ID: 919768163

View in Genome Browser
Species Human (GRCh38)
Location 1:201140589-201140611
Sequence GCAGGAGAGCTCCTGGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919768152_919768163 8 Left 919768152 1:201140558-201140580 CCTCTTCCTCTTCCAGTTCTTTA 0: 1
1: 0
2: 4
3: 139
4: 1252
Right 919768163 1:201140589-201140611 GCAGGAGAGCTCCTGGTCACAGG 0: 1
1: 0
2: 2
3: 18
4: 190
919768156_919768163 -4 Left 919768156 1:201140570-201140592 CCAGTTCTTTACCCCCTGGGCAG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 919768163 1:201140589-201140611 GCAGGAGAGCTCCTGGTCACAGG 0: 1
1: 0
2: 2
3: 18
4: 190
919768153_919768163 2 Left 919768153 1:201140564-201140586 CCTCTTCCAGTTCTTTACCCCCT 0: 1
1: 0
2: 2
3: 32
4: 385
Right 919768163 1:201140589-201140611 GCAGGAGAGCTCCTGGTCACAGG 0: 1
1: 0
2: 2
3: 18
4: 190
919768151_919768163 11 Left 919768151 1:201140555-201140577 CCTCCTCTTCCTCTTCCAGTTCT 0: 1
1: 1
2: 67
3: 486
4: 3402
Right 919768163 1:201140589-201140611 GCAGGAGAGCTCCTGGTCACAGG 0: 1
1: 0
2: 2
3: 18
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919768163 Original CRISPR GCAGGAGAGCTCCTGGTCAC AGG Intronic
900236818 1:1597019-1597041 GCATCTGAGCTCGTGGTCACTGG - Intergenic
900483644 1:2911155-2911177 GCAGGTGAGCTCCTGGGCCGAGG + Intergenic
901300383 1:8196166-8196188 GCAGGAGAGCAGCGTGTCACAGG + Intergenic
903037159 1:20500355-20500377 ACAGAAGAGCTGCTGATCACTGG + Exonic
903642075 1:24867133-24867155 GCAGATGAGGTCCTGGTCCCTGG + Intergenic
905604001 1:39280414-39280436 GTGGGAGAGCTCCTCGCCACTGG - Intronic
906193665 1:43915202-43915224 GCTGAAGAGCTGCTGGTCACTGG + Intronic
906219587 1:44068431-44068453 GCAGGAGAGCTCCTGGGGCAGGG + Intergenic
907029223 1:51153994-51154016 CCACTAGAGCTCCTGGTAACAGG + Intergenic
909357072 1:74721873-74721895 GCAGGATAGCCACTGGACACGGG + Intronic
911025809 1:93434697-93434719 GCAGGATAGCTCCTATCCACAGG + Intergenic
911025813 1:93434719-93434741 GCAGGATAGCTCCTATCCACAGG + Intergenic
914850478 1:151310244-151310266 GGAGGAGAGCTCCTGGGAAAGGG + Exonic
915467387 1:156105460-156105482 GCAGGAGATTTCCTGGCCGCTGG - Intronic
915476384 1:156155107-156155129 CCTGGCGAGCTCCGGGTCACCGG - Intronic
915567797 1:156725981-156726003 GCAAGAGACCTGCTGGTCTCAGG - Intronic
916353648 1:163880142-163880164 GCTGGTGAGATACTGGTCACAGG - Intergenic
917114091 1:171584502-171584524 GCTGGAGAGCACTTGGTGACTGG - Exonic
918447581 1:184630534-184630556 GCAAGAGAACTCCAGGTTACTGG - Intergenic
919690483 1:200524308-200524330 GCAGGTGGGCTCCAGGTCTCTGG + Intergenic
919768163 1:201140589-201140611 GCAGGAGAGCTCCTGGTCACAGG + Intronic
919927516 1:202199974-202199996 CCAGCAGAGCTACTGGTGACAGG + Intronic
