ID: 919763638

View in Genome Browser
Species Human (GRCh38)
Location 1:201113083-201113105
Sequence CTGTAGGGATGGGAGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 1, 2: 6, 3: 34, 4: 463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919763638_919763648 6 Left 919763638 1:201113083-201113105 CCCATCTCCTCCCATCCCTACAG 0: 1
1: 1
2: 6
3: 34
4: 463
Right 919763648 1:201113112-201113134 AGGTTGTGTGCATTATCTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 135
919763638_919763647 5 Left 919763638 1:201113083-201113105 CCCATCTCCTCCCATCCCTACAG 0: 1
1: 1
2: 6
3: 34
4: 463
Right 919763647 1:201113111-201113133 AAGGTTGTGTGCATTATCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 119
919763638_919763649 13 Left 919763638 1:201113083-201113105 CCCATCTCCTCCCATCCCTACAG 0: 1
1: 1
2: 6
3: 34
4: 463
Right 919763649 1:201113119-201113141 GTGCATTATCTCTGGGACTCTGG 0: 1
1: 0
2: 1
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919763638 Original CRISPR CTGTAGGGATGGGAGGAGAT GGG (reversed) Intergenic
900300233 1:1973427-1973449 CTGAAGGGAAGGAATGAGATGGG + Intronic
900881211 1:5382645-5382667 CTCCAGGGATGGGAGTAGATGGG + Intergenic
902150607 1:14439969-14439991 CAGTGGGGTTGGGAGTAGATGGG - Intergenic
902288987 1:15424569-15424591 CTGCAGGGAGTGGCGGAGATTGG - Intronic
902381643 1:16055566-16055588 CAGCAGGAATGGGAGGAGAGGGG + Intronic
902911128 1:19597756-19597778 CTGTATGGTGGGGAGGAGAAAGG + Intronic
904671689 1:32170902-32170924 CTCCAGGGAGGGGAGGGGATGGG + Exonic
904677001 1:32204884-32204906 CTGAAAGGATAGGAGGACATCGG - Intronic
905154735 1:35966463-35966485 CTGTAAGGATGGGAGGAGAAAGG + Intronic
905181280 1:36168563-36168585 CTGCTGGTATGGGAAGAGATGGG + Intronic
905204189 1:36333608-36333630 GTGTAGGGATGGAGGGAGAGCGG - Intergenic
905417608 1:37815161-37815183 CTGCAGGGGGAGGAGGAGATGGG - Exonic
905440968 1:37996494-37996516 ATGTAGGGAAGGGAGGGGTTTGG - Intergenic
905555027 1:38875702-38875724 GCCTAGGGATCGGAGGAGATTGG - Exonic
905870255 1:41399460-41399482 CTGTAGGGAAGTGAGCAGAGGGG - Intergenic
905905385 1:41614694-41614716 CAGAAGGGATGGAAGAAGATGGG + Intronic
906264567 1:44418252-44418274 AAGGAGGGATGGGAGGAGGTTGG + Intronic
906584872 1:46967425-46967447 CTGGAGGGCAGGCAGGAGATTGG + Intergenic
906860839 1:49357434-49357456 CTGTAAGGATGGAAGTAGAGAGG + Intronic
907272334 1:53298342-53298364 CTGAGGGGCTGGGAGGAGGTGGG + Intronic
907946782 1:59142873-59142895 TTGAAGGGATGGTAGTAGATAGG + Intergenic
908626908 1:66054867-66054889 CTGAAGAGATGTGAGGAGTTGGG - Intronic
909151631 1:72013076-72013098 CTTCAGGGGAGGGAGGAGATGGG + Intronic
909921984 1:81393275-81393297 CTTTGGGGAAGGGATGAGATTGG + Intronic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
913068763 1:115281431-115281453 GTGCGGGGATAGGAGGAGATAGG + Intergenic
914366985 1:146988048-146988070 CTGTAGGGCTGGCAGGAGTCAGG - Exonic
914367521 1:146992806-146992828 CTGTAGGGCTGGCAGGAGTCAGG - Exonic
914825938 1:151138106-151138128 CTGGAGGGATGGGTGGAGTGGGG + Intronic
915021256 1:152781082-152781104 CTGGAGGGGAGGGAGAAGATAGG - Intronic
915237062 1:154491686-154491708 ATGGATGGATGGGAGGAGAGAGG + Intronic
915249174 1:154576374-154576396 CTGAAGGGAGGGGAAGAGAGAGG + Exonic
916007657 1:160676972-160676994 CTTGAGGGATGGGAGGAGCAGGG + Intergenic
916118730 1:161510094-161510116 ATGTAGGGAGGGGAGAAGAGGGG + Intronic
916128442 1:161591418-161591440 ATGTAGGGAGGGGAGAAGAGGGG + Intronic
917753052 1:178071783-178071805 CTGTAGGGGAGGGAAGAGACTGG - Intergenic
918430540 1:184455506-184455528 ATTTGGGGATGGGAGGAGATTGG - Intronic
919763638 1:201113083-201113105 CTGTAGGGATGGGAGGAGATGGG - Intergenic
919853910 1:201692949-201692971 CTGTAGAGATGGGATGGAATGGG + Intronic
919933098 1:202234335-202234357 CTGTGGGAATGGGTGGGGATAGG - Intronic
920031810 1:203042050-203042072 CTGGAGTGATGAGAGGGGATTGG + Intronic
920038731 1:203082591-203082613 CTGAAGGGAATGGAGGAGAATGG + Intergenic
920095394 1:203483355-203483377 CTGGAGGGAGGGGAGGAGGCAGG - Exonic
920728656 1:208461973-208461995 CTCTAGGGATGGGCGGGGAGGGG - Intergenic
921117232 1:212104640-212104662 CAGTAGGGCTGCCAGGAGATGGG - Exonic
921606740 1:217165108-217165130 CTGTTGGGGTGGGCGGATATGGG - Intergenic
922143467 1:222914585-222914607 CTCTGGGGATGGGAGGAGGAAGG - Intronic
922686215 1:227640429-227640451 AGGTAGGGTTGGGAGGAGAAAGG + Intronic
922752849 1:228078966-228078988 TTGGAGGGCTGGCAGGAGATGGG + Intergenic
923262793 1:232283539-232283561 TTTTTGGGGTGGGAGGAGATGGG + Intergenic
924051582 1:240084926-240084948 CTGTAGGGATGGAAGTGGGTGGG + Intronic
