Intergenic
1168479951 19:56711456-56711478 GGTTGCCAGGGGATAGGGGAGGG - Intergenic
926113853 2:10198770-10198792 GGTATTTAAGGGTTTAGGGAGGG + Intronic
927424177 2:22962880-22962902 GGTTATCACAGGCTTGGGGATGG - Intergenic
927597344 2:24408245-24408267 GTTTTTCCACGGAATGGGGATGG + Intergenic
927750053 2:25660406-25660428 GGTTTCCAGGGGTTTGTGGAGGG + Intronic
929283948 2:40114764-40114786 AGTTTTAAAGTGATTGGGGGAGG + Intronic
929747671 2:44675833-44675855 GGTTGCCAAGGGCTGGGGGAGGG - Intronic
930603270 2:53466523-53466545 GACCTTCTAGGGATTGGGGAGGG - Intergenic
930947594 2:57093460-57093482 GATTGCCAAGGGATTGGAGAGGG + Intergenic
930954033 2:57182372-57182394 GGTTGCCAAGGAATTGGGGAAGG - Intergenic
931129429 2:59317430-59317452 GATTTTCAAGAGAGTGGGTAAGG + Intergenic
931151617 2:59580537-59580559 GGTTTACAATGGATTGGTGTGGG + Intergenic
931798955 2:65740180-65740202 GGTTTGCATGGGATTGGGGGTGG + Intergenic
931849734 2:66240122-66240144 GAATTTCAAGGGAAGGGGGAGGG + Intergenic
934649672 2:96083734-96083756 GGTCTTGCAGGGATTGGGGGTGG - Intergenic
934780665 2:96967774-96967796 GATTTTTAAGGCAATGGGGACGG + Intronic
935136983 2:100314633-100314655 TGTTTTCAAGGACTTGGGGTAGG - Intronic
935702874 2:105827785-105827807 TGTTTACAAGGGGTTGGTGATGG + Intronic
936415335 2:112303549-112303571 GGTTTTCAGGGGCTGGGGGCAGG - Intronic
936459481 2:112702298-112702320 GGTTACCAAGGGTTGGGGGAAGG - Intergenic
936666389 2:114601476-114601498 TGTTTTAAAGGGATTGGGGAGGG + Intronic
936727601 2:115339790-115339812 GGTTGCCAAGGGATTGGGTGGGG + Intronic
936889891 2:117356965-117356987 GGTTGCCAGGGGATGGGGGAGGG - Intergenic
937077837 2:119119903-119119925 GATGTTTAAGGGATTGGTGAGGG - Intergenic
937850716 2:126632679-126632701 GGTTTTCAAGGACTCAGGGAAGG + Intergenic
940149574 2:150584470-150584492 GGTTTTCCAGGCACTGGGAATGG + Intergenic
940271624 2:151897316-151897338 GGTCTTCAAGTGCTTGGTGATGG + Intronic
940382063 2:153026393-153026415 GGTTGACAAGGGTTTGGGGGAGG - Intergenic
940415914 2:153419518-153419540 TGTTTTTTAGGGATTAGGGAGGG + Intergenic
940747043 2:157579134-157579156 GACTTTCTTGGGATTGGGGAAGG + Intronic
940979317 2:159983616-159983638 GGTTTTCAAAGTGTTGTGGAAGG - Intronic
941510403 2:166401077-166401099 GGTTTTCTAGGGTTAGGTGATGG + Intergenic
941975367 2:171398522-171398544 AGTTTTTAATGGATAGGGGAGGG + Intronic
942940750 2:181613166-181613188 GGTTGTCAAGAGCTGGGGGAGGG - Intronic
943006316 2:182391526-182391548 GTTTTGCAAGGTATTGGTGAAGG - Intronic
943215580 2:185029463-185029485 GGTTTTCAGAGGATGAGGGATGG - Intergenic
946233465 2:218307217-218307239 GTTTTTCCAGGGACTGGGGGAGG + Intronic
946325728 2:218983958-218983980 GGTTTTCCAGGCTTTGGGGCAGG - Intronic
946741874 2:222810444-222810466 GGTTTCCAGGGGTTGGGGGAAGG + Intergenic
947477030 2:230459518-230459540 GGTCTTCAGGCAATTGGGGAAGG - Intronic
948501313 2:238397002-238397024 GGTTTTGAAGTCATTTGGGATGG + Intronic
1168976574 20:1970623-1970645 GGTTTCCAAGGGTTTTGAGAAGG + Intergenic