920315651 1:205074239-205074261 GCGGGAGAGCTCTTGGTCCCAGG - Exonic
920396483 1:205649704-205649726 GGAGGACAGCTCCTGTTCCCAGG + Intergenic
921323391 1:213966235-213966257 ACAGAAGAGCTCCTTGGCACTGG - Intergenic
921559127 1:216635693-216635715 GCAGGAGAGCTGAAGGTGACAGG - Intronic
924782886 1:247169258-247169280 GCAGGAGATTCCCTGGTCCCCGG + Intronic
1062965220 10:1602018-1602040 GCAGGAGGGCTCATGGGAACCGG + Intronic
1065742443 10:28809156-28809178 CCAGGAGAATTCTTGGTCACAGG + Intergenic
1065869489 10:29944096-29944118 GCAGGAGAGCTGCTTGACTCTGG + Intergenic
1069686071 10:70319578-70319600 GCTAGATAGCACCTGGTCACAGG - Intronic
1072080466 10:92024928-92024950 GCAGCATACCTCCTGGTCAGAGG + Exonic
1073392641 10:103192559-103192581 TCCGGACAGCTCCTGGTCAGGGG - Intronic
1076886702 10:133266438-133266460 GCAGGAGAGCCCCTGCCCTCTGG - Intronic
1077445755 11:2589931-2589953 GCTGGAGACCTCCTGCCCACTGG + Intronic
1077887175 11:6394798-6394820 GCAGTCTAGCTCCTGGGCACAGG - Exonic
1081854610 11:46295666-46295688 GCCGCAGAGCTCCTGGCCAATGG - Intronic
1081866849 11:46364938-46364960 GCAGGTGATCTCCTGGGCCCTGG - Intronic
1081907043 11:46676801-46676823 ACAGGAGAGGCCCTGGTCATAGG + Intergenic
1083222371 11:61261124-61261146 GCAGGAGAGTTGCTGGAAACCGG + Intronic
1083879538 11:65541180-65541202 GCAGGAGTGCTGCTGCTCTCTGG - Exonic
1084190333 11:67495751-67495773 GCAGGAGTGCAGCTGGCCACTGG - Intronic
1091057702 11:132434184-132434206 GCATGGGTGTTCCTGGTCACTGG + Intronic
1091907226 12:4198751-4198773 TCATGAGAGCTCCTGCTCTCAGG + Intergenic
1092981735 12:13801721-13801743 GCTGGACAGCTCCTTGACACAGG - Intronic
1095853736 12:46838751-46838773 GCAGAATGGCTCCTGGTCAGTGG - Intergenic
1096543067 12:52319123-52319145 GCAGGAGGGGTTCTGGGCACAGG - Intronic
1097326725 12:58285633-58285655 GCAGGAAAGCTCCTAGTCGTAGG - Intergenic
1098804773 12:75009815-75009837 GGGAGAGAGCTCCTGGTCAAGGG - Intergenic
1101938625 12:109082085-109082107 TCAGAAGAGCTCAGGGTCACTGG - Intronic
1104014735 12:124954181-124954203 CCTGGTGAGCTCCTCGTCACTGG + Exonic
1104053085 12:125209393-125209415 GCAGCAGAGTGGCTGGTCACTGG + Intronic
1104891649 12:132143131-132143153 GCAGGCGAGCGCCAGGTCACAGG - Intronic
1104956045 12:132466365-132466387 GCACAGGAGTTCCTGGTCACAGG - Intergenic
1110769372 13:79321233-79321255 GCAGGAGAGCTCCTGGTATTAGG - Intronic
1112327249 13:98450085-98450107 GAAGCAGAGGTGCTGGTCACAGG - Intronic
1115205439 14:30898645-30898667 GAAGGAGAGGTCCTCGTTACTGG - Intronic
1117836679 14:59815343-59815365 GAAGGAGGGCTCCTGTGCACAGG - Intronic
1118491839 14:66268874-66268896 GCATGAGAACTCCTGGTCTAAGG - Intergenic
