ID: 919765088

View in Genome Browser
Species Human (GRCh38)
Location 1:201122017-201122039
Sequence GTTTCAACACTGATGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919765085_919765088 1 Left 919765085 1:201121993-201122015 CCTTTCAGAATCTTGACGGGTAT 0: 1
1: 0
2: 0
3: 2
4: 60
Right 919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 213
919765081_919765088 28 Left 919765081 1:201121966-201121988 CCAGACCACATATTCAACATAAG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 213
919765082_919765088 23 Left 919765082 1:201121971-201121993 CCACATATTCAACATAAGCAATC 0: 1
1: 0
2: 1
3: 24
4: 221
Right 919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919765088 Original CRISPR GTTTCAACACTGATGGGAGA AGG Intronic
900428590 1:2591760-2591782 ATTTCAATGCTGATGGGAGGAGG - Intronic
903644573 1:24886823-24886845 CCCTCAGCACTGATGGGAGACGG - Intergenic
906892600 1:49733635-49733657 ATTGCAACAGTGATGGGAGGTGG + Intronic
909264379 1:73537709-73537731 GATGCAGCACTGATGGGAGTGGG + Intergenic
909592607 1:77368022-77368044 CTTTTAACAATGATGGGTGAAGG + Intronic
909858901 1:80578221-80578243 GTTTCAAAACTGAAAGGAAAAGG - Intergenic
912573910 1:110646577-110646599 GTAACAACTCAGATGGGAGATGG + Intergenic
913162080 1:116153539-116153561 GTTTCTAAACTCCTGGGAGATGG - Intergenic
915485032 1:156214266-156214288 GTTTCAACACTGATGTGCTGGGG - Intronic
919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG + Intronic
922134581 1:222812521-222812543 TGTTCAAAACTGATGGGAAAAGG - Intergenic
922357059 1:224786368-224786390 ACTTCAACACTGTTGGGAGCTGG - Intergenic
923483003 1:234402209-234402231 GTTTCACCTTTGGTGGGAGAAGG + Intronic
1063119281 10:3093247-3093269 CTTTCAACACTGTTGGGGGAAGG - Intronic
1065292187 10:24241873-24241895 GGTTCCACACTCCTGGGAGAAGG + Intronic
1068769428 10:60804370-60804392 GTTTAGGCACTGGTGGGAGAGGG + Intergenic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1070209210 10:74297850-74297872 GTTGCAACACAGATTGGAGTTGG + Intronic
1070651127 10:78237144-78237166 GCTTGAACACTGCTGGGGGAGGG + Intergenic
1071380903 10:85058500-85058522 GCTGTAACAGTGATGGGAGAGGG + Intergenic
1071614823 10:87065876-87065898 GTCACAGCACTGATGGGTGAAGG + Intronic
1074874108 10:117601034-117601056 GCTTCAAGGCTGATGGGGGAAGG + Intergenic
1076105028 10:127814994-127815016 GTTATGACACTGATGGGGGAGGG - Intergenic
1077325862 11:1963793-1963815 GTTTTAGCACTGATCGCAGAAGG + Intronic
1078744203 11:14095896-14095918 GATTCCACAGTGATGGAAGAAGG - Intronic
1079435017 11:20438813-20438835 GCTTCAACCCTGATGGCAGAGGG + Intronic
1080244280 11:30162255-30162277 GTTGCATCTCTGAAGGGAGAAGG + Intergenic
1082854088 11:57791123-57791145 GTCTCTACACTGTTAGGAGAGGG - Intronic
1083077989 11:60061331-60061353 GTTTAAACACTGATTTAAGAGGG + Intronic
1083949186 11:65944707-65944729 GTTTCAATCCAGGTGGGAGATGG + Intergenic
1084612606 11:70212999-70213021 CTTACAACATTGCTGGGAGAGGG - Intergenic
1086969817 11:93068177-93068199 GATTCAACACAGTTAGGAGATGG + Intergenic
1087229633 11:95645865-95645887 AATTCAACAGTGCTGGGAGATGG + Intergenic
1087790948 11:102406043-102406065 ATTTCAACAGTTAAGGGAGAGGG - Intronic
1089038220 11:115419298-115419320 GATTGAACACTGTTGTGAGAAGG - Intronic
1089761143 11:120724493-120724515 GTTTTTACAATGATTGGAGAAGG + Intronic
1090043481 11:123310956-123310978 TTTTCTAGACTGATTGGAGAAGG - Intergenic
1090376244 11:126291724-126291746 CTTTCAGCACTGAGGGGAGGTGG - Intronic
