ID: 919765088

View in Genome Browser
Species Human (GRCh38)
Location 1:201122017-201122039
Sequence GTTTCAACACTGATGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919765081_919765088 28 Left 919765081 1:201121966-201121988 CCAGACCACATATTCAACATAAG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 213
919765085_919765088 1 Left 919765085 1:201121993-201122015 CCTTTCAGAATCTTGACGGGTAT 0: 1
1: 0
2: 0
3: 2
4: 60
Right 919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 213
919765082_919765088 23 Left 919765082 1:201121971-201121993 CCACATATTCAACATAAGCAATC 0: 1
1: 0
2: 1
3: 24
4: 221
Right 919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919765088 Original CRISPR GTTTCAACACTGATGGGAGA AGG Intronic