924291126 1:242537559-242537581 CTGGAGGAGTAGGAGGAGATAGG - Intergenic
924724337 1:246654318-246654340 GTGGAGGGCTGGGAAGAGATAGG - Intronic
924744546 1:246819362-246819384 TTGTAGGGAGGGGAGGGGAGGGG - Intergenic
1063615084 10:7593749-7593771 CTGTAGGGATGAGTGGGGCTGGG - Intronic
1063651802 10:7945590-7945612 CTGTAGGGGTGGGAGGAGGTAGG - Intronic
1064909962 10:20390058-20390080 CTGTAGGGATGGGAGGAGACTGG - Intergenic
1064994189 10:21282033-21282055 CTATAGGAATGGGAAGAAATTGG - Intergenic
1065746811 10:28849490-28849512 CTGCAGGGATGGATGGAGGTAGG + Intronic
1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG + Intergenic
1067550056 10:47227740-47227762 CTGCAGGGAGGGGAGCAGAGGGG + Intergenic
1067782762 10:49221082-49221104 CTGTAGGGGTGGCAGGATAGGGG - Intergenic
1068261961 10:54594580-54594602 CTGTAGTGTGGGGAGGACATGGG - Intronic
1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG + Intronic
1070587636 10:77778871-77778893 CTGAAGGGAAGGGAGGAGCTTGG - Intergenic
1070624603 10:78041716-78041738 CTGCAGGGATGGGATGGGATGGG + Intronic
1072486968 10:95864875-95864897 CTGTTGGGCTGGGGGGAGGTTGG + Intronic
1072631785 10:97151433-97151455 GAGAATGGATGGGAGGAGATGGG + Intronic
1072695607 10:97600709-97600731 CTGGAGGGAAGGGAGAAGAAGGG + Intronic
1073058933 10:100721620-100721642 CTGTAGGGGCAGGAGGAGTTGGG - Intergenic
1073173437 10:101533485-101533507 CTGCAGGGATGGCAGGGGAGGGG - Intronic
1073578918 10:104646134-104646156 CCGTAGGGAGAGGAGGAGCTGGG + Intronic
1074174656 10:110985760-110985782 CTATAGGTATGAGAGGAGAAAGG + Exonic
1075182249 10:120222141-120222163 CTGTGGGCATGGCAGGAGCTGGG - Intergenic
1075627225 10:123972266-123972288 GAGTAGGGAGGGGAAGAGATGGG + Intergenic
1076100809 10:127776403-127776425 CTATAGGGTAGGGAGGAGATAGG - Intergenic
1076206937 10:128611169-128611191 CTGTAGTGATGTGAGGATCTTGG + Intergenic
1077021144 11:417653-417675 CTGGAGGAAAGGGAAGAGATAGG - Intergenic
1077466607 11:2736501-2736523 CTTTGGGGATGGGAGGCGCTAGG + Intronic
1078555346 11:12320796-12320818 GTGTGGGGAGGGGAGGAGAGAGG + Intronic
1078666358 11:13328938-13328960 CTGTAGGGATTGAAGGAGATTGG + Intronic
1079378863 11:19919040-19919062 TTGGAAGGATGGGATGAGATAGG + Intronic
1081706144 11:45182838-45182860 CTGGAGGGATGGAAAGAGAAGGG - Intronic
1081773603 11:45664171-45664193 CTGGAGGGGTGGGAGGAGCTGGG - Intronic
1082028146 11:47587400-47587422 CTATAGGGAGGGGAGGAGGGTGG + Intronic
1082782325 11:57297606-57297628 CTTTAGGGGTGGGAGGAGGGTGG - Intergenic
1082939756 11:58691915-58691937 TTGTAGGGACAGGAGGAAATTGG + Intronic
1083207635 11:61161974-61161996 CAGGGGGGAAGGGAGGAGATGGG - Intergenic
1083294695 11:61708940-61708962 CTGGGGTGATGGGAGGGGATAGG + Intronic
1084772038 11:71349610-71349632 CTGTGGGGATGGCAGGCCATTGG + Intergenic
1084937820 11:72596396-72596418 GTGTGGGGGTGGGAGGAGTTGGG - Intronic
1084970289 11:72767873-72767895 CTGTAAGGATTAGATGAGATTGG + Intronic
1085013644 11:73158439-73158461 CTGGAGGGATTGGAAGGGATAGG - Intergenic
1085096441 11:73764213-73764235 TAGTGGGGATGGGAGCAGATGGG - Intergenic
1085668573 11:78439704-78439726 CTTTTGGTATGGAAGGAGATAGG - Intronic
1085779351 11:79394282-79394304 CTGTGGGGATGTGAGGAGGGTGG + Intronic
1086173764 11:83865541-83865563 CTGTAGAGAAGGGAGGGGAAAGG + Intronic
1086258582 11:84910084-84910106 CTGGAAGGAAGGGAGGAAATTGG + Intronic
1086420641 11:86634068-86634090 TTGTAGGAATGGAAGGAGAGGGG - Intronic
1087169247 11:95033672-95033694 ATTTAGTGATGTGAGGAGATAGG + Intergenic
1088391904 11:109323835-109323857 GTGTAGGGATGGGATGGGACAGG - Intergenic
1088627067 11:111737171-111737193 CTGTTGGACTGGGAGGTGATAGG + Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089531506 11:119132827-119132849 CAGGAGGGATTGGAGGACATGGG - Intronic
1090970940 11:131642494-131642516 CTCCAGGGATGTGAGCAGATGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091029155 11:132168794-132168816 CTGTAGGAAAGGGAGGAGCCCGG + Intronic
1091485278 12:880813-880835 CTGTCGGCATGGGAGGGGATAGG - Exonic
1091693974 12:2615931-2615953 CTGTGTGGAGGGGAGGAGTTAGG - Intronic
1091775379 12:3181560-3181582 CTGTGCAGAGGGGAGGAGATTGG + Intronic
1092017827 12:5173893-5173915 GTGCAGGGAAGGGAGGAGCTTGG + Intergenic
1092080719 12:5713846-5713868 CTGAGGGGAAGGGTGGAGATGGG - Intronic
1092615947 12:10215614-10215636 CTGGAGGGAAGGGAGGGGTTTGG - Intronic
1094213581 12:27917982-27918004 CTGGGGGGAGGGGAGGAGATAGG + Intergenic
1094332274 12:29307433-29307455 CTGTTTGGATGGGAGGGCATAGG + Intronic
1095688475 12:45062106-45062128 CTGTAGTGAGGAGAGGAGCTAGG + Intergenic
1096263282 12:50105875-50105897 CTGAAGGGAGGAGACGAGATTGG + Intronic
