ID: 919771986

View in Genome Browser
Species Human (GRCh38)
Location 1:201167513-201167535
Sequence CGTTATCTGCAGGAGTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 2, 2: 20, 3: 91, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919771983_919771986 12 Left 919771983 1:201167478-201167500 CCTGAAAAAGCTGTTCTTGGGTT 0: 1
1: 0
2: 0
3: 20
4: 174
Right 919771986 1:201167513-201167535 CGTTATCTGCAGGAGTCACTGGG 0: 1
1: 2
2: 20
3: 91
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919771986 Original CRISPR CGTTATCTGCAGGAGTCACT GGG Intronic
900662743 1:3793611-3793633 TGTTATCTGCAGGAGTCACTGGG - Intronic
901784026 1:11612713-11612735 CTTTATCAGCAGGTGTTACTGGG - Intergenic
901791521 1:11655683-11655705 CCTTACCTCCAGGGGTCACTGGG - Exonic
902540270 1:17149461-17149483 CGTGACCTGCAGGAGGGACTGGG + Intergenic
903699125 1:25233098-25233120 CGTTATCTACAGGAATAATTGGG - Intergenic
905409314 1:37757322-37757344 TGTTAGCTGCAGAAGGCACTTGG + Intronic
906853533 1:49280000-49280022 TGTTATCTGCAGGAGTAATTGGG - Intronic
907789856 1:57652148-57652170 TGTTATCTGCAGGAGTAACTGGG - Intronic
909131087 1:71738347-71738369 CTTTATTTGCAGTTGTCACTGGG - Intronic
910195595 1:84636630-84636652 TGTTATCTGCAGGAGTAATTGGG + Intergenic
910461729 1:87454724-87454746 TGTTATCTGCAGGAGTAATTGGG - Intergenic
911851074 1:102821972-102821994 CCTTATCTGGAGGACTGACTAGG + Intergenic
913220423 1:116655634-116655656 TTCTATCTGGAGGAGTCACTTGG + Intronic
914318946 1:146541019-146541041 TGTTATCTGCAGGAACAACTGGG - Intergenic
914495411 1:148192338-148192360 TGTTATCTGCAGGAACAACTGGG + Intergenic
915641532 1:157230887-157230909 TGTTATTTGCAGGAGTAATTGGG + Intergenic
916231267 1:162543744-162543766 AGTTATTTACAGGAGTGACTGGG + Intergenic
916272883 1:162962940-162962962 TATTATCTGCAGGAGTAATTGGG - Intergenic
916810866 1:168304481-168304503 TGTTATCTGCAGGAGTAATTGGG + Intronic
917314789 1:173713557-173713579 TGTTATCTGTAGGAGTAATTGGG - Intergenic
917412086 1:174769421-174769443 TGTTATCTACAGGAGTAATTGGG + Intronic
918689986 1:187467762-187467784 TGTTATCTGCAGGAATAATTGGG + Intergenic
918991037 1:191697102-191697124 TGTTATCTGCAGGAGTAATTGGG + Intergenic
919771986 1:201167513-201167535 CGTTATCTGCAGGAGTCACTGGG + Intronic
920772961 1:208906934-208906956 TGTTATTTACAGGAGTAACTGGG + Intergenic
921153338 1:212418824-212418846 CGTTATCTGCAGGAGTAATTGGG + Intergenic
921899203 1:220432504-220432526 CATGATCTGCAGGAGAAACTGGG + Intergenic
922556858 1:226539164-226539186 CCTTATCTGCAGGACTTGCTTGG + Intergenic
922912994 1:229233167-229233189 TGTTATCCTCAGGAGTAACTGGG - Intergenic
923032393 1:230259810-230259832 TGTTATCTGCAGGAGTAATTGGG + Intronic
923110245 1:230884512-230884534 TGTTATCTATAGGAGTAACTGGG - Intergenic
923596800 1:235366670-235366692 TGTTATCTGCAGGAATGATTGGG + Intergenic
923779414 1:237008955-237008977 CGTTATCTCCAGGAGTAATTGGG - Intergenic
923876442 1:238054214-238054236 TGTTATCTACAGGAGCAACTGGG - Intergenic
923908167 1:238409189-238409211 CGTTATCTACAGGAGTAACTGGG - Intergenic
1063897809 10:10700659-10700681 CAATTTCTACAGGAGTCACTAGG - Intergenic
1066137112 10:32459777-32459799 CATTTTCTTCAGGACTCACTTGG - Intronic
1066249128 10:33615984-33616006 TGTTATCTGCAGGAGAAATTGGG - Intergenic
1067196786 10:44126713-44126735 AGCTCTCTGCAGGAGTCACTAGG + Intergenic