1119620741 14:76130252-76130274 GCAGGAGTTTTCCTGGGCACAGG - Intergenic
1122200228 14:100118151-100118173 GTAGGAGAGCACCTGCTCATGGG - Intronic
1122327547 14:100891528-100891550 GCAGGAGCGCTGCTGGGCCCAGG - Intergenic
1123714696 15:23019189-23019211 GCAGCAGAGCACAAGGTCACTGG - Intronic
1124597377 15:31102244-31102266 GCAGGCAAGCTCCTGGTGAAGGG - Intronic
1128064047 15:64753507-64753529 CCAGGATAGCTGCTGGTTACTGG + Intronic
1129044271 15:72719603-72719625 GCAGGAGAGCTCAGGGTCACAGG + Intronic
1131354291 15:91731076-91731098 GCTGGAGAGTCCCTGGGCACAGG + Intergenic
1132586589 16:708194-708216 GCAGGGGAGCTCCAGGTGAAGGG - Intronic
1132798928 16:1741938-1741960 GTAGCGGAGCTCCTGGTCAGCGG + Intronic
1133046920 16:3093139-3093161 GCAGGACAGCCCCCGGTCTCAGG + Intronic
1135944883 16:26857098-26857120 GCAGGAGACCTCGTGGTCTCCGG + Intergenic
1142685395 17:1574664-1574686 CCAGGATGGCTCCTGGGCACTGG + Exonic
1143194051 17:5061772-5061794 GCAGGAGAGCTCCTTGAGCCCGG + Intergenic
1144731584 17:17529208-17529230 GCAGGTGTGATCCAGGTCACCGG - Intronic
1145965149 17:28911670-28911692 GCATGGGAGCCCCTGGTCCCAGG - Intronic
1146175475 17:30663632-30663654 GGAGGAGAACTCCTGCTCCCTGG - Intergenic
1146348926 17:32079678-32079700 GGAGGAGAACTCCTGCTCCCTGG - Intergenic
1147238086 17:39072275-39072297 GCAGGGGGGCTTCTGGGCACAGG - Intronic
1148044179 17:44732346-44732368 TCATGTGAGCTTCTGGTCACCGG + Intronic
1148082989 17:44977719-44977741 GCCACAGAGCTCCTGGTCCCAGG + Intergenic
1148157546 17:45432416-45432438 GCAGGGGACCTCCTGGCGACTGG - Intronic
1148699533 17:49579354-49579376 GCAGGAGACCATCTGGACACCGG + Exonic
1149096847 17:52853075-52853097 GCAGCAGAGCTCTGGGTCCCTGG - Intergenic
1149865732 17:60150089-60150111 GCAGGTGAGCTCCCGGGCTCCGG + Exonic
1150389229 17:64781107-64781129 GCAGGGGACCTCCTGGCGACGGG - Intergenic
1150790206 17:68196797-68196819 GCAGGAGACCTCCTGGCGACTGG + Intergenic
1152068026 17:78122054-78122076 GTAGGGGGGCTTCTGGTCACTGG - Intronic
1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG + Intronic
1153550761 18:6259080-6259102 GCAGGTGTGCACCTGGCCACAGG + Intronic
1155428958 18:25735660-25735682 GCATGAGAGGACTTGGTCACGGG - Intergenic
1155910607 18:31500324-31500346 GCAGTGCAGTTCCTGGTCACAGG - Intronic
1157165405 18:45354295-45354317 TCAGCAGAGCTCCTAGACACTGG + Intronic
1157711015 18:49849796-49849818 CCAGGAGAGCTGCTCTTCACAGG + Intronic
1157756046 18:50218744-50218766 ACAGGCGAGCTCCTGGAGACAGG - Intergenic
1158184861 18:54760156-54760178 GGATGAGTGCTTCTGGTCACCGG - Intronic
1158781484 18:60657262-60657284 TGAGAAGAGCACCTGGTCACAGG + Intergenic
1161016381 19:1985718-1985740 GCAGGGGAGCTCTGGGGCACAGG + Exonic