1169024350 20:2355950-2355972 GGTTGTCAGGGGCTTGGGGTGGG + Intergenic
1169048599 20:2558208-2558230 GGTCTTCAAGGGAGACGGGAGGG + Intronic
1169848092 20:10017392-10017414 GGTTGCCTAGGGATTAGGGAAGG + Intronic
1170465546 20:16619385-16619407 GGTTTTCAGGGGTTTGGAGTGGG - Intergenic
1170980398 20:21206953-21206975 GCTTTTCTAGGGAATGAGGAAGG - Intronic
1172995378 20:39066547-39066569 GGTGTTCCTGGGATTGGGGTTGG + Intergenic
1173169590 20:40713350-40713372 GGTGGTCAAGGGAATGAGGAGGG - Intergenic
1173688808 20:44942974-44942996 GGCCATCAAGGGATTGAGGAGGG + Exonic
1173708293 20:45131125-45131147 GGTTTCCAAGGGTTTCAGGAAGG - Intergenic
1174042337 20:47708909-47708931 GGTTTTTAAGGGTTGGGGGTTGG - Intronic
1174248626 20:49201124-49201146 GGTTGTCAAGGGCTGGGGAAGGG + Intergenic
1174332976 20:49835524-49835546 GGTTTCCAGGGGATGGGAGAAGG - Intronic
1175207218 20:57320491-57320513 GGCTTCCAAGGGCTGGGGGAAGG + Intergenic
1175303964 20:57963339-57963361 GGTTGCCAAGGGCTTGGGGGAGG + Intergenic
1175406021 20:58729270-58729292 GGTTTCCAAGGGATAGGGGAAGG + Intergenic
1175713280 20:61238170-61238192 GGTTTCCAGGGGCTTGGGAAGGG + Intergenic
1175732159 20:61361444-61361466 GATTTTCCAGGGGATGGGGAGGG + Intronic
1175742764 20:61431803-61431825 GGTTGCCAGGGGATGGGGGAGGG - Intronic
1177253457 21:18627684-18627706 ATTTTTCAAGGGATAGGAGAAGG - Intergenic
1177476477 21:21630572-21630594 GGTTGCCAAGGGTTTGGGGGAGG + Intergenic
1177514994 21:22137927-22137949 GGTTGTCAAGGGTTTGTGGGAGG + Intergenic
1177597562 21:23265661-23265683 ATTTTTCCATGGATTGGGGAGGG - Intergenic
1178534242 21:33399282-33399304 GGTTATCATGGGAGTGGGGCTGG + Intergenic
1178752681 21:35319452-35319474 GGTATTCAAAGGATCGGGGAAGG + Intronic
1179244937 21:39624868-39624890 GATTTTCAAGAGAGTGAGGATGG - Intronic
1180114103 21:45685226-45685248 GGTTTTAAAGGTTGTGGGGAAGG + Intronic
1182194390 22:28500192-28500214 GGTTTTCAGGAGCTTGGGGTAGG - Intronic
1182267362 22:29128061-29128083 GGTTGCCAAGGGCTGGGGGAAGG + Intronic
1182684685 22:32112715-32112737 GGTTATCAAGGGCTGGGGGAGGG + Exonic
1182823577 22:33241833-33241855 GGTTACCAAGGGCTGGGGGACGG + Intronic
1183007427 22:34915068-34915090 GCTTAGCAAGGGAATGGGGAGGG + Intergenic
1183183745 22:36279494-36279516 GGTTGTCAAGGGCTGGGGGAGGG + Intergenic
1184132852 22:42528089-42528111 GGCTTTCAATGGATTGGACAAGG + Intergenic
1184346873 22:43918929-43918951 GGTTTCCAGGGGCTGGGGGAAGG + Intergenic
1184537624 22:45098242-45098264 GGTTTACCAGGGGCTGGGGAAGG + Intergenic
949535280 3:4990725-4990747 GGTTGCCAAGGGATGAGGGAGGG + Intergenic
950606086 3:14082008-14082030 GGTTTTTAGGGGACTGGGGCAGG - Intronic
951129525 3:19025265-19025287 GGGTTTCAACTGATTGGGGGAGG - Intergenic
952559706 3:34577076-34577098 GATTTTGAAGGGATTGGAGATGG + Intergenic
953487563 3:43316765-43316787 AGTTTCCAAGGGGGTGGGGAGGG - Intronic
953678270 3:45020250-45020272 GGTTTCCAGGGGCTTGGGGTGGG - Intronic