1090715138 11:129423633-129423655 GTTTCAAAACTTATGTGAAAAGG + Intronic
1202808842 11_KI270721v1_random:18972-18994 GTTTTAGCACTGATCGCAGAAGG + Intergenic
1097063403 12:56302341-56302363 TTCTCAACACTGATGGGACCTGG + Intronic
1099709922 12:86210934-86210956 GTTTCTAATCTGATTGGAGAGGG + Intronic
1103427279 12:120847206-120847228 ATTTCAACACTAATTAGAGAGGG + Intronic
1108718032 13:53101110-53101132 GTTGCAACAATGAAGGGAGAAGG - Intergenic
1111313838 13:86525494-86525516 GTTTCAGCTGTGATTGGAGAGGG + Intergenic
1111946926 13:94675825-94675847 GTTTCAAGCCTGATGGGAAAAGG + Intergenic
1113130996 13:107036879-107036901 GTTTTCTCACTGCTGGGAGAAGG + Intergenic
1113864663 13:113513018-113513040 TCTCCAACACTGATGGGATAAGG + Intronic
1115327556 14:32158645-32158667 GTTTCAATACATATGGGACATGG + Exonic
1117583129 14:57172885-57172907 GTTTCTATGGTGATGGGAGAAGG - Intergenic
1118170762 14:63386470-63386492 GTTCGCACACTGGTGGGAGAAGG + Intronic
1121600004 14:95196255-95196277 GTTTGAAGACTGAGGAGAGAAGG + Intronic
1121614472 14:95303870-95303892 GTTTCAATAAAGTTGGGAGATGG - Intronic
1127414646 15:58746203-58746225 TTTTCAACAGTTATGAGAGAGGG - Intronic
1130108883 15:80949042-80949064 GTTTCAGCCCTGATGGGCCAAGG + Exonic
1130304571 15:82704587-82704609 GGTTCCACACAGATGGGACAAGG - Intronic
1130382098 15:83379751-83379773 CCTTCAACACTGACTGGAGACGG + Intergenic
1130904844 15:88233068-88233090 GCTTCAAGGCTGAGGGGAGAAGG + Intronic
1136086410 16:27888268-27888290 CTTTCAGAAGTGATGGGAGATGG + Intronic
1139345279 16:66299083-66299105 GTTTCAACAGAGATTGGAAAAGG - Intergenic
1139383371 16:66548589-66548611 GTCTCAACACTGGGGGGAGAGGG + Intronic
1140912400 16:79466139-79466161 GTTTCATCAGTGATTGTAGAAGG - Intergenic
1142893445 17:2959797-2959819 ATTTCTTCACTGAGGGGAGAAGG + Intronic
1143287934 17:5805144-5805166 AGTTCAACAATGATGGGAGGTGG - Intronic
1147378762 17:40039605-40039627 GTATAAACACTGATGGGAAAGGG - Intronic
1149572725 17:57685052-57685074 TTATCAACAGTGCTGGGAGAAGG + Intergenic
1151759641 17:76093303-76093325 ATTTCCACACTGGAGGGAGAAGG + Intronic
1155756033 18:29497733-29497755 GTATCAAAACTGATGGAAAATGG - Intergenic
1156181093 18:34605415-34605437 GTTGCAACACTGATTGGTGGAGG - Intronic
1156522846 18:37736294-37736316 GTTTCAGCACTGATGGGGTGTGG - Intergenic
1160155454 18:76430199-76430221 TTTTCAAAAATGATGGAAGATGG - Intronic
1161217385 19:3101223-3101245 GTGTCCACACTGATGGGTGCTGG + Intronic
1161887046 19:7005159-7005181 TTTTCAACAACGATGGGACATGG + Intergenic
1167734670 19:51286307-51286329 CTTTCAACTATGAAGGGAGAGGG - Intergenic
1168360226 19:55733491-55733513 ATTTCAACTCATATGGGAGAAGG - Exonic
1168412837 19:56150512-56150534 GTGTGGACACTGATAGGAGAAGG - Intronic
925544574 2:5003316-5003338 GTTCCCACACAGATGGGACACGG - Intergenic
925802879 2:7618709-7618731 GTGTGAACTCTGATGGGACATGG + Intergenic
926824813 2:16894260-16894282 CTTTCCACACTGATTTGAGATGG + Intergenic
930451713 2:51547533-51547555 GTCCCAAAACTGATAGGAGATGG - Intergenic
931936872 2:67208193-67208215 GTTTCAACATGGATTTGAGATGG + Intergenic
932450054 2:71803802-71803824 GATTCAACACCATTGGGAGATGG + Intergenic
934334963 2:92120329-92120351 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934339969 2:92249507-92249529 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934350795 2:92421351-92421373 GTTTCAACACTGGTAGTTGAGGG - Intergenic
934365629 2:92656855-92656877 GTTTCAACACTGGTAGTTGAGGG - Intergenic