1162112169 19:8405142-8405164 CCAGAAGAGCTCCAGGTCGCTGG + Intronic
1162117801 19:8442124-8442146 GCAGGAGAGCTCATGCGCACTGG - Intronic
1162177625 19:8843007-8843029 GCAGGAGTGCTCCAGACCACTGG - Exonic
1162349245 19:10138749-10138771 GCAGGCGTGCTCCTGGTCAGAGG + Intronic
1162983491 19:14254279-14254301 GGAGGAGAACTCCTGCTCCCTGG + Intergenic
1165265165 19:34655848-34655870 GCAGGAGAGGCCAAGGTCACAGG + Intronic
1166141052 19:40805510-40805532 GCAGGTGACTTCCTGGTCTCAGG - Intronic
1167712852 19:51123107-51123129 GCAGGAGGGCTTCTGGCCCCTGG + Intergenic
1167857771 19:52256515-52256537 GCAGGAGAGATAATGGACACGGG - Intergenic
1168213632 19:54909502-54909524 CCAGTGAAGCTCCTGGTCACAGG + Exonic
925318460 2:2942515-2942537 GCAGATGAGCTCCTGGTCTCCGG + Intergenic
925893121 2:8452093-8452115 GAAGTAGAGGTCTTGGTCACGGG - Intergenic
926439203 2:12870049-12870071 CGAGGAGCGCTTCTGGTCACAGG - Intergenic
927378113 2:22442406-22442428 TCAGGAAAACTTCTGGTCACTGG - Intergenic
927930752 2:27041981-27042003 AAAGGACACCTCCTGGTCACTGG - Intergenic
933675404 2:85051878-85051900 GCAGGGGAGATCCTGCTCTCTGG + Intronic
935102867 2:100013546-100013568 CCAGGATAGCTCCTGTTCTCTGG - Intronic
935579676 2:104745907-104745929 GCAGGGCAGCTCCTGATCCCAGG + Intergenic
937121289 2:119441508-119441530 CCAGGAGAGCTCCTAGCCATTGG - Intronic
937681985 2:124654044-124654066 GCTGGATAGCTCCTGCACACTGG - Intronic
938246089 2:129779112-129779134 GCAGGGGTGCTGCTGGGCACAGG + Intergenic
939266748 2:139884337-139884359 GAAGGAGAGCACATGGACACAGG + Intergenic
943115924 2:183670317-183670339 GCAGCAGAGATCCTTGTCTCTGG - Intergenic
944581933 2:201138961-201138983 GTAGGTGAGTCCCTGGTCACTGG + Intronic
948502943 2:238408240-238408262 GATGGTGAGCTCCTCGTCACAGG + Intergenic
1169363087 20:4968162-4968184 GCAGGAGAGCTCAAGGACACTGG + Intronic
1171165431 20:22966384-22966406 GCCACAGAGCTCCTGGGCACAGG + Intergenic
1172040410 20:32040658-32040680 GCAGCAGACCTCCTGCTCAGGGG - Intergenic
1173918508 20:46726828-46726850 GCAGGAGGGCTCCTGGGCTGTGG - Intronic
1178406746 21:32330727-32330749 GCAGCAGATCTCCTAGTCAGTGG - Intronic
1179480251 21:41672324-41672346 GCGGCAGAGCTCCGGGTCACGGG + Intergenic
1179797191 21:43792049-43792071 GCAGGAGACGTCCTTGTCTCAGG - Intronic
1180624959 22:17188275-17188297 ATGGGAGAGCTCCTGGCCACAGG - Intronic
1180637578 22:17273003-17273025 GCTGGAGAGCTCCTGGCAAAGGG - Intergenic
1181887366 22:26031901-26031923 ACAGGAGGGCTCTGGGTCACTGG + Intergenic
1181942353 22:26488160-26488182 CCAAGAGAGATCTTGGTCACAGG + Exonic
1184450057 22:44577418-44577440 GGAGGTGAGCTCCCCGTCACAGG + Intergenic
1184974908 22:48054155-48054177 CCAGCAGAGCTCCTGGGCAGTGG - Intergenic
