ID: 919763224

View in Genome Browser
Species Human (GRCh38)
Location 1:201111278-201111300
Sequence CCTTCTAGGGAACAGCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919763214_919763224 18 Left 919763214 1:201111237-201111259 CCACGTTTCTCTTGTCCTTCCAG No data
Right 919763224 1:201111278-201111300 CCTTCTAGGGAACAGCTGGTAGG No data
919763217_919763224 -9 Left 919763217 1:201111264-201111286 CCCTCATTCTCCTTCCTTCTAGG 0: 1
1: 0
2: 2
3: 45
4: 462
Right 919763224 1:201111278-201111300 CCTTCTAGGGAACAGCTGGTAGG No data
919763213_919763224 19 Left 919763213 1:201111236-201111258 CCCACGTTTCTCTTGTCCTTCCA 0: 1
1: 0
2: 0
3: 25
4: 266
Right 919763224 1:201111278-201111300 CCTTCTAGGGAACAGCTGGTAGG No data
919763212_919763224 20 Left 919763212 1:201111235-201111257 CCCCACGTTTCTCTTGTCCTTCC 0: 1
1: 0
2: 2
3: 25
4: 314
Right 919763224 1:201111278-201111300 CCTTCTAGGGAACAGCTGGTAGG No data
919763219_919763224 -10 Left 919763219 1:201111265-201111287 CCTCATTCTCCTTCCTTCTAGGG 0: 1
1: 0
2: 4
3: 54
4: 367
Right 919763224 1:201111278-201111300 CCTTCTAGGGAACAGCTGGTAGG No data
919763216_919763224 -1 Left 919763216 1:201111256-201111278 CCAGTTATCCCTCATTCTCCTTC 0: 1
1: 0
2: 0
3: 26
4: 423
Right 919763224 1:201111278-201111300 CCTTCTAGGGAACAGCTGGTAGG No data
919763215_919763224 3 Left 919763215 1:201111252-201111274 CCTTCCAGTTATCCCTCATTCTC 0: 1
1: 0
2: 1
3: 35
4: 362
Right 919763224 1:201111278-201111300 CCTTCTAGGGAACAGCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919763224 Original CRISPR CCTTCTAGGGAACAGCTGGT AGG Intronic
No off target data available for this crispr