934368044 2:92695741-92695763 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934372323 2:92764066-92764088 GCTTCAACACTGTTGGTTGAGGG - Intergenic
934377424 2:92845782-92845804 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934377695 2:92850192-92850214 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934377882 2:92853249-92853271 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934380723 2:92898349-92898371 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934383953 2:92950833-92950855 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934385932 2:92982595-92982617 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934390340 2:93053913-93053935 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934391282 2:93069192-93069214 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934391934 2:93079713-93079735 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934393185 2:93099736-93099758 GCTTCAACACTGTTGGTTGAGGG - Intergenic
934396151 2:93148114-93148136 GCTTCAACACTGTTAGGTGAGGG - Intergenic
934396293 2:93150490-93150512 GCTTCAACACTGTTGGTTGAGGG - Intergenic
934402666 2:93254101-93254123 GCTTCAACACTGTTGGTTGAGGG - Intergenic
934404047 2:93276177-93276199 GCTTCAACACTGATAGTTGAGGG - Intergenic
934414882 2:93449945-93449967 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934427019 2:93644445-93644467 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934428127 2:93662266-93662288 GCTTCAACACTGTTAGGTGAGGG - Intergenic
934429277 2:93680773-93680795 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934435380 2:93779537-93779559 GTTTCAACACTGCTAGTTGAGGG - Intergenic
934436665 2:93800241-93800263 GCTTCAACACTGTTGGTTGAGGG - Intergenic
934442443 2:93893493-93893515 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934443927 2:93917605-93917627 GCTTCAACACTGTTGGTTGAGGG - Intergenic
934451152 2:94034402-94034424 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934451322 2:94037122-94037144 GTTTCAACACTGGTAGTTGAGGG - Intergenic
934451592 2:94041528-94041550 GTTTCAACACTGCTAGTTGAGGG - Intergenic
934452231 2:94051708-94051730 GTTTCAACACTGCTAGTTGAGGG - Intergenic
934453191 2:94067161-94067183 GTTTCAACACTGCTAGTTGAGGG - Intergenic
934454799 2:94142919-94142941 GTTTCAACACTGTTAGTTGAGGG - Intergenic
934504274 2:94879092-94879114 GTTTCATCTCTGATGCCAGATGG + Intergenic
936014920 2:108950783-108950805 GAATCAACACTGTTGGCAGAAGG + Intronic
936554425 2:113481530-113481552 ATTTCAACACTGATGGGGACAGG - Intronic
938071859 2:128312578-128312600 GTTTCACCCCTGCTGAGAGAGGG - Intronic
938961334 2:136344324-136344346 GTTTCCACACTCATGGAAGTTGG + Intergenic
940554416 2:155205371-155205393 CTTTCAACACTGCAGGGAGAGGG - Intergenic
940726418 2:157341478-157341500 GTTCCCACACAGATGGGACATGG + Intergenic
941860344 2:170272652-170272674 GTGTCAACAGTGTTGGGAGGTGG + Intronic
944260545 2:197671187-197671209 GATTCTAAACTGATGGGAAATGG - Intronic
944478048 2:200126985-200127007 TTTTCAACAGAGATGGCAGATGG + Intergenic
945554708 2:211263805-211263827 GGTTCCACACAGATGGGACACGG - Intergenic
1170409255 20:16070652-16070674 GTTTATACACTGTTGGCAGAAGG - Intergenic
1171585043 20:26510509-26510531 GGTTCAACACTGTTAGTAGAGGG - Intergenic
1171591517 20:26609196-26609218 GTTTCAACACTGCTAGTTGAGGG - Intergenic
1171717475 20:28505190-28505212 GGTTCAACACTGTTAGTAGAGGG - Intergenic
1173304636 20:41836576-41836598 GTTTTAACACTGGAGAGAGAAGG - Intergenic