1096742198 12:53702094-53702116 CTGTGGGGATAGGAGGAGATAGG - Intergenic
1097249079 12:57622519-57622541 ATGAAGGCATGGGAAGAGATGGG - Intronic
1099790550 12:87329196-87329218 CTGTTGGGATGGAGGGAGAGGGG + Intergenic
1100050826 12:90446321-90446343 CTATAGGGATGCTAGGATATGGG + Intergenic
1100209733 12:92388643-92388665 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1101005210 12:100395174-100395196 ATGTAAGCATGGTAGGAGATGGG - Intronic
1101650887 12:106676053-106676075 GCGTAGAGATGGGAGGATATGGG + Intronic
1101902221 12:108799201-108799223 CTGCAGGGGTGGGAGCAGTTGGG + Intronic
1101969526 12:109303250-109303272 GTGAAGGGATGGGAAGACATCGG + Intronic
1102391387 12:112551719-112551741 GTGCAGGGAGGAGAGGAGATGGG + Intergenic
1102920745 12:116789616-116789638 ATGGATGGATGGGAGGAGAGTGG + Intronic
1102920816 12:116789914-116789936 ATGGATGGATGGGAGGAGAGTGG + Intronic
1102971017 12:117166432-117166454 GTGTAGGGCAGGGAGGATATGGG + Intronic
1103145758 12:118594528-118594550 CAGGAGGGGTGGGAGGTGATAGG + Intergenic
1104179482 12:126364682-126364704 CTCCACGGGTGGGAGGAGATGGG + Intergenic
1104306124 12:127612309-127612331 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1104409120 12:128543524-128543546 CAGTAGGGAAGTGAGGAGAAAGG - Intronic
1104918590 12:132278980-132279002 CTGTTGGGATGGGATGGGCTGGG - Intronic
1105039954 12:132954436-132954458 GGGTAGGGAGGGGAGGAGAAGGG + Intronic
1105870970 13:24505991-24506013 CTGTAGGAGTGGGAGGTGAAAGG - Intronic
1105950991 13:25229456-25229478 CTTTAGGGAAAGGAGGAGAGCGG - Intergenic
1106013794 13:25849082-25849104 CTGAAGGGAAAGGAGGAGAGAGG + Intronic
1107010573 13:35666120-35666142 CTGAAGGGATGGGAGGGGCCTGG + Intronic
1108521832 13:51252911-51252933 CTGGAAGGATGAGAGGAGAAAGG - Intronic
1110678295 13:78277124-78277146 CTACAGGGATGGGAGGAGTCGGG - Intergenic
1111266032 13:85814709-85814731 CTGTTGGGGTGGGAGGAAAGAGG - Intergenic
1112395755 13:99029303-99029325 CTGTAGGGCTGGGGGCAAATAGG - Intronic
1112620394 13:101048333-101048355 TTGCAGGGATAGGAGGGGATAGG + Intergenic
1113190809 13:107743247-107743269 CTGCAGGAAAGGAAGGAGATAGG - Intronic
1113286228 13:108851986-108852008 CTGTAAGGTCGGGAGGAGATGGG - Intronic
1114318849 14:21530066-21530088 CTGTAGGGAGGGGACCTGATGGG - Intronic
1114550374 14:23529397-23529419 CTGGAAGGAGGGGAGGAGAAAGG - Intronic
1114945120 14:27671758-27671780 CAGTAGGAATAGGAGGAAATAGG - Intergenic
1115620563 14:35136204-35136226 CTGCAGTGATGGGAGAAGACAGG + Intronic
1115702204 14:35964751-35964773 CTGTGGTGAGTGGAGGAGATTGG + Intergenic
1117009717 14:51458257-51458279 GGGTAGGGGTGAGAGGAGATGGG - Intergenic
1117391568 14:55267493-55267515 CTGTGGGGATAGGAGGATCTGGG + Intergenic
1119053074 14:71389847-71389869 CTGAAGGGCTCGGAGGAGAGTGG + Intronic
1119472376 14:74908060-74908082 CTGGAGAGGTGGGAGGAGACAGG + Intronic
1120303756 14:82741044-82741066 CTTTAGGGGTGGGAGGAAAGGGG - Intergenic
1121553269 14:94818491-94818513 CTGCAGGGATGGGGACAGATTGG + Intergenic
1121653230 14:95575419-95575441 CTGTAGGGTGGGGAAGTGATTGG + Intergenic
1122129488 14:99596842-99596864 ATGTAGGGATGGGAGTAGCGGGG + Intronic
1122651437 14:103229133-103229155 GTCCAGGGATGGGAGGAGTTTGG + Intergenic
1122776948 14:104121593-104121615 CTCCAGGGGTGGGAGGAGTTGGG - Intergenic
1122786680 14:104167240-104167262 CTGCCGGGATGGGAGGGGAGTGG + Intronic
1122834654 14:104424865-104424887 GTGGAGGGAGGGGAGGAGCTGGG + Intergenic
1123142385 14:106094004-106094026 AATTAGGGAAGGGAGGAGATGGG + Intergenic
1123901353 15:24880304-24880326 GTGGAGGGATGGGAGGAAAGGGG + Intronic
1124208378 15:27742459-27742481 CTCTTGGGGTGGGAGGTGATTGG - Intergenic
1124212662 15:27776300-27776322 ATGTAGGGATGGCAGGAGGGAGG - Intronic
1124461018 15:29891799-29891821 CTGCAGAGAGGGGAAGAGATGGG - Intronic
1126072125 15:44874363-44874385 CTGTAGGGAGGCTAGGATATGGG + Intergenic
1126322209 15:47437035-47437057 GGGTAGGGAGGGGAGGGGATGGG + Intronic
1127957300 15:63864326-63864348 CTTTAGGGAAGGGAGGAGTGAGG + Intergenic
1128548299 15:68581783-68581805 CGGTAGGTAGGGGAGGAAATGGG + Intronic
1129537930 15:76329537-76329559 CAGGAGGGCCGGGAGGAGATGGG - Intergenic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1129957890 15:79655847-79655869 CTGTAGGGAAGAGTGGAGACTGG - Intergenic
1130940759 15:88506853-88506875 AAGCAGGGATGGGAGGAGAGAGG + Intergenic
1131790390 15:95958186-95958208 CCATGAGGATGGGAGGAGATGGG + Intergenic
1132655718 16:1040986-1041008 CTGGGGGTCTGGGAGGAGATGGG - Intergenic
1135523211 16:23193239-23193261 AGGGAGGGATGGGAGGAGAAAGG + Intronic
