ID: 919769485

View in Genome Browser
Species Human (GRCh38)
Location 1:201148128-201148150
Sequence AACAGCACTCTTGCGTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919769481_919769485 6 Left 919769481 1:201148099-201148121 CCAAAGGAAGAGTAGACCCACTT 0: 1
1: 0
2: 1
3: 9
4: 122
Right 919769485 1:201148128-201148150 AACAGCACTCTTGCGTAAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 43
919769480_919769485 7 Left 919769480 1:201148098-201148120 CCCAAAGGAAGAGTAGACCCACT 0: 1
1: 0
2: 0
3: 7
4: 123
Right 919769485 1:201148128-201148150 AACAGCACTCTTGCGTAAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 43
919769482_919769485 -10 Left 919769482 1:201148115-201148137 CCCACTTTCATCTAACAGCACTC 0: 1
1: 0
2: 2
3: 13
4: 131
Right 919769485 1:201148128-201148150 AACAGCACTCTTGCGTAAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919769485 Original CRISPR AACAGCACTCTTGCGTAAGG TGG Intronic