954601346 3:51872857-51872879 GGTTGTCAGGGGCTAGGGGAGGG + Intergenic
955145923 3:56319455-56319477 GGTTGTCAAGGGCTAGGGGGAGG + Intronic
955207993 3:56914825-56914847 GGTTGCCAGGGGATGGGGGAGGG + Intronic
955380296 3:58433179-58433201 GGTTACCAGGGGTTTGGGGAAGG + Intronic
955941664 3:64151878-64151900 GGTTTTTAGGGGTTAGGGGATGG + Intronic
957173937 3:76779510-76779532 GGTTGTCAGGTGCTTGGGGAGGG - Intronic
958514559 3:95096805-95096827 GGTTACCAACGGATCGGGGAAGG - Intergenic
958880574 3:99664669-99664691 GGTCCTCAAGTGTTTGGGGATGG + Intronic
958916145 3:100052737-100052759 GGTTTACATGAGGTTGGGGAAGG - Intronic
958953756 3:100444843-100444865 GGTTTTCAAAGGCTTATGGAAGG - Intronic
959500039 3:107096523-107096545 TGATTGCCAGGGATTGGGGATGG + Intergenic
959845760 3:111031526-111031548 GGCTTTCAAAGAGTTGGGGATGG - Intergenic
960261830 3:115577021-115577043 GGTTATTATGGGATTGGAGATGG - Intergenic
960726988 3:120680672-120680694 GGATTTCAGGGGAGTGGGCAGGG - Intronic
960852558 3:122071293-122071315 TGGTTTCCAGGGGTTGGGGAGGG - Intronic
960880974 3:122344571-122344593 GGTTATCATGGGAGTGGGGCGGG - Intergenic
961432142 3:126890873-126890895 GGTTCCCCAGGGAGTGGGGAGGG + Intronic
961481861 3:127185903-127185925 GGTTGCCAAGGGCTGGGGGAGGG - Intergenic
961802238 3:129460223-129460245 GGTTTTCAGGGGCTGGGGGTAGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962435537 3:135363087-135363109 GCATGTCAAGTGATTGGGGAAGG - Intergenic
962583231 3:136817429-136817451 GTTTTTCAAGGGGATGGGGAAGG + Intergenic
962904036 3:139785910-139785932 TGTTTTCAAGGGGGTGTGGATGG + Intergenic
964193429 3:154033235-154033257 GGTTTTCAAAGACTTTGGGATGG + Intergenic
966398279 3:179523425-179523447 GGTTGTGGAGGGATTGTGGAGGG + Intergenic
966897587 3:184457393-184457415 GGTTATCATGGGAGTGGGGCTGG - Intronic
967119247 3:186368044-186368066 GCTGTTCCATGGATTGGGGATGG - Intergenic
967414146 3:189198104-189198126 GATCTTCAAGGGATTGGGTTTGG + Intronic
967526483 3:190500736-190500758 GATTGCCAAGGGCTTGGGGAAGG - Intergenic
968713460 4:2137663-2137685 AGTGTTCAAGAGGTTGGGGAGGG - Intronic
969659190 4:8516462-8516484 GGTTTTTCAGGGAATGGTGAAGG - Intergenic
969783038 4:9425849-9425871 TGGTTTCCAGGGACTGGGGAGGG + Intergenic
969833289 4:9816363-9816385 GGTTTTCAGGAGATGAGGGAAGG + Intronic
970446174 4:16124889-16124911 GATTGTCAAGGGATTGGCGGGGG - Intergenic
971127965 4:23775189-23775211 GGTTTTCAAGGGAATTGGGAGGG - Intronic
971254871 4:25005118-25005140 GGTTTTCAGGGGCTGTGGGATGG + Intronic
971616690 4:28799807-28799829 GGTATTTAAGGGTTTAGGGAGGG + Intergenic
973104378 4:46315553-46315575 GGTGTTCAAGGGACTGAGGCAGG - Intronic
973907260 4:55545261-55545283 GGTTTTCAAAGCTTGGGGGAAGG - Intronic
975096002 4:70457073-70457095 GGTAATTAAGGGAATGGGGATGG + Intronic
975758215 4:77592409-77592431 GGTTGTCAGGGGTTGGGGGAAGG + Intronic
976398924 4:84586020-84586042 GGTTTACAAGGGTTTGGGTAGGG + Intronic
976954445 4:90878287-90878309 GGACTTCAAGGCATTGCGGATGG - Intronic