1185100616 22:48839056-48839078 GCAGGTGCACTCCTGGTCTCTGG + Intronic
950930875 3:16787825-16787847 GAATGAGAGCCCCTGGGCACTGG - Intergenic
951495368 3:23319524-23319546 GAAGGATAGCTTTTGGTCACAGG - Intronic
953413511 3:42702814-42702836 GCTGCAGAGCTGCTGGCCACAGG + Exonic
954705966 3:52480636-52480658 GCAGGTTGGCTCCTGGTTACAGG + Intronic
956118488 3:65942122-65942144 GTGGTAAAGCTCCTGGTCACAGG - Intronic
957084172 3:75664986-75665008 GCAGTACAGATCCTGGACACTGG + Intronic
961553171 3:127680494-127680516 CCAAGAGAGCTCCTGGCCCCTGG - Exonic
961722666 3:128907018-128907040 GCAGGAGAGCCCCTGGTCTCCGG - Intronic
962341924 3:134593098-134593120 AGTGGAGAGCTCCTGGTCCCTGG + Intergenic
967886816 3:194338945-194338967 GCAGGAGAACTGCTTGTCCCGGG - Intergenic
969250382 4:5964311-5964333 GCAGCAGACCTCCTGAGCACTGG + Intronic
969315867 4:6381040-6381062 ACGGGAGAGCTGCTGGCCACAGG - Exonic
969370587 4:6728739-6728761 GCAGGACAGGTCCTGGCCCCGGG - Intergenic
971936172 4:33150627-33150649 ACAATAGAGCTCCTGGTCTCAGG + Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
975821796 4:78278381-78278403 TCATGTGAGCTCCTGGTCATGGG + Intronic
978980588 4:114940563-114940585 GCATGAGTGCTTCTGGGCACCGG + Intronic
980030505 4:127823987-127824009 GATGGAGAGCTACTGGTCAAAGG - Intronic
980097277 4:128504409-128504431 GCATGAGTGCTTCTGGGCACTGG + Intergenic
980233576 4:130074894-130074916 GAAAGACTGCTCCTGGTCACAGG - Intergenic
981167691 4:141581267-141581289 CCAGCGGAGCTCCTGGGCACTGG - Intergenic
982343322 4:154328619-154328641 GCAGGACAGCTCCTGATAATTGG - Intronic
983192314 4:164767732-164767754 TGTGGAGAGCTCCTGGTCAAGGG + Intergenic
985861676 5:2476444-2476466 ACAGGTGTGCTCCTGGTCCCAGG + Intergenic
985987139 5:3525361-3525383 GCAGGAGAGCTGGTGGTGAAGGG + Intergenic
991411723 5:66352489-66352511 GCAGGAGAGCCCCAGGAAACTGG + Intergenic
994331002 5:98506462-98506484 AGAGGAGAGCTCATGGTCATTGG + Intergenic
994646868 5:102481269-102481291 GCAGGTGAGCTCCCTGTCATAGG - Intronic
995623901 5:114056210-114056232 GCCGGAGAGCTCCGGGGCGCGGG - Intergenic
998498791 5:142614230-142614252 GAAGGACAGCTCCAGGGCACAGG + Intronic
999624368 5:153504850-153504872 GCAGGAAATGTCCTGGTCACTGG - Intronic
1001103720 5:168835132-168835154 GCTGGAGAGATCCTAGCCACAGG + Intronic
1001819147 5:174696192-174696214 CCAGGAGGGCTCCTGGTCCCTGG - Intergenic
1002323122 5:178387482-178387504 CCAGGAGAGCTCATGGGCAGGGG - Intronic
1002538899 5:179893361-179893383 GAAGAAGAGCTCCTGGTCGCGGG + Exonic
1007052383 6:38845679-38845701 AAAGGAGAGCTCCTGCTCAAAGG + Exonic
1014071861 6:117191451-117191473 GCAGCAGAGCTCCTGGTTCTTGG - Intergenic
