ID: 919769482

View in Genome Browser
Species Human (GRCh38)
Location 1:201148115-201148137
Sequence GAGTGCTGTTAGATGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919769482_919769487 5 Left 919769482 1:201148115-201148137 CCCACTTTCATCTAACAGCACTC 0: 1
1: 0
2: 2
3: 13
4: 131
Right 919769487 1:201148143-201148165 TAAGGTGGGATAAAGATCATAGG 0: 1
1: 0
2: 1
3: 6
4: 125
919769482_919769489 25 Left 919769482 1:201148115-201148137 CCCACTTTCATCTAACAGCACTC 0: 1
1: 0
2: 2
3: 13
4: 131
Right 919769489 1:201148163-201148185 AGGTTCCACATCTAAAAACAGGG 0: 1
1: 1
2: 1
3: 43
4: 443
919769482_919769488 24 Left 919769482 1:201148115-201148137 CCCACTTTCATCTAACAGCACTC 0: 1
1: 0
2: 2
3: 13
4: 131
Right 919769488 1:201148162-201148184 TAGGTTCCACATCTAAAAACAGG No data
919769482_919769486 -9 Left 919769482 1:201148115-201148137 CCCACTTTCATCTAACAGCACTC 0: 1
1: 0
2: 2
3: 13
4: 131
Right 919769486 1:201148129-201148151 ACAGCACTCTTGCGTAAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 60
919769482_919769485 -10 Left 919769482 1:201148115-201148137 CCCACTTTCATCTAACAGCACTC 0: 1
1: 0
2: 2
3: 13
4: 131
Right 919769485 1:201148128-201148150 AACAGCACTCTTGCGTAAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919769482 Original CRISPR GAGTGCTGTTAGATGAAAGT GGG (reversed) Intronic