ID: 919769480

View in Genome Browser
Species Human (GRCh38)
Location 1:201148098-201148120
Sequence AGTGGGTCTACTCTTCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919769480_919769486 8 Left 919769480 1:201148098-201148120 CCCAAAGGAAGAGTAGACCCACT 0: 1
1: 0
2: 0
3: 7
4: 123
Right 919769486 1:201148129-201148151 ACAGCACTCTTGCGTAAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 60
919769480_919769484 4 Left 919769480 1:201148098-201148120 CCCAAAGGAAGAGTAGACCCACT 0: 1
1: 0
2: 0
3: 7
4: 123
Right 919769484 1:201148125-201148147 TCTAACAGCACTCTTGCGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 45
919769480_919769485 7 Left 919769480 1:201148098-201148120 CCCAAAGGAAGAGTAGACCCACT 0: 1
1: 0
2: 0
3: 7
4: 123
Right 919769485 1:201148128-201148150 AACAGCACTCTTGCGTAAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 43
919769480_919769487 22 Left 919769480 1:201148098-201148120 CCCAAAGGAAGAGTAGACCCACT 0: 1
1: 0
2: 0
3: 7
4: 123
Right 919769487 1:201148143-201148165 TAAGGTGGGATAAAGATCATAGG 0: 1
1: 0
2: 1
3: 6
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919769480 Original CRISPR AGTGGGTCTACTCTTCCTTT GGG (reversed) Intronic