1016534377 6:145093994-145094016 ACAGAAGAGCTCCTGCTCACTGG - Intergenic
1017735726 6:157361289-157361311 GCAGCAGAGCACAGGGTCACAGG - Intergenic
1018469327 6:164082134-164082156 CCACGAGAGCTCCTGGGGACAGG - Intergenic
1019346571 7:533702-533724 GCAGAATTGCTCCTGTTCACTGG - Intergenic
1020585791 7:10064823-10064845 GCAGGGAAGCTACTGTTCACAGG + Intergenic
1023719388 7:43077513-43077535 GGAGGGGAGCTGCTGCTCACGGG + Intergenic
1024084569 7:45882772-45882794 GCAGGAGGTCTCCTGGTCCCCGG + Intergenic
1026960745 7:74405721-74405743 GGAGGTGGGCTCCTGGTGACGGG + Exonic
1031992965 7:128209822-128209844 GCAGGAGCTCCCGTGGTCACAGG - Intergenic
1034279156 7:149839522-149839544 GCAGGAGAGCTCCTTGAGAAAGG - Intronic
1035440352 7:158892002-158892024 GCAGGTGAACTCCTGGTGATGGG + Intronic
1035477029 7:159151092-159151114 ACAGGAGTGCTCCTGATCCCAGG - Intergenic
1035547333 8:493323-493345 GAAGGAGAGGGCCTGGGCACTGG - Intronic
1037200691 8:16249339-16249361 GGAGGCGAGCCCCTGGTGACCGG - Intronic
1039475753 8:37838655-37838677 GCAGGCCTGCTGCTGGTCACAGG + Intronic
1039882381 8:41632956-41632978 GGAGGAGAGCTTCTGGTGACTGG - Intergenic
1040807322 8:51408758-51408780 GCAGGAGAGCCCCTGTTTCCTGG - Exonic
1041433953 8:57817411-57817433 GCAGCAGAGCTACTGCACACTGG + Intergenic
1043473526 8:80584091-80584113 GCAGAACAGCTCCTGGGCTCCGG + Intergenic
1045966847 8:108034859-108034881 GTAGGAGTGCGACTGGTCACAGG - Intronic
1047305909 8:123652786-123652808 GCAGGGGATCTCCCGGGCACCGG + Exonic
1048441027 8:134459026-134459048 GCTGGGGAGCTCCAGCTCACAGG - Intergenic
1049272337 8:141702599-141702621 GCGGGAGAGGTCCTCATCACAGG - Intergenic
1049344634 8:142131903-142131925 TCCGGAGAGCTGCTGGGCACAGG - Intergenic
1049796216 8:144498372-144498394 CCAGGAGAGCTCATGAACACAGG + Intronic
1051279818 9:15431154-15431176 GCAGGAAAGCTGCTGGGCGCGGG - Intronic
1053065747 9:35067760-35067782 GCAGGAAGCCTCCTGGTCATGGG - Intronic
1053394643 9:37762076-37762098 GAGGGAGAGATCCTGGCCACAGG + Exonic
1056788686 9:89611226-89611248 GCAGGAAGGCTCCTGGTCAGAGG + Intergenic
1057303999 9:93902116-93902138 ACAAGAGAGCTCCTGGGCCCAGG + Intergenic
1057600307 9:96451043-96451065 GGAGGAGGGCGCCTGGTCCCGGG + Intronic
1059705832 9:116822470-116822492 ACAAGAGGGCACCTGGTCACAGG + Intronic
1186461681 X:9753262-9753284 GCAGGAGAGTTCCTGGAACCTGG + Intronic
1190030402 X:46966951-46966973 GATAGTGAGCTCCTGGTCACTGG + Intronic
1190501443 X:51082602-51082624 GCAGCAGAGCCACTGATCACTGG + Intergenic
1192309887 X:70002091-70002113 GCATGAGAGTTCCCGGTAACAGG + Intronic
1199746328 X:150774064-150774086 GCAGGGGAGGTCCTGGTGGCTGG - Intronic
1199988987 X:152973753-152973775 GGAACTGAGCTCCTGGTCACTGG - Intergenic