1067787882 10:49264139-49264161 CGCTGTCTGCAGTTGTCACTGGG - Intergenic
1067822566 10:49542493-49542515 TGTTATTTGCAGGAGTAATTGGG + Intergenic
1068446709 10:57134608-57134630 TGTTATCTGCAGGTGTGACTGGG - Intergenic
1069806477 10:71128381-71128403 TGTTATCTGCAGGAGTAACTGGG - Intergenic
1070034464 10:72708493-72708515 AGTTGCCTGCAGGAGTCAATAGG + Intronic
1070420192 10:76228721-76228743 TGTTATTTGCAGGAGTAATTGGG + Intronic
1070899557 10:80016258-80016280 TGTTATCTGGAGGAGTAATTGGG - Intergenic
1071829206 10:89355102-89355124 TGTTATTTGCAGGAGTAATTGGG + Intronic
1072279598 10:93853833-93853855 TGTTATTTGCAGGAGTAATTGGG - Intergenic
1072419178 10:95275052-95275074 TGTTATTTACAGGAGTAACTGGG - Intronic
1072531559 10:96324130-96324152 CGTTATATTCAGGAGAAACTAGG + Intronic
1073500904 10:103936198-103936220 AGGCATCTGCAGGAGACACTGGG - Intergenic
1075243551 10:120799898-120799920 TGTTATCTGCAGGAGTAATTGGG - Intergenic
1075447539 10:122524185-122524207 TGTTGTCTGCAGGAGTAACTGGG + Intergenic
1075491759 10:122877526-122877548 TGTTATCTGCAGGAATAATTGGG + Intronic
1076462795 10:130657791-130657813 CGTTCACTGCAGGAGCCACGGGG - Intergenic
1079657631 11:23002384-23002406 TGTTATCTGCAGGAATAATTGGG - Intergenic
1080358291 11:31478562-31478584 CTTTAAATGCAGGAGTCACAGGG + Intronic
1080555813 11:33416193-33416215 CGTTATCTTCAGGAGTCCTGTGG - Intergenic
1081530532 11:43955726-43955748 CATTATCTGCAGGAGTAATTGGG + Intergenic
1082685690 11:56236470-56236492 TGTTATCTGCAGGAATAATTGGG - Intergenic
1083539192 11:63500333-63500355 TATTATCTGCAGGAGTAATTGGG - Intergenic
1085622107 11:78045394-78045416 TGTTATCTGCAGGAGTAATTGGG + Intronic
1085682894 11:78594840-78594862 CGTTATCTGCAGGAGCAACTGGG - Intergenic
1085683924 11:78604373-78604395 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1086024693 11:82276458-82276480 TGTTATATGCAGCACTCACTGGG + Intergenic
1086407570 11:86511780-86511802 TGTTATCTACAGGAGCAACTAGG - Intronic
1086737165 11:90320976-90320998 TATTATCTGCAGGAGTAATTGGG - Intergenic
1086881973 11:92160087-92160109 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1086970178 11:93073023-93073045 TGTTCTCTGCAGGAGTAACTGGG - Intergenic
1088051422 11:105519719-105519741 TGTTATCTCCTGGAGTCACTAGG - Intergenic
1089084925 11:115808875-115808897 TGTTATCTGCAGGAGTAGATGGG + Intergenic
1090017916 11:123102213-123102235 TGTTATTTGCAGGAATAACTAGG - Intronic
1090095222 11:123736125-123736147 CCTTATCTGAAGGTGTCACGTGG + Intronic
1090884745 11:130865854-130865876 AGTCATCTGCCGGGGTCACTTGG - Intergenic
1091649746 12:2301145-2301167 CACTATCTGCAGGAGGCGCTTGG + Intronic
1092450188 12:8594422-8594444 CCTTACCTGGAGCAGTCACTCGG + Intergenic
1095306964 12:40650382-40650404 TGTTATTTGCAGGAGTAATTAGG + Intergenic
1098921421 12:76305651-76305673 AGTTATTTACAGGAGTAACTGGG - Intergenic
1100276976 12:93080469-93080491 TGTTATCTGCAGGAATCACTGGG + Intergenic
1100367466 12:93934970-93934992 TGTTATCTGCAGGAGTAATTGGG - Intergenic
1103305078 12:119957657-119957679 GGTTATCTGCAGGAGTCATTGGG + Intergenic
1104237492 12:126953156-126953178 TGTTATCTCCAAGAGTAACTGGG + Intergenic
1104320163 12:127743169-127743191 TATTATCTGCAGGAGTAACTGGG + Intergenic
1104436381 12:128760232-128760254 TGTTGTCTGGAGCAGTCACTGGG - Intergenic
1104800538 12:131552548-131552570 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1105043828 12:132985553-132985575 TGTTATCTGTAGGAGTAACTGGG + Intergenic