1135628172 16:24014274-24014296 GGGTGGGGAGGGGAGGAGATGGG + Intronic
1135827238 16:25739713-25739735 CTGTTGGGATGGTAGTACATGGG + Intronic
1135905788 16:26510521-26510543 GTTTGGGGATGGGAGGAGAAGGG + Intergenic
1136124278 16:28166186-28166208 CTGTAGGGGTGGCAGGAGGTGGG - Intronic
1136476999 16:30519759-30519781 CAGTCCGGATAGGAGGAGATGGG + Intronic
1137235662 16:46615335-46615357 ATGTAGGGGTGGGGGGAGATAGG + Intronic
1137776334 16:51057358-51057380 CTGCAGGGATGGGTGGGGAGAGG - Intergenic
1138083745 16:54115539-54115561 CTGTGGGGAAGGGAGGTGGTTGG + Exonic
1138895710 16:61201462-61201484 CTTTAGGGGTGGGAGCAGAAGGG - Intergenic
1139641443 16:68294525-68294547 CTGTAGGGAAGGGGGGAGCAGGG + Intronic
1141407873 16:83809241-83809263 CTGCAGGGACGGGAGGAAAAAGG + Intronic
1141632619 16:85296761-85296783 CTGTAAGAATGGAAGGAGTTAGG - Intergenic
1142234451 16:88915224-88915246 GTGTGGGGTGGGGAGGAGATGGG + Intronic
1142526283 17:543902-543924 CTGGAGGGAGGGGAGGGGACAGG + Intronic
1142627094 17:1199094-1199116 ATGAAGGTCTGGGAGGAGATAGG - Intronic
1143024811 17:3935278-3935300 CTGCGGGGAAGGGAGGAGACCGG + Intronic
1143379490 17:6487150-6487172 CTCTAGGGCTGGGAGGAGCGTGG + Intronic
1144788101 17:17842864-17842886 CTGTGGGGATGGGAGGAGACAGG + Intergenic
1145199094 17:20924494-20924516 GTGGAGGGAGGGGAGGACATGGG - Intergenic
1145815932 17:27794984-27795006 CTGTAGTGTGGGGAGGAGTTGGG - Intronic
1145908514 17:28529239-28529261 CTCCAGGGATGGGAGGAGGAGGG + Intronic
1146163058 17:30570254-30570276 CTGTGAGGATCTGAGGAGATGGG + Intergenic
1146221967 17:31031888-31031910 CGGCGGGGTTGGGAGGAGATCGG - Intergenic
1147038257 17:37698020-37698042 CTCTAGGGCTGGAAGGAGATCGG + Intronic
1147703698 17:42411843-42411865 CAGTGGGGATGGGAGGGGAATGG - Intronic
1148115555 17:45172711-45172733 ATGTGGGGAGGGGAGGAGAGGGG + Intergenic
1148834650 17:50459654-50459676 TGGCAGGGCTGGGAGGAGATGGG + Intronic
1149007313 17:51819526-51819548 CTGCAGGGATGGGAGCTGTTTGG + Intronic
1149073838 17:52575222-52575244 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1149569599 17:57663110-57663132 CCTTAGGGCTGGGAGGGGATTGG + Intronic
1149670301 17:58402298-58402320 ATGAAGGGATAGGAAGAGATTGG + Intronic
1150292932 17:63992131-63992153 CTGTGGGCATGGGAGAAGAGGGG + Intergenic
1151179219 17:72313641-72313663 TTGGAGGAATGGGAGGAGGTTGG - Intergenic
1152485719 17:80591269-80591291 CAGAAGGGAAGGGAGGAGAGGGG - Intronic
1153030771 18:711421-711443 CAGTAGGGAGGGAAGGAAATGGG - Intronic
1153482825 18:5564751-5564773 CAGTAGGAGTGGGAGGAGTTGGG - Intronic
1153712494 18:7814158-7814180 CTATAGGGATTGTGGGAGATGGG + Intronic
1154079239 18:11238009-11238031 CTGAAAGGATGGCAGGACATAGG + Intergenic
1155263426 18:24067656-24067678 TTGAGGGGGTGGGAGGAGATGGG - Intronic
1155895227 18:31316884-31316906 CAGTGTGGAGGGGAGGAGATAGG - Intergenic
1155941594 18:31806287-31806309 CTGTAGGCTTCGGAGGCGATCGG - Intergenic
1156172803 18:34506421-34506443 CGGTGGGGATGGGAGAAGTTGGG + Intronic
1156641862 18:39111110-39111132 CTGAAGGGAAGGGATGGGATGGG + Intergenic
1157094593 18:44676392-44676414 CTGAAGTGGTGGGAGGAGAGTGG - Intergenic
1158051021 18:53220096-53220118 CTAGTGGGAAGGGAGGAGATGGG + Intronic
1159647154 18:70932518-70932540 CTCTAGGGGAGGGAGGAGCTGGG + Intergenic
1160561490 18:79760670-79760692 CTATAAGGAGGGGAGGAGACAGG - Intergenic
1161982804 19:7638703-7638725 CTGCAGGGAAGGGAGGGGAGGGG - Intronic
1162107859 19:8381513-8381535 CTGTAGGGAGGCTAGGATATGGG - Intronic
1162327928 19:10009627-10009649 AGGGAGGGAGGGGAGGAGATGGG + Intronic
1163784274 19:19266610-19266632 CTGCAGGGGCGGGAGGAGAGGGG + Intronic
1163883824 19:19949022-19949044 GTGTAGGAATAGGAGGAGAGCGG - Intergenic
1163939591 19:20479531-20479553 ACGTAGGGTTGGGAGGAGAAAGG + Intergenic
1164429453 19:28174569-28174591 AGGTAGAGATGGGAGGAGACAGG + Intergenic
1165222995 19:34332554-34332576 TTCTGGGGATGGGAGGAGAGAGG + Intronic
1165291419 19:34889182-34889204 ATGCAGGGAAGGTAGGAGATGGG - Intergenic
1165395790 19:35563007-35563029 ATGGAGGGAGGGGAGGAGAGAGG - Intronic
1165435218 19:35791560-35791582 CTGTAGGCCTGAGAGGAGGTGGG - Intergenic
1165476919 19:36035977-36035999 ATGTTGGGGAGGGAGGAGATTGG + Intronic
1165958928 19:39518722-39518744 ATGTACTGAGGGGAGGAGATGGG - Exonic
1166299261 19:41904926-41904948 CTGCAGGGAGAGGGGGAGATGGG - Intronic
1166383549 19:42368432-42368454 CTGTATGGGGGGGAGGGGATGGG - Intronic
1166798821 19:45443809-45443831 GGGTAGAGTTGGGAGGAGATAGG - Intronic
1167272259 19:48511990-48512012 CAGGAGGGAGGGGAGGAAATGGG + Intronic
1167333284 19:48869245-48869267 CCGTAGGCAGGGGAGGAGAGCGG + Intergenic