978162375 4:105564473-105564495 GGTTTCCAGGGGCTGGGGGAAGG + Intronic
978325881 4:107553780-107553802 GGTTTTTAAGGGTGTGGGGATGG + Intergenic
978328979 4:107590541-107590563 GGTTTCCAGGGTCTTGGGGAAGG - Intronic
978480271 4:109181859-109181881 GGTTATCAAGGGCTAGGGGCAGG - Intronic
979084378 4:116388369-116388391 GGTATTGAAGGGTTTAGGGAGGG - Intergenic
979898651 4:126190989-126191011 GTTTTGCAAGGTATTGGTGAAGG + Intergenic
980547953 4:134294135-134294157 GGTTACCAAGGACTTGGGGAAGG + Intergenic
980642067 4:135594405-135594427 GGTTGTCAGGGGCTTGGGGGAGG - Intergenic
981356173 4:143791824-143791846 GGTTGCCAGGGGCTTGGGGAGGG - Intergenic
981367695 4:143922463-143922485 GGTTGTCAGGGGCTTGGGGAGGG - Intergenic
981377494 4:144032708-144032730 GGTTGCCAGGGGCTTGGGGAGGG - Intergenic
981538594 4:145825225-145825247 GGGTTTCAAGGAGCTGGGGAAGG + Intronic
981653757 4:147088906-147088928 GGTTTTCACAGGAGTGTGGAGGG - Intergenic
981751647 4:148098023-148098045 GGTTTTTAAGGGCTTGGGAGTGG - Intronic
981982434 4:150810395-150810417 GATTATCAAGGGAATGGGAAAGG - Intronic
982983649 4:162175695-162175717 GGTTGTCAATGGCTGGGGGAAGG + Intergenic
983113896 4:163788048-163788070 GATTGTCAATGGATAGGGGAAGG + Intronic
984819197 4:183865307-183865329 GGTTTTAAAGTGACTGGGGTGGG + Intronic
986021794 5:3811589-3811611 GGTTGTCAGGGGTTGGGGGAAGG + Intergenic
986169011 5:5300651-5300673 GGCTATCAAGGGTTTGGGGCGGG + Intronic
986436903 5:7743195-7743217 TGGTTTCATGAGATTGGGGAGGG + Intronic
987237737 5:15959972-15959994 GGTGCTCAAGGGAGGGGGGATGG - Intergenic
989469206 5:41795404-41795426 GATTGTGAAGGGAATGGGGATGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989751261 5:44896506-44896528 GGTTGCCAGGGGATGGGGGAAGG - Intergenic
989980162 5:50633844-50633866 GGTTGCCAGGGGTTTGGGGATGG + Intergenic
990479026 5:56189489-56189511 TGGTTTCCAGGGACTGGGGATGG - Intronic
990828655 5:59931567-59931589 GGTTTTCATGGGATTGGGACTGG - Intronic
991351536 5:65724265-65724287 GGTTAACCAGGGATTGGGGGAGG - Intronic
992298926 5:75357480-75357502 GGTTATCATGGGTTTGGGGAAGG + Intronic
993705861 5:91169434-91169456 GGTTGCCAGGGGATGGGGGAGGG + Intergenic
993797696 5:92288467-92288489 GGTTTTCATGGGTTTGAGGTAGG - Intergenic
994405276 5:99338171-99338193 GGCTTTTGGGGGATTGGGGAGGG - Intergenic
994626435 5:102226012-102226034 TGTTGTCAAGGGAGTGGGGAAGG - Intergenic
994930218 5:106173176-106173198 GGTATTTAAGGGTTTAGGGAGGG - Intergenic
996076036 5:119195559-119195581 GGTTTTCAAGGGCTGGTGGTGGG + Intronic
996120090 5:119661905-119661927 GGTTTCCAGGGGTTAGGGGAAGG - Intergenic
996206502 5:120744391-120744413 GGTTGGAAGGGGATTGGGGAAGG + Intergenic
996953540 5:129156550-129156572 GGTTTTCTAGTTATTGAGGAAGG + Intergenic
997334431 5:133095856-133095878 GGCTGTCAGGGGATGGGGGAGGG - Intronic
997510038 5:134447838-134447860 GGTTTCCAAGTGATTCTGGATGG + Intergenic
997888393 5:137652644-137652666 GGTTACCAAGGGATAGGGGAAGG + Intronic