1106351617 13:28936415-28936437 CCTTATCTCTAGGAGTCTCTAGG + Intronic
1106439577 13:29754130-29754152 TGTTATCTTCAAGAGTAACTGGG + Intergenic
1106576782 13:30982176-30982198 TGTTATCTGCAGGAGTAACGGGG - Intergenic
1107155715 13:37165041-37165063 TGTTATTTGCAGGAGTAATTGGG + Intergenic
1107288554 13:38824773-38824795 TGTTATTTGCAGGAGTAACTGGG + Intronic
1107684076 13:42879305-42879327 TGTTGTCTGCAGGAGTAATTGGG + Intergenic
1107836764 13:44417962-44417984 TGTTCCCTGCAGGAGTCACCTGG + Intergenic
1107949064 13:45445674-45445696 TGTTATCTGCAGGAGGCATTGGG + Intergenic
1113076087 13:106469326-106469348 GTGTGTCTGCAGGAGTCACTGGG - Intergenic
1113925049 13:113936886-113936908 CGTTATCTGCGGGAGTAGTTGGG + Intergenic
1116201614 14:41804439-41804461 TATTACCTGCAGGAGTAACTGGG + Intronic
1117181737 14:53198754-53198776 TGTTATCTGCAGGAGTAATTAGG + Intergenic
1117445551 14:55800689-55800711 TGTTATCTGCAAGAGTAATTGGG - Intergenic
1117822763 14:59668142-59668164 CTTTTTCTGTAGGATTCACTTGG - Intronic
1118088483 14:62445852-62445874 TGTTATCTGCAGGAGTGATTGGG - Intergenic
1118474135 14:66101387-66101409 TGTTATCTGCAGGAGTAACTGGG - Intergenic
1121042614 14:90761275-90761297 TGTTATCTGCAGGAGTAATTCGG - Intronic
1202913611 14_GL000194v1_random:142499-142521 CGTAATGTGCAGGTGCCACTTGG - Intergenic
1123889665 15:24764137-24764159 TGTTATTTGCAGGAGTAATTGGG - Intergenic
1124061099 15:26294279-26294301 CGCTGCCTGCAGGAGTCAGTAGG - Intergenic
1124230772 15:27944506-27944528 TGTTATCTGCAGGAGTAACTGGG - Intronic
1124335929 15:28857053-28857075 TGTTATCTACAGGAGGCACTGGG + Intergenic
1125052806 15:35321020-35321042 TGTTATCTACAGGAGCAACTGGG + Intronic
1125630346 15:41142129-41142151 TGTTATCTGCAAGAGTAATTGGG - Intergenic
1127506377 15:59601765-59601787 TGTTATCTGCAGGAGTAACTGGG + Intronic
1127585655 15:60375549-60375571 CTTAATCTGTAGGAGTCTCTTGG - Intronic
1128317949 15:66672918-66672940 AGTTGTCTAGAGGAGTCACTGGG + Intronic
1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG + Intronic
1131007534 15:88990649-88990671 TGTTATCTGCAGGAATAACTGGG + Intergenic
1131194676 15:90346098-90346120 AGTTATCTGTAGGATTGACTGGG - Intergenic
1131329487 15:91483872-91483894 AGTCATGTGGAGGAGTCACTAGG + Intergenic
1133738552 16:8633777-8633799 CCTTCTCTGCATGAGGCACTGGG - Intronic
1134595393 16:15491821-15491843 CGCTATCTGGAGGAGTCCCCGGG + Intronic
1134605733 16:15569779-15569801 TGTTATCTGCAGGAGTAATTGGG + Intronic
1134872550 16:17665203-17665225 TCTTATCTGCAGGAGTAACTAGG - Intergenic
1135972417 16:27082343-27082365 CGTTTTCTGCAGGAATAATTGGG - Intergenic
1137546866 16:49410816-49410838 CCTTCTCTGGAGGAGTCACAGGG + Intergenic
1138299769 16:55916228-55916250 TGTTATCTGCAGGAGTAATTGGG + Intronic
1138993883 16:62424900-62424922 TGTTATCTGCAGGAATAACTGGG - Intergenic
1139014899 16:62677995-62678017 TGATATCTGCAGGAGTAATTAGG - Intergenic
1139066685 16:63324374-63324396 TGTTATCTACAGGAGCAACTGGG - Intergenic
1140847884 16:78907342-78907364 TGTTATCTGCAGGAATAATTGGG + Intronic
1142556457 17:781621-781643 TGTTATTTGCAGGATTCAGTTGG - Intronic
1143287558 17:5801507-5801529 CCTAACCTGCAGGGGTCACTAGG - Intronic
1144364176 17:14526124-14526146 TGTTATCTGCAGGAGTAATAGGG - Intergenic
1145024313 17:19456307-19456329 TGTTATCTGCAGGAGTAAGTGGG + Intergenic