1167658762 19:50783433-50783455 CTGGAGGGCTGTGAGGAGAAAGG + Intergenic
1167711370 19:51113402-51113424 CTTTAGGGAGAGGAGGAGAGTGG - Intergenic
1167752075 19:51387450-51387472 CTGTGGGGAAGGGGAGAGATGGG + Intronic
1168075201 19:53977579-53977601 CTGTGGGGATGGGGAGAGAGAGG - Intronic
1168169509 19:54576305-54576327 ATGAAGGGCTGGGAGGAGACGGG + Intronic
927346831 2:22053947-22053969 GTCTAGGGATAGGAGGTGATTGG - Intergenic
928021533 2:27708693-27708715 CGGTAGAGATGGGGAGAGATGGG - Intronic
929463711 2:42126027-42126049 CTGTAGGGTGGGGTGGAAATTGG - Intergenic
933289896 2:80426436-80426458 TGGTAGAGATGGGAGGAGAAGGG - Intronic
934513468 2:94967737-94967759 AAGTGGGGCTGGGAGGAGATAGG + Intergenic
934904097 2:98184277-98184299 CTGCAAGGATGGAAGGAGAAAGG - Intronic
935585772 2:104798720-104798742 CTGAAGGAATGTGAGTAGATGGG - Intergenic
935664296 2:105496770-105496792 CTACAGGGATGTGAGGAGAAGGG + Intergenic
935674525 2:105583005-105583027 CTGGAGGGATGGCAGGGGAATGG - Intergenic
935778625 2:106493077-106493099 CTGTAGTGCTGGGAGGGGTTTGG - Intergenic
935842719 2:107130986-107131008 CTGTAGGGAAGGGATGAGAAAGG - Intergenic
936595939 2:113848003-113848025 CTGTAGGGATTGGAAGACAGGGG - Intergenic
936654832 2:114472911-114472933 CTATGGTGATGGGAGGAGATTGG - Intronic
936865947 2:117076901-117076923 ATGAAGGGATGGGATGGGATGGG - Intergenic
937051313 2:118893432-118893454 CTGGAGGAATGGGAAGAGAGTGG - Intergenic
937756347 2:125543371-125543393 CTTGGGGGATGAGAGGAGATAGG + Intergenic
938218984 2:129549444-129549466 CTGGAGGCAGGGGAGGAGTTAGG - Intergenic
938328620 2:130431584-130431606 CTGTCTGGATGGGAGGGCATAGG - Intergenic
938361325 2:130689910-130689932 CTGTCTGGATGGGAGGGCATAGG + Intergenic
938636539 2:133233857-133233879 CTGTAGGTATGTGGGGAGAAGGG - Intronic
938863511 2:135394459-135394481 CTGAAGGGAGGTAAGGAGATGGG + Intronic
939496951 2:142936101-142936123 AGGTAGGGTTGGGAGGAGAAAGG + Intronic
940810812 2:158240766-158240788 CTGTAGGAATTGCAGGATATGGG - Intronic
943475795 2:188353818-188353840 CTGTAGGGGTAGGAGGGGTTTGG - Intronic
944822004 2:203440876-203440898 GTGCAGGGATAGGAGGAGGTGGG + Exonic
946124992 2:217554881-217554903 TTGTAAGGAAGGGAAGAGATGGG + Intronic
946613194 2:221481292-221481314 ATGTAGGAATTGGAGGAGACTGG + Intronic
946715884 2:222554979-222555001 CCGAAGGGATGGGAGGAGGGAGG - Intronic
946770268 2:223081874-223081896 CCGTGGGGATAGGAGGAGTTTGG + Intronic
1168911347 20:1449733-1449755 CTGTAAAGATAGGAGGAGTTGGG - Intronic
1169204418 20:3732203-3732225 CAGTAGGGGTGGGAGGAGAGAGG + Intergenic
1169837601 20:9897911-9897933 CCGTAGGGATTGAAGGATATAGG - Intergenic
1171096010 20:22332805-22332827 CTGGAGGCATGGGATGAGAAGGG - Intergenic
1171999842 20:31765402-31765424 GGGTAGGGATGGGAAGAGAAAGG - Intronic
1172527245 20:35607341-35607363 CTGTAGAGATGGGAAGGCATTGG + Intergenic
1172656410 20:36541278-36541300 TTGTAGGGAGGGGAGGTGATGGG - Intergenic
1173805936 20:45925433-45925455 CTGGAGGGATGGCAGGGGCTGGG - Intergenic
1174286664 20:49478947-49478969 CTGGGGGGATGGGTGGGGATGGG + Intronic
1174421986 20:50405285-50405307 CTGTAGGGGTGGCGGGAGAAGGG - Intergenic
1174899094 20:54479885-54479907 CTGTAGGGGTGGGAGATGAGGGG - Intronic
1175367834 20:58467659-58467681 CTGCAGGGGTGGAAGGAGATGGG + Intronic
1176119250 20:63446582-63446604 CTGTGGGGCTGGGGGCAGATGGG + Intronic
1178040247 21:28632980-28633002 CCATAGGAATGGGAGGAAATAGG - Intergenic
1178458255 21:32776278-32776300 CTGCAGGGGTGGGAGGTGGTTGG - Intergenic
1178678123 21:34648083-34648105 CAGGAGGGATGGCAGGTGATGGG + Intergenic
1179121980 21:38556444-38556466 CTCTGGAGATAGGAGGAGATAGG + Intronic
1179155988 21:38851724-38851746 CTGAAAGGTTGGGATGAGATGGG - Intergenic
1179505285 21:41835911-41835933 CTGTGGGGGAGGGAGGAGAGTGG - Intronic
1179505296 21:41835941-41835963 CTGTGGGGGAGGGAGGAGAGCGG - Intronic
1179505309 21:41835971-41835993 CTGTGGGGGAGGGAGGAGAGTGG - Intronic
1179556638 21:42182836-42182858 CTGTGGGCAAGGGAGGGGATGGG - Intergenic
1179999557 21:44989165-44989187 CTGTGGGGAGGGGAGAAGTTAGG - Intergenic
1180132211 21:45834065-45834087 GGGTAGGGAAGGGAGGAGCTGGG + Intronic
1180209374 21:46285724-46285746 CTGTAGAGATTGGAGGAAGTCGG - Intronic
1181318198 22:21984847-21984869 CTGGAGGGAGAGGAGGAGCTCGG - Intergenic
1181362291 22:22347264-22347286 GTGTTGGGATGAGAGTAGATGGG - Intergenic
1182540799 22:31040388-31040410 TTGTAGAGATGGGAGGGGGTGGG + Intergenic
1182557878 22:31138800-31138822 CTGCAGGGAGGGGAGGGGAGAGG + Intronic
1183316464 22:37139704-37139726 GCGTAGGGATGGGGAGAGATAGG - Intronic
1183402693 22:37613921-37613943 CTGCAGGGGTGGGAGGAGTGGGG + Intronic