997950684 5:138240377-138240399 GGTTTTAAAGGAATCAGGGAAGG + Intergenic
998407640 5:141883056-141883078 GGATTTTAAGGGGGTGGGGAGGG - Intergenic
999435338 5:151559271-151559293 GGCGTGCAAGGGATTGGAGAAGG + Intronic
1000717509 5:164664449-164664471 GGTTTACAGGGGATGGGGGAAGG + Intergenic
1001768137 5:174271082-174271104 GGTTGCCAGGGGCTTGGGGAGGG + Intergenic
1002005858 5:176234227-176234249 GGTTTTCAGGGGTTGGGGAAGGG - Intergenic
1002220517 5:177676398-177676420 GGTTTTTCAGGGGTTGGGGAAGG + Intergenic
1002457560 5:179354244-179354266 GGTTTGGAAGGCCTTGGGGATGG - Intergenic
1002992533 6:2251015-2251037 TGTTTTCAAAGGATTAGGGATGG - Intergenic
1003513927 6:6803139-6803161 GCTTCTCCAGGGCTTGGGGAGGG - Intergenic
1003684539 6:8288130-8288152 TGATTTCCAGGGGTTGGGGAAGG - Intergenic
1003704997 6:8516003-8516025 CATTTTCAAGGGGTGGGGGAAGG + Intergenic
1004320574 6:14628553-14628575 GGTTTCCAGGGGCTGGGGGAAGG - Intergenic
1004609319 6:17224317-17224339 TGTTTTCAAGGGTTTCGGAATGG + Intergenic
1005832631 6:29682830-29682852 TCTTTTCTAGGGAGTGGGGAGGG - Intergenic
1006082443 6:31575238-31575260 GGTTTTGAGGGGCATGGGGACGG + Intergenic
1006082895 6:31577572-31577594 GGTAATAAAGGGATTGGGGCAGG - Exonic
1006104355 6:31707613-31707635 GGTTTTCCAGGGTCTGGGGCTGG - Exonic
1007157550 6:39760273-39760295 AGTTTGCAAGGGATTTGGTATGG + Intergenic
1008590652 6:52990419-52990441 GGTTTACAAGGTGGTGGGGAGGG - Intronic
1008840087 6:55892429-55892451 GGTTTCCAGGGGCTCGGGGATGG + Intergenic
1010227584 6:73505481-73505503 GGTTACCAGGGGATGGGGGAGGG + Intronic
1010479123 6:76328228-76328250 GGTATTTAAGGGGTTAGGGAGGG - Intergenic
1010484817 6:76397521-76397543 GGAATTCAAGTGACTGGGGAAGG + Intergenic
1011052188 6:83164686-83164708 GATTTTGGAGGGATTGGAGATGG + Exonic
1011173519 6:84534121-84534143 GGTTGCCAAGGGCTGGGGGATGG + Intergenic
1011600343 6:89054050-89054072 GGCTTCCAAGGGCTGGGGGAAGG - Intergenic
1011903642 6:92333680-92333702 GGTTATCAAGGGCTGGGGGAGGG - Intergenic
1012222360 6:96664398-96664420 GGTTCTCAGGGGCTGGGGGAAGG - Intergenic
1012451928 6:99361892-99361914 GGCTCTCCAGGCATTGGGGATGG + Intergenic
1012502818 6:99908480-99908502 TGTTTACCAGGGAGTGGGGAAGG + Intergenic
1015566111 6:134573485-134573507 GTTTGTTAAGGCATTGGGGATGG + Intergenic
1015771527 6:136773145-136773167 GGTTTCCATGGGAATGTGGAAGG - Intronic
1016025929 6:139287000-139287022 GTTTTTCCATGGACTGGGGAGGG - Intronic
1016222998 6:141698874-141698896 GGTTTTCATGGGATTGGAATGGG - Intergenic
1016428343 6:143957426-143957448 GGGTTTCTAGGGAGTGAGGAGGG - Intronic
1016671396 6:146712914-146712936 GGTTTTCATGGGCTGGGGGGAGG - Intronic
1017203914 6:151784979-151785001 GCTTTTCAACTGATTGGGCAAGG + Intronic
1017778370 6:157697190-157697212 GGTGTTCAAGGGTGTGTGGATGG - Intergenic
1019025261 6:168956756-168956778 GGCTTCTAAGGGTTTGGGGATGG + Intergenic
1019531814 7:1507027-1507049 GGGTTGAAAGGGATGGGGGATGG - Intergenic
1019753817 7:2753024-2753046 GGTTACCAAGGGATTAGGGATGG - Intronic