1173898049 20:46565830-46565852 GTTTCAACACTGTTGATAGTTGG - Intronic
1182881167 22:33734762-33734784 GTTTAAACAGAGGTGGGAGAAGG - Intronic
1183867451 22:40715024-40715046 TTCACATCACTGATGGGAGATGG + Intergenic
1202717296 2_KI270715v1_random:21833-21855 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202717521 2_KI270715v1_random:25224-25246 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202719043 2_KI270715v1_random:48997-49019 GCTTCAACACTGATAGTTGAGGG - Intergenic
1202719145 2_KI270715v1_random:50694-50716 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202719186 2_KI270715v1_random:51374-51396 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202719808 2_KI270715v1_random:61228-61250 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202729612 2_KI270716v1_random:50341-50363 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202730477 2_KI270716v1_random:63933-63955 GCTTCAACACTGATAGTTGAGGG - Intergenic
1202730580 2_KI270716v1_random:65629-65651 GCTTCAACACTGATAGTTGAGGG - Intergenic
1202731145 2_KI270716v1_random:74469-74491 GTTTCAACACTGTTAGTTGAGGG - Intergenic
1202735260 2_KI270716v1_random:140234-140256 GTTTCAACACTGTTAGTTGAGGG - Intergenic
949201497 3:1385735-1385757 CTTACAACACTGCTGGGACAGGG + Exonic
949545029 3:5065407-5065429 AATCCAACACTGAGGGGAGAAGG - Intergenic
950024601 3:9811488-9811510 GTTACAACACAGACGGGAGAAGG - Intronic
950336521 3:12198530-12198552 GTTGCAACACTGCAGGAAGATGG + Intergenic
955345048 3:58154717-58154739 GTTTGAACAAGGATGGAAGAGGG + Intronic
956388517 3:68746979-68747001 GTCTCAAGACAGCTGGGAGAGGG - Intronic
959382556 3:105659091-105659113 ATTGCAAAACTCATGGGAGAGGG - Exonic
960234915 3:115271044-115271066 ACTTCAGCAGTGATGGGAGAAGG - Intergenic
961192116 3:124970674-124970696 CTTTCATCACTGATGAAAGACGG + Exonic
961554423 3:127688470-127688492 GTTTCCACACGGAGGCGAGAGGG - Intergenic
961690169 3:128663743-128663765 TTTTCAACAATGATGGGGGCAGG - Intronic
970203925 4:13637044-13637066 ATTTCAACAGAGAAGGGAGAAGG + Intergenic
971530800 4:27686298-27686320 GTATCAACACTGATGCCTGAGGG - Intergenic
977346027 4:95817312-95817334 GATGCAAAACTGATGAGAGATGG - Intergenic
981152482 4:141395510-141395532 GTTTCATCACTAATGGGCAATGG - Intergenic
983574206 4:169242628-169242650 AATGCAACAGTGATGGGAGATGG + Intronic
983805770 4:171989408-171989430 GTTCCTACACAGATGGGATACGG + Intronic
984767360 4:183409853-183409875 TTTTCTCCTCTGATGGGAGATGG + Intergenic
986134042 5:4957906-4957928 GTTGCTGGACTGATGGGAGAGGG + Intergenic
986561243 5:9062367-9062389 GTTTCAGGTCTGCTGGGAGAAGG + Intronic
988174345 5:27702152-27702174 GTTTCCACAATGAAGGGAGGAGG - Intergenic
990549190 5:56855704-56855726 TTTTCTACACTGATAGGAAAAGG - Intronic
992153550 5:73930922-73930944 GTTTCAACACAGGAGAGAGAAGG - Intronic
993264169 5:85700247-85700269 GAGTCAAGACTGATGGCAGATGG - Intergenic
993472595 5:88324192-88324214 GATGCAACAGTGTTGGGAGATGG + Intergenic
993486214 5:88489340-88489362 GTTTCAACAATGAAGAAAGAAGG - Intergenic
996786423 5:127241562-127241584 GTTATAAGACTGCTGGGAGAGGG + Intergenic
996985945 5:129564666-129564688 TGTTCATCACTGATGGGACAAGG - Intronic
1000633034 5:163612702-163612724 GTTTCATCACTGGTGAGAAAAGG + Intergenic
1000846065 5:166281596-166281618 ATTTCAACACTGATTGCAAACGG + Intergenic
1000955746 5:167541555-167541577 TTTACAACACTGAAGTGAGACGG - Intronic
1003306490 6:4933615-4933637 TTTTAAACAAAGATGGGAGAAGG + Intronic
1004581026 6:16952306-16952328 GCTACAACATTAATGGGAGAGGG - Intergenic