1183408123 22:37640257-37640279 CTGGGGCGAGGGGAGGAGATGGG + Intronic
1183674643 22:39292521-39292543 GTGTAGGGTTGGGAGGAGGAAGG - Intergenic
1183792889 22:40088151-40088173 CTGTGAGGATGAGACGAGATAGG - Intronic
1183986912 22:41575151-41575173 CGGCAGGGAGGGGAGGAGAGAGG - Exonic
1184510371 22:44929866-44929888 CTGGAGGGAGGGGAGGCGACAGG + Intronic
1184893260 22:47392146-47392168 CTGCAGGGCAGGGAGGAGAGAGG - Intergenic
950043419 3:9934258-9934280 CTGTGGGGATGGGTGGGGAAAGG - Intronic
950433019 3:12962064-12962086 AGGGAGGGATGGGATGAGATGGG + Intronic
951668118 3:25149643-25149665 CTGTGGGTATGGGAGGTGAGTGG - Intergenic
951722373 3:25713786-25713808 CGGTAAGAATGGGAGGAAATCGG + Intergenic
953182945 3:40613564-40613586 GTGTAGGGATGGGAGGTTCTGGG - Intergenic
953360220 3:42289204-42289226 CTGTAGGGAGAGGAGGAAATTGG - Intergenic
953377377 3:42440204-42440226 CAGCAGGGATGGGAGAAGAAGGG + Intergenic
953662312 3:44900151-44900173 ATGTAGGGGAGGGCGGAGATAGG - Intronic
953755830 3:45645157-45645179 CTGCAGGGATCGGAAGAGAGTGG + Intronic
953959100 3:47253528-47253550 CTTTTGGGATGGGAGGGGAGTGG - Intronic
954138034 3:48591246-48591268 GTGTGGGGCAGGGAGGAGATTGG + Intronic
955726165 3:61935116-61935138 GTGTAGGGAGAGGCGGAGATGGG - Intronic
955789537 3:62574078-62574100 CAGTGGGGATGGAATGAGATGGG - Intronic
956564887 3:70625165-70625187 CTGTGGGGATAGAAGCAGATGGG + Intergenic
959918689 3:111847469-111847491 GTGATGGGATGGGAGGATATTGG - Intronic
960169352 3:114440325-114440347 CTGTAAGGAAGGGTGGAGCTGGG + Intronic
960657151 3:120017640-120017662 CAGTAGGGAGGGGAGGAGAGAGG + Intronic
960800693 3:121536275-121536297 CTGCAGAGAAGGGAGAAGATTGG + Intronic
961015235 3:123463238-123463260 CTGTAGGGATAAAAGCAGATTGG + Intergenic
965871987 3:173275545-173275567 AGGTAGGGTTGGGAGGAGAAAGG - Intergenic
967428552 3:189355371-189355393 CTGAAGTGTTGGGAGGAGAGGGG + Intergenic
968607328 4:1541685-1541707 GTGTCGGGCTGGGAGGAGGTGGG - Intergenic
969386579 4:6853819-6853841 TTGTAGGGATGGGAAGTGATAGG + Intronic
969624776 4:8296835-8296857 CTGTAGGGAGGGGAGGGGACAGG + Intronic
970998555 4:22296010-22296032 CTGTAGGGATGTGAGGGGCAGGG + Intergenic
971451509 4:26805641-26805663 CTGTAGGTAAGGGTGGAGGTGGG - Intergenic
972433206 4:39004510-39004532 GTGTAGGGGTGAGAAGAGATAGG - Intronic
976330083 4:83821590-83821612 CAGCAGGGATGGCAGGATATGGG + Intergenic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
978835379 4:113143127-113143149 ATTTAGGTATGGGAGGACATTGG + Intronic
978924516 4:114226782-114226804 CTGAAAGGATGAGTGGAGATGGG - Intergenic
979207328 4:118054639-118054661 CTTTAGAGATGGAAGGAGAAAGG - Exonic
982068757 4:151676614-151676636 CTTTAGTGAGGGGAGGAGACGGG + Intronic
982231343 4:153210983-153211005 CTGGAGGGCTGGGAGGAGACAGG + Intronic
982852376 4:160335945-160335967 CTGTACTGATGGGAGGAAAGTGG + Intergenic
983835005 4:172375116-172375138 CTATAGGGATGCTAGGATATGGG + Intronic
984291502 4:177800970-177800992 GTGAAAGGATGGGAAGAGATAGG - Intronic
984450407 4:179893673-179893695 ATGTAGGGGTGGGAGGAAAAGGG + Intergenic
984701218 4:182819856-182819878 GTGCAGGGATGGGAGGGGATGGG - Intergenic
985121558 4:186648169-186648191 CTGGAGGGAAGAGAGGAGAGAGG + Intronic
985485570 5:146475-146497 CTGTGTGGAGGGGAGGAGAGAGG - Intronic
985925954 5:3019230-3019252 CCCTAGGGATGGGTGGAGAAAGG - Intergenic
986144713 5:5066461-5066483 CAGCAGGGCTGGGAGGAAATTGG + Intergenic
987011451 5:13770311-13770333 CAGAAGGGATGGGAAGAGAAGGG + Intronic
987384144 5:17313203-17313225 AGGTAGGGATGGGAGGAAGTAGG - Intergenic
988519304 5:31931590-31931612 CTGTAGCTATGGAAGTAGATGGG + Intronic
989262795 5:39437391-39437413 CTCTAGGGGTGGGAGGAACTGGG - Intronic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
991513811 5:67411392-67411414 CCTAAGGGATGGGAAGAGATGGG + Intergenic
991674048 5:69074968-69074990 CGGGAGGGATGGGAGGTGACAGG - Intergenic
992049282 5:72928368-72928390 CTATAGGGATGCTAGGATATGGG - Intergenic
992223894 5:74599749-74599771 CTTCAAGGATGGGAGGAGAAAGG - Intergenic
993318157 5:86437454-86437476 CTGAAGGAATGGCAGGAGGTGGG + Intergenic
994143820 5:96370662-96370684 CGGTAGGGATAGGAAGAGTTTGG + Intergenic
995080233 5:108042406-108042428 ATGTAGGGGTGGGAGGAAAATGG - Intronic
995803463 5:116025058-116025080 CTGTAGTGGTGGGAGGGGAGTGG - Intronic
995907197 5:117139646-117139668 CTGTGGATATGGGAGGAGAGAGG + Intergenic
996092291 5:119363009-119363031 CTGTAGGGAAAGGAGGGGACTGG + Intronic
996605125 5:125312870-125312892 CTGTTGGGAAGGAATGAGATTGG - Intergenic
997001648 5:129768906-129768928 CTGTAGGAAAGGGAGTGGATAGG + Intergenic