1020537618 7:9421480-9421502 AGTTTTCAAATGCTTGGGGATGG + Intergenic
1021465866 7:20943064-20943086 GGTTTCCAGGGGCTTGGGGGAGG + Intergenic
1021677221 7:23093181-23093203 TGTTTGCCAGGGATTGGGGGTGG - Intergenic
1022208914 7:28189306-28189328 TATTTTCAGGGGGTTGGGGATGG - Intergenic
1022310708 7:29194198-29194220 GGATTTGAAGGGGATGGGGAGGG - Intronic
1022751104 7:33226871-33226893 GGTTTCCAGGGGCTTGGGAAAGG + Intronic
1022759551 7:33332995-33333017 GGTTTCCAGGGGCTGGGGGAGGG - Intronic
1023347205 7:39283433-39283455 GGTTGTCAAGGGCTTGGGAGTGG - Intronic
1024448043 7:49504683-49504705 TGATTTTAAGGGATTAGGGAAGG - Intergenic
1024551437 7:50565818-50565840 GATTTTGATGGGTTTGGGGAAGG - Intergenic
1024569383 7:50711255-50711277 GGGTTTCAGGGGGTGGGGGAGGG - Intronic
1024899677 7:54304570-54304592 TTGTTTCAAGGGATTTGGGAGGG + Intergenic
1025028770 7:55538977-55538999 GGTTGAGAAGGTATTGGGGAGGG + Intronic
1026234520 7:68514618-68514640 GGTTGCCAAGGGATGGGGGAAGG - Intergenic
1026395332 7:69947107-69947129 GGGTTTAAAGGGATTGAGGGAGG + Intronic
1026527250 7:71165185-71165207 GGTTTTTCAGGGATTGGGAAGGG + Intronic
1026563961 7:71474251-71474273 GGTTTTCATGGATTTGGGCAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027168110 7:75850304-75850326 AGTTTTCAAGGGATTGAGGTAGG + Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027663901 7:81020684-81020706 GGTGTTAAAGGGTTTGGTGATGG - Intergenic
1027701158 7:81471670-81471692 GGTTGTCAAGGGAATGAAGAAGG - Intergenic
1028505738 7:91568319-91568341 GGCTTTCAACTGATTGGGTAAGG + Intergenic
1028723656 7:94062140-94062162 TGTTTTGAAGTGAGTGGGGATGG + Intergenic
1029347718 7:99990906-99990928 GTTTTTCCACGGACTGGGGAGGG - Intergenic
1030031769 7:105376397-105376419 GGTTTTCAATGGATAGGGATGGG - Intronic
1030091972 7:105865850-105865872 GGTATTCAGGGGCTGGGGGAGGG - Intronic
1031906499 7:127465806-127465828 GGTTTTCAGGGGATGGTGGCTGG - Intergenic
1032258091 7:130312783-130312805 GGTATTTAAGGGTTTAGGGAGGG + Intronic
1032500145 7:132394027-132394049 GGCTGTCAGAGGATTGGGGAAGG - Intronic
1032919023 7:136525377-136525399 GGTTTCCAGGGGCTGGGGGAAGG + Intergenic
1033634983 7:143203929-143203951 GGATTGCATGGGATGGGGGAGGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034402653 7:150875577-150875599 GGATTTCCAGGGGATGGGGATGG + Intergenic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1035622819 8:1047150-1047172 TGTTTTCCAGGGTCTGGGGAAGG - Intergenic
1036151798 8:6305891-6305913 GGTTGTCAGGGGCTGGGGGATGG - Intergenic
1036808429 8:11851025-11851047 GCCTTTGCAGGGATTGGGGAGGG - Intronic
1036836022 8:12068209-12068231 TGCTTTCCAGGGACTGGGGAGGG - Intronic
1036857865 8:12314779-12314801 TGCTTTCCAGGGACTGGGGAGGG - Intergenic
1037443553 8:18942064-18942086 GGTTTTCAGTTGATTTGGGAAGG + Intronic
1037619116 8:20547646-20547668 TGTTTGCCAGGGACTGGGGAGGG + Intergenic
1037836181 8:22216049-22216071 GATGTTCAAGGGGTGGGGGAAGG - Intergenic