1006454582 6:34124478-34124500 GCTTCCACACTGGAGGGAGACGG - Intronic
1008463716 6:51806057-51806079 ATTGCCACACTGATGGGAGGGGG + Intronic
1009895060 6:69738416-69738438 GTCTCAAGACTGAGGGGAGAAGG - Intronic
1013926089 6:115474349-115474371 ATTTCAAAATTGAAGGGAGACGG + Intergenic
1015430636 6:133126994-133127016 ATTTCAACACTGAAAGGACAAGG + Intergenic
1015581635 6:134731256-134731278 ATTCTACCACTGATGGGAGAAGG + Intergenic
1016085683 6:139911414-139911436 GATGCAACACTGCTGAGAGATGG - Intergenic
1018422795 6:163653901-163653923 GTCTCAACACTGGTGGGAATGGG - Intergenic
1018451560 6:163913000-163913022 GTTTCAGCACTGGTGGGTGGAGG + Intergenic
1018552976 6:165019877-165019899 GTTTCAACACTGTTTGTTGAAGG - Intergenic
1021386606 7:20038799-20038821 ATTTCAAAACAGATGGTAGAAGG + Intergenic
1021994944 7:26170190-26170212 TTTTCAAGACTGATGTGACATGG + Intronic
1024463997 7:49690039-49690061 GGTTAAACACCTATGGGAGAGGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025023456 7:55497541-55497563 GTGACAACACTGATGGGGGGGGG + Intronic
1026365616 7:69645669-69645691 TTTTCAACACTGAGGGGATTGGG - Intronic
1028808201 7:95053578-95053600 TTTTGAACTATGATGGGAGAGGG + Intronic
1029181377 7:98704380-98704402 GTTTCCGCACTGATGGGTGAGGG - Intergenic
1029952419 7:104601274-104601296 GTTTAGTCACTAATGGGAGAGGG - Intronic
1031955658 7:127939934-127939956 GTTTTAATACTGATGAGACAAGG + Intronic
1033306310 7:140228421-140228443 GTTCCAACACCGTTTGGAGATGG + Intergenic
1035780553 8:2224124-2224146 GCTTCAACACTGGTTTGAGAGGG - Intergenic
1037353402 8:17990501-17990523 GTTTTACAGCTGATGGGAGAGGG - Intronic
1037491229 8:19398906-19398928 ATTTAATCACTGATGGGAAAAGG - Intergenic
1037751619 8:21686018-21686040 ATGTCAACACCGATGGGAGGTGG - Intergenic
1040811823 8:51461760-51461782 GTGTCAACAGTGATTGGAGGAGG + Intronic
1045323341 8:101098385-101098407 ATTTCAACATCCATGGGAGATGG + Intergenic
1046292314 8:112179268-112179290 GTTTGAACCCTGATAGGAAATGG - Intergenic
1047119999 8:121891876-121891898 GAATAAAAACTGATGGGAGAGGG + Intergenic
1048240351 8:132735238-132735260 GTGTCAACACAGCTGGGAAAGGG + Intronic
1049898582 9:135655-135677 ATTTCAACACTGATGGGGACAGG + Intronic
1050217665 9:3345920-3345942 ATACCAACACTGATGGGAGGTGG + Intronic
1051171392 9:14321594-14321616 TTTCCACCACTGAGGGGAGAGGG + Intronic
1053597943 9:39582836-39582858 GTTTAAACACTAATGGGAAATGG + Intergenic
1053741634 9:41145958-41145980 ATTTCAACACTGATGGGGACAGG + Intronic
1053855967 9:42339845-42339867 GTTTAAACACTAATGGGAAATGG + Intergenic
1054346846 9:63975440-63975462 ATTTCAACACTGATGGGGACAGG + Intergenic
1054444625 9:65302103-65302125 ATTTCAACACTGATGGGGACAGG + Intergenic
1054485646 9:65719397-65719419 ATTTCAACACTGATGGGGACAGG - Intronic
1054686710 9:68285342-68285364 ATTTCAACACTGATGGGGACAGG - Intronic
1059256341 9:112934655-112934677 GCTTCAGCAATGATGGGAGTGGG + Intergenic
1060810565 9:126609676-126609698 TTTTCCAGCCTGATGGGAGAGGG - Intergenic
1188022891 X:25177545-25177567 GTTGCAAGACTCATTGGAGAAGG + Intergenic
1190032961 X:46992138-46992160 GTTTCATTACTGCTGGGAGAAGG - Intronic
1191825572 X:65362051-65362073 GTTCCCACACTGATGGGACATGG - Intergenic
1192779760 X:74282339-74282361 GTTTTCACACTGATAGGAAAAGG + Intergenic
1193046938 X:77063842-77063864 TTTTCCACACAGCTGGGAGAAGG - Intergenic
1194706728 X:97184193-97184215 GTTTCTTCAATGATGGGAAAAGG - Intronic
1198830166 X:140741937-140741959 TTTTTCTCACTGATGGGAGATGG + Intergenic