998158818 5:139801593-139801615 CTGTATGGAGGAGTGGAGATGGG - Intronic
998167029 5:139849972-139849994 CTGTAGGGAGCAGAGGAGCTGGG - Intronic
998871038 5:146551969-146551991 ATGTGGTGATGGGAGGAAATGGG - Intergenic
999122298 5:149218784-149218806 CTGTGGGGATGGGGGAAGAGAGG - Intronic
999901923 5:156094416-156094438 CAGTTGGGATGGGAGGATAAGGG - Intronic
999949528 5:156634105-156634127 CTGTGGGGAAGAGAGGAGAGAGG - Intronic
1000486461 5:161850340-161850362 ATTTAGGGATTGGAGGGGATAGG - Intronic
1000833673 5:166131581-166131603 GTGTAGGGATGGAGGGAGAGTGG + Intergenic
1000954393 5:167525143-167525165 CTGCAGGGTTGGGAGCAGCTTGG - Intronic
1001654687 5:173340509-173340531 CTGTAGGACTTGGAGGAGAAGGG + Intergenic
1001658014 5:173368822-173368844 TTAGAGGGATGGGAGGAGGTTGG + Intergenic
1001686360 5:173597611-173597633 ATGGAGGGATGGGATGGGATGGG - Intergenic
1001721542 5:173860878-173860900 CTGTAGGGCAGCGAGGAGAGAGG - Intergenic
1002069780 5:176672298-176672320 CAGTGGGGAGGCGAGGAGATGGG + Intergenic
1002523686 5:179804649-179804671 CTGCAGGGAAGGAAGGAGGTGGG - Intronic
1002791502 6:440922-440944 GGGAAGGGATGGGAGGGGATGGG - Intergenic
1002791514 6:440951-440973 GGGAAGGGATGGGAGGAGATGGG - Intergenic
1002854823 6:1027347-1027369 CAGGAAGGATGGGAGGAGGTGGG + Intergenic
1003786451 6:9492405-9492427 ATGCAGAGATGGGAGGAAATGGG + Intergenic
1004667499 6:17761932-17761954 CTATGGGGATGCGAGGGGATGGG + Intronic
1005959910 6:30687206-30687228 CTGGAGGGAGGGGAGGAGGGAGG + Exonic
1006288528 6:33116568-33116590 CAGTAGGGATAGGAGGAGTTGGG - Intergenic
1007049144 6:38808320-38808342 CTGTAGGGATGAGGGGCCATGGG - Intronic
1007294078 6:40808069-40808091 TTGCAGGGATGTGAGGAGTTAGG - Intergenic
1010400943 6:75445098-75445120 TTGCAGAGATGGGAGGAGAGGGG - Intronic
1010769399 6:79811319-79811341 CTGTAGTGAGGAGAGGAGTTGGG - Intergenic
1011650479 6:89501896-89501918 CTGTGGGGAGGTGATGAGATGGG - Intronic
1012912462 6:105133887-105133909 TTGTAGGGAAGGGAGGAGTGAGG + Intronic
1013186155 6:107760404-107760426 AGGTAGGGGTGGGAGAAGATGGG - Intronic
1013227779 6:108132918-108132940 CTGCAGGGTGGGGAGGAGATGGG + Intronic
1013480635 6:110549880-110549902 GTGGAGGCATGGGAGGAGCTGGG - Intergenic
1014432595 6:121388511-121388533 CTGCAGGGATGGAAGGAGAGGGG - Intergenic
1014605616 6:123470461-123470483 CACTAGTGATGGAAGGAGATGGG + Intronic
1015784759 6:136911138-136911160 CTGGAGGGAAGGGTGGGGATAGG - Intronic
1015891493 6:137974009-137974031 TTGGAGAGATGGGATGAGATGGG - Intergenic
1016292092 6:142537626-142537648 AGGTAGGGTTGGGAGGAGAAAGG - Intergenic
1018563407 6:165125822-165125844 ATGTAAGAGTGGGAGGAGATTGG - Intergenic
1018916031 6:168132935-168132957 CTGGTGGGATGCGAGGCGATCGG + Intergenic
1018996171 6:168712066-168712088 CCCTAGCTATGGGAGGAGATGGG + Intergenic
1019521639 7:1463384-1463406 CTGGAGGGAGGGGAGGAGACAGG + Intergenic
1019607817 7:1918874-1918896 CTGTAGAGAGGGGAGGGGAGGGG - Intronic
1020141533 7:5614641-5614663 TTTGAGGGAGGGGAGGAGATGGG + Intergenic
1020787561 7:12590331-12590353 GTGTAGGGATGGAGGGAGAGTGG + Intronic
1020879343 7:13739344-13739366 CTGAAGTCATGGGAAGAGATAGG + Intergenic
1022370283 7:29764803-29764825 CTGCAGGGTTAGGAGGAGAGTGG - Intergenic
1023061665 7:36333353-36333375 CTGGAGAGAGGGGAGGAAATGGG + Intronic
1024574930 7:50755647-50755669 GGGTAGGGATGGGAGGACCTGGG - Intronic
1024963349 7:55001537-55001559 CTCTAGTGATGGCTGGAGATGGG + Intergenic
1026940850 7:74287156-74287178 CAGAAGGGATGGGATGGGATGGG - Intergenic
1027443035 7:78240638-78240660 TTGTGGGGCTGGGAGGAGTTGGG + Intronic
1028503869 7:91550087-91550109 CCCTTGGGATGGGAGTAGATGGG + Intergenic
1029158672 7:98535417-98535439 CTGTAGGGAAGTGGGGACATTGG + Intergenic
1030060561 7:105617899-105617921 CTGGAGGGATGGCAGCCGATGGG - Intronic
1030875829 7:114812261-114812283 GTGTAGGGATGGGAGTAGATGGG - Intergenic
1033595629 7:142856041-142856063 CCCCAGGGATGGGAGGAGAGAGG - Intronic
1034111745 7:148544029-148544051 GTGTGGAGATGGGAAGAGATGGG + Intergenic
1034931573 7:155167736-155167758 GTCTGGGGCTGGGAGGAGATGGG - Intergenic
1034986389 7:155518104-155518126 CTGAGAGGATGGGAGGAGAAGGG - Intronic
1035270704 7:157718457-157718479 CTGCAGGGTTGGGAGGAGGAAGG - Intronic
1035291629 7:157842979-157843001 CTTTAGAGATGGGAGGAGGCCGG - Intronic
1035519901 8:267099-267121 GTGTGGGGATGTGGGGAGATGGG + Intergenic
1035560772 8:602082-602104 CTGGAGGGAAGGGAGGTGCTGGG + Intergenic
1036885248 8:12547348-12547370 ATGTAGGGATGGACTGAGATAGG - Intergenic
1037297112 8:17413224-17413246 GAGGAGGGACGGGAGGAGATGGG - Intronic
1037736499 8:21571175-21571197 CTGTAGGTTTTGGAGGAGAGTGG - Intergenic