1037899651 8:22680265-22680287 AGTTTTCTGGGGTTTGGGGAGGG - Intergenic
1038029074 8:23621272-23621294 GGTTTTAGAGGGAGTGTGGATGG - Intergenic
1038384749 8:27132524-27132546 TGTTTGCAGGGGAATGGGGAGGG - Intergenic
1038646386 8:29365739-29365761 GCTTTGCCAGGGAGTGGGGAAGG + Intergenic
1038928488 8:32167230-32167252 GATTATCAAGGAATTGGGGTAGG - Intronic
1039435570 8:37557184-37557206 AGTTTTAAAGGGATTGGGGGGGG - Intergenic
1039933121 8:42013028-42013050 GGTTTGCCAGGGTTGGGGGAGGG + Intronic
1040047982 8:42982306-42982328 GGTTACCAGGGGATAGGGGAGGG + Intronic
1040577106 8:48662326-48662348 GGTTTGCAGAGGATTGGGGTGGG - Intergenic
1040640420 8:49327873-49327895 TGTTTACTAGGGGTTGGGGATGG - Intergenic
1040856183 8:51950406-51950428 GGTTGCCAGGGGATGGGGGAAGG + Intergenic
1041292260 8:56319169-56319191 GGGGTGCAAGGGGTTGGGGAGGG + Intronic
1042756390 8:72217829-72217851 GGTTTCCAAGGGCTGGGGGAAGG + Intergenic
1043599004 8:81916647-81916669 GGTTTTGGAGGGGTTGTGGAGGG - Intergenic
1043639017 8:82425667-82425689 GGTTGTCAGGGGTTGGGGGAAGG - Intergenic
1043739688 8:83795149-83795171 GGTTGTCAGGGGTTGGGGGAGGG + Intergenic
1044430893 8:92104496-92104518 GGGTTTAAAAGGATGGGGGAAGG - Intergenic
1044600764 8:94001834-94001856 GGTTTTTCAGGGATAAGGGAAGG + Intergenic
1044600799 8:94002474-94002496 GGTTTTTCAGGGATAAGGGAAGG - Intergenic
1045121073 8:99035337-99035359 GGTTGTCAAGGGCTGGGGCAGGG - Intronic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1045910804 8:107407465-107407487 TGTTTTCAAAAGAATGGGGATGG + Intronic
1046825364 8:118685033-118685055 TGGTTTCAAGGGGTTAGGGATGG - Intergenic
1047465792 8:125112721-125112743 GGTTACCAAGGGATTGGGGAAGG + Intronic
1047506453 8:125484464-125484486 GGTGTCCCAGGGATGGGGGAGGG + Intergenic
1047513900 8:125536923-125536945 ATTTTTCCATGGATTGGGGAAGG + Intergenic
1048496353 8:134939311-134939333 TGTTTTCAAGGAGGTGGGGAAGG + Intergenic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1050226633 9:3465134-3465156 AGATTGCAAGGGTTTGGGGAAGG - Intronic
1050252779 9:3762829-3762851 GGTTGCCAAGGGATAGGTGAAGG - Intergenic
1050377547 9:4988157-4988179 GGTCTAAAAGGGAGTGGGGAAGG - Intronic
1051021390 9:12547832-12547854 GATTATGAAGAGATTGGGGAAGG - Intergenic
1051341308 9:16113396-16113418 TGTTTTAAAGGGCTTAGGGAGGG - Intergenic
1052483440 9:29063205-29063227 TGTTTTCAGGGAATTAGGGAAGG - Intergenic
1052816427 9:33105632-33105654 GGTTGTCAGGGGCATGGGGAAGG - Intronic
1053283639 9:36837080-36837102 GGATTTCTAGGGAATGGGGGTGG + Exonic
1054748580 9:68881140-68881162 GGTCTTCAAGCTCTTGGGGAAGG - Intronic
1055255964 9:74371508-74371530 GGCTTTCATGGGATTGCGGAAGG - Intergenic
1055582659 9:77723764-77723786 GGTTTCCAAGGGTTAGGGGGAGG + Intronic
1055647354 9:78373602-78373624 GGTTTACCAGGGGTTTGGGATGG - Intergenic
1056286751 9:85094828-85094850 GGTTTCCAGGGGCTGGGGGAAGG + Intergenic
1056544228 9:87600730-87600752 GCTGTTCAATGGATGGGGGAAGG - Intronic
