ID: 919769481

View in Genome Browser
Species Human (GRCh38)
Location 1:201148099-201148121
Sequence AAGTGGGTCTACTCTTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919769481_919769484 3 Left 919769481 1:201148099-201148121 CCAAAGGAAGAGTAGACCCACTT 0: 1
1: 0
2: 1
3: 9
4: 122
Right 919769484 1:201148125-201148147 TCTAACAGCACTCTTGCGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 45
919769481_919769485 6 Left 919769481 1:201148099-201148121 CCAAAGGAAGAGTAGACCCACTT 0: 1
1: 0
2: 1
3: 9
4: 122
Right 919769485 1:201148128-201148150 AACAGCACTCTTGCGTAAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 43
919769481_919769486 7 Left 919769481 1:201148099-201148121 CCAAAGGAAGAGTAGACCCACTT 0: 1
1: 0
2: 1
3: 9
4: 122
Right 919769486 1:201148129-201148151 ACAGCACTCTTGCGTAAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 60
919769481_919769487 21 Left 919769481 1:201148099-201148121 CCAAAGGAAGAGTAGACCCACTT 0: 1
1: 0
2: 1
3: 9
4: 122
Right 919769487 1:201148143-201148165 TAAGGTGGGATAAAGATCATAGG 0: 1
1: 0
2: 1
3: 6
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919769481 Original CRISPR AAGTGGGTCTACTCTTCCTT TGG (reversed) Intronic