1038129360 8:24712446-24712468 CATTAGGGAGGGGAGGAGAAAGG + Intergenic
1038519414 8:28217017-28217039 CTGGAGGAATGGAAGCAGATGGG + Intergenic
1039242740 8:35574266-35574288 CTGTTGGGATTGGAGAAGAAAGG + Intronic
1040386562 8:46918312-46918334 GAGCCGGGATGGGAGGAGATCGG + Intergenic
1041494870 8:58474760-58474782 CTGGAGGTGTGGGTGGAGATGGG - Intergenic
1041814302 8:61950474-61950496 ATGAAGGGATGGGAGGAGCGGGG + Intergenic
1041917619 8:63152304-63152326 GTGTGAGGATGGGAGGTGATAGG + Intergenic
1042193339 8:66210289-66210311 CTGAAGGGAAGGGAGGTGACTGG + Intergenic
1042200590 8:66276579-66276601 CTGTAGACATGGGAGGAGACAGG - Intergenic
1043976033 8:86585866-86585888 GTTTATGGATGGAAGGAGATAGG + Intronic
1044920553 8:97165458-97165480 CTTTGGGGTTGGGAGGAGAATGG - Intergenic
1045858449 8:106790617-106790639 CTATAGGGATGCTAGGATATGGG - Intergenic
1046352585 8:113034051-113034073 CTGCATGGATGTGAGGGGATGGG - Intronic
1047555960 8:125930624-125930646 CTGTAGGGAGGGGAGAAGTCTGG + Intergenic
1047654098 8:126957221-126957243 CTGAAGGGCTGGGTGGAGAAAGG - Intergenic
1047758166 8:127934448-127934470 CTCTCGGGATGGGAGGAAGTTGG + Intergenic
1048245114 8:132787259-132787281 CTGGGGGGGTGGGAGGAGAGAGG + Intronic
1049163105 8:141110284-141110306 CTGTAGGGTTGGGTTGAGAGGGG + Intergenic
1049301714 8:141874086-141874108 GTGTAGGGGAGGGAGGTGATGGG + Intergenic
1049301743 8:141874222-141874244 GTGTAGGGGAGGGAGGTGATGGG + Intergenic
1049301788 8:141874437-141874459 GTGTAGGGGAGGGAGGTGATGGG + Intergenic
1049438802 8:142599833-142599855 CTCTAGAGAGGGGAGCAGATAGG + Intergenic
1049614726 8:143571119-143571141 ATTTGGGGATGGGGGGAGATGGG - Intronic
1049963091 9:755093-755115 CTGTGGGGAAGGGTGGAGCTAGG + Intergenic
1050033675 9:1412872-1412894 CGGGAGGGATGGTGGGAGATCGG + Intergenic
1050683654 9:8142659-8142681 TTGTAGAGCTGGGAGGAGCTGGG - Intergenic
1051375241 9:16395749-16395771 TGGTAGGGATGGGATTAGATAGG - Intergenic
1053130651 9:35613299-35613321 CTTTAGGGAGTGGAGGAGATGGG - Intronic
1053278421 9:36800491-36800513 ATGCACGGAAGGGAGGAGATGGG + Intergenic
1054453889 9:65420012-65420034 AGGGAGGGATGGGAGGAGAAGGG + Intergenic
1054789367 9:69240994-69241016 CTGCAGTGAGGGGAGTAGATGGG + Intronic
1056946853 9:91005026-91005048 CTGCAGGGATAGGTGGAGCTCGG - Intergenic
1056976251 9:91257453-91257475 CTGTTGGGGTGGGAGGAGGCTGG - Intronic
1057130539 9:92651416-92651438 GCGAAGGGATGGGAGGGGATTGG + Intronic
1058839314 9:108890884-108890906 CTGTGGGGAAGGAAGGAGAGTGG - Intronic
1059364780 9:113778196-113778218 TTTTAGGGATGGGAGGAATTTGG - Intergenic
1060082597 9:120665147-120665169 AAGGAAGGATGGGAGGAGATTGG - Intronic
1060153256 9:121301948-121301970 CTGTTGGGCTGGGATGAGACAGG - Exonic
1060779300 9:126399900-126399922 CTGGAGCCATGGGAGGCGATGGG + Intronic
1060999823 9:127896825-127896847 CTGGGGGGATGGGAGGACGTAGG - Intronic
1061367228 9:130178380-130178402 ATGTAGGGAAGGGAGAAGCTGGG - Intronic
1062264227 9:135679564-135679586 CTCTAGGGAGGGGTGGGGATAGG - Intergenic
1062733396 9:138121358-138121380 CTGGGGGGATGGGAGGAGAGAGG - Intronic
1185680702 X:1886575-1886597 CTGCTGGGCTGGGAGGAGAAGGG - Intergenic
1185885285 X:3776860-3776882 CTGTAGCGATGGGGGAAGCTGGG + Intergenic
1186130188 X:6457550-6457572 CTGCCTGGCTGGGAGGAGATGGG + Intergenic
1187103197 X:16216029-16216051 CTGTAGAGGAGGGAGGAGATGGG + Intergenic
1187720764 X:22148633-22148655 CTGGAGGGAGGGGGAGAGATAGG - Intronic
1187840861 X:23485991-23486013 CTGTCGGGAGGTGAGGGGATGGG + Intergenic
1188503986 X:30861355-30861377 GTGGGGGGATGGCAGGAGATGGG - Intronic
1190432833 X:50394232-50394254 CAGTGGGGGTGGGAGGAGGTGGG + Intronic
1190693911 X:52935379-52935401 CTGGCTGGATGGGAGGAGAATGG - Intronic
1190808843 X:53864376-53864398 CTCTGGGGGTGGGAGGAGGTGGG - Intergenic
1192246662 X:69378715-69378737 CTGTAGGGATACCATGAGATGGG - Intergenic
1192358889 X:70426115-70426137 CAGTAGGGATGGGAGTGCATGGG + Intronic
1197726884 X:129782311-129782333 CTGTAGGCATGGGTGGGGATAGG + Intronic
1197872017 X:131069780-131069802 TTGTAAGGAGGGGAGGTGATGGG - Intronic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1198889176 X:141373879-141373901 ATGTGGGGATTGGAGGAGTTAGG + Intergenic
1202242786 Y:22788211-22788233 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1202298706 Y:23387508-23387530 ATGAAGGAATGGGAGAAGATAGG + Intergenic
1202395773 Y:24421961-24421983 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1202475012 Y:25248131-25248153 CTGTAGGGAGGCTAGGATATGGG + Intergenic
1202572103 Y:26283090-26283112 ATGAAGGAATGGGAGAAGATAGG - Intergenic