1057758008 9:97852828-97852850 GGTTTTTGTGGGAATGGGGAGGG - Intergenic
1058182133 9:101811034-101811056 GGTTTTGAAAGGAGTTGGGAGGG + Intergenic
1058691688 9:107525514-107525536 GGTTTGCGACGGGTTGGGGATGG + Intergenic
1058893784 9:109382967-109382989 GGTTGCCAAGGGCTTGGGGAAGG - Intronic
1059442005 9:114313218-114313240 GATTTTCCAGGGGTTGGGGGAGG - Intergenic
1059892734 9:118822149-118822171 GGTTGCCAAGGGATGAGGGAAGG - Intergenic
1060911896 9:127357950-127357972 GGTTTTTAAGGGGGTAGGGAGGG - Intronic
1061761834 9:132856840-132856862 GCTTTTCCAGGGATGGGGAATGG + Intronic
1062553722 9:137104138-137104160 TGTTTTTCAGGGACTGGGGAGGG - Intronic
1186208719 X:7227877-7227899 GGTTTCCAGGGGATAGGGGAAGG - Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186484249 X:9921622-9921644 GGTTGTTAGGGGATGGGGGAAGG - Intronic
1186494061 X:9997742-9997764 GGGTTTCCAGGGACTGGGGGAGG + Intergenic
1187049166 X:15678956-15678978 GGCTTTCGACGGATTGGGTAGGG + Intergenic
1187668777 X:21647055-21647077 GGATTTTGAGGGATGGGGGATGG - Intronic
1187792700 X:22968404-22968426 TGTTTTCAAGGGGGTGGGAATGG - Intergenic
1188002600 X:24996204-24996226 GGTCTTCAGGAGCTTGGGGAGGG - Exonic
1188118814 X:26279274-26279296 GTAGTTCAAGGGAGTGGGGAAGG - Intergenic
1188721151 X:33525503-33525525 GGTTGTCAAGGCTTTGGGAATGG + Intergenic
1189125433 X:38440605-38440627 CATTTTCGAGGGAATGGGGAGGG + Intronic
1189678020 X:43483318-43483340 TGTTCTCTAGGGATTTGGGATGG - Intergenic
1190316449 X:49155086-49155108 GGCTTACAAGGGTATGGGGAAGG - Intergenic
1190547030 X:51538217-51538239 GGTTATCATGGGATTGGGACTGG + Intergenic
1190722092 X:53157834-53157856 GGTTTTCAAGGGGATGGGGGTGG - Intergenic
1191624326 X:63253312-63253334 GGTTATCAAGAGCTGGGGGAAGG + Intergenic
1192677723 X:73216108-73216130 GGTTTTCAGAGGCTTGGGGTAGG + Intergenic
1193546891 X:82842467-82842489 AGTTTTCCAGGAATTGGGCAGGG + Intergenic
1193878036 X:86886222-86886244 GGTTTCCAAGGGTTGGGGAAGGG + Intergenic
1194252800 X:91599428-91599450 GGTTTTCAGTGGCTGGGGGAAGG + Intergenic
1194891690 X:99386378-99386400 GGTTTTCAGGGGCTGGGGGAAGG - Intergenic
1195465825 X:105177483-105177505 ATTTTTCTAGGGATTGGGGGAGG - Intronic
1196051909 X:111314528-111314550 GGTTTCCAAGGGTTGGAGGAAGG + Intronic
1196288857 X:113915424-113915446 GGCTTTCAATGGAGAGGGGAGGG - Intergenic
1196987693 X:121293004-121293026 TGTGTTTATGGGATTGGGGAGGG + Intergenic
1197326367 X:125099175-125099197 GGTTTTAAAAGGAATGGGGGAGG + Intergenic
1197331780 X:125161615-125161637 TGTTTGCCAGGGATTGGGGAAGG + Intergenic
1198250784 X:134877530-134877552 GGTCATAAAGGGATTTGGGATGG - Intergenic
1198776160 X:140181278-140181300 GTTTTCCAAGGGCTAGGGGAAGG + Intergenic
1199683922 X:150248162-150248184 GGTTTTCAAGGGCTGGAGAAAGG + Intergenic
1200571738 Y:4840668-4840690 GGTTTTCAGTGGCTGGGGGAAGG + Intergenic
1201239184 Y:11941854-11941876 GGGTTCCAGGGGATTGAGGAAGG + Intergenic
1201361299 Y:13152805-13152827 AGTTTTCCAGAGATTGGGGGGGG + Intergenic