1146602718 17:34232732-34232754 TGTTATCTGCAGGAGTTACTGGG - Intergenic
1146663379 17:34680304-34680326 TGTTATCTGCAGGAGTAAATGGG - Intergenic
1146823613 17:36004245-36004267 TGTTATCTGCAGGAGAAATTGGG + Intergenic
1148627283 17:49079318-49079340 GGTTATCTGCAAGAGTAATTGGG - Intergenic
1150853926 17:68732548-68732570 TGTTATCTGCAGGAATAATTGGG - Intergenic
1151741280 17:75983929-75983951 TGTTATCTGCAGGAGTAACTGGG + Intronic
1152871283 17:82754450-82754472 CATGGTCTGCAGGAGTAACTGGG + Intronic
1153868304 18:9293502-9293524 TGTTATCTGCAGGAGTAATTAGG - Intergenic
1154155485 18:11941014-11941036 TGTTATTTGGAGGAGTAACTGGG + Intergenic
1154205872 18:12336253-12336275 TGTTATCTGTAGGAGTAATTGGG - Intronic
1155143982 18:23068527-23068549 TGTTACCTGCAGGAGTAATTGGG - Intergenic
1156787954 18:40938338-40938360 CATTTTCTACAGGAGACACTTGG + Intergenic
1157038326 18:44005285-44005307 TGTTATCTGCAGGAGCAAATTGG + Intergenic
1157305246 18:46512184-46512206 TGTTATCTGCAGGGGTAATTGGG - Intronic
1157368156 18:47085489-47085511 TGTTATCTCCAGGAGTAACTGGG - Intronic
1159707347 18:71707763-71707785 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1159938053 18:74384353-74384375 TGTTATCCACAGGAGTAACTGGG - Intergenic
1161110536 19:2467195-2467217 TGTTATTTGCAGGAGTAATTGGG - Intergenic
1162035001 19:7933914-7933936 CGTTCTCTTCCGGAGTCGCTGGG + Exonic
1162294510 19:9803823-9803845 TGTTATTTGCAGGAGTAATTGGG + Intergenic
1164505821 19:28860403-28860425 TGTTATCTACAGGAGCAACTGGG + Intergenic
1164523034 19:28993219-28993241 TGTTACCTGCAGGAGTAATTGGG - Intergenic
1165187650 19:34035828-34035850 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1165249864 19:34521263-34521285 TGGTATCTGCAGGAGTAATTGGG + Intergenic
1165257262 19:34585856-34585878 TGGTATCTGCAGAAGTAACTGGG + Intergenic
1167419244 19:49393573-49393595 CCTCAACTGCAGGAGCCACTGGG - Intronic
1167533295 19:50032384-50032406 CATGATCTGCAGGTGTGACTGGG + Intronic
1167580696 19:50340458-50340480 TGTAATCTGCAGGAGTAATTGGG - Intronic
1167987107 19:53327927-53327949 CGTTGTCTTCAGGAGTCCCCTGG - Intergenic
1168613632 19:57820482-57820504 TGTTATCTTCAGGAGCAACTTGG + Intronic
1168617623 19:57851185-57851207 GGTTATCTTCAGGAGCAACTTGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925912891 2:8584509-8584531 CTTTATCTGCAGGACCCGCTGGG + Intergenic
927194373 2:20537615-20537637 CATTATTTGCAGGAGTAATTAGG + Intergenic
928671468 2:33607487-33607509 TGTTATTTGCAGGAGTAATTGGG + Intergenic
929444153 2:41989699-41989721 CCTGATCTGCAGGAGTCATCAGG + Intergenic
929550757 2:42889964-42889986 TGTTATCTGCAGGAGTAATTGGG + Intergenic
930113224 2:47696713-47696735 TGTTATCTGCAGGAGTAACTGGG - Intronic
930164114 2:48187021-48187043 TGTTATCTGCAAGAGTAATTGGG - Intergenic
930981726 2:57534097-57534119 TGTTATCTGTAGGAGTAATTGGG - Intergenic
932079080 2:68695015-68695037 TGTTATCTGCAGGAGTAATTAGG - Intronic
932157916 2:69435024-69435046 TGTTTTCTGCAGGAGTAATTGGG + Intronic
932330854 2:70897587-70897609 CGCTTTGTGCAGGAGCCACTAGG - Intergenic
932466449 2:71927227-71927249 CTTTATCTCCAGGAGTCATGTGG + Intergenic
933179159 2:79210710-79210732 AGGTATCTGGAGGAGTAACTTGG - Intronic
933198316 2:79418209-79418231 TGTTATCTGCAGGAATCACTGGG + Intronic
933374023 2:81455898-81455920 AGGGATCTGCAGAAGTCACTGGG - Intergenic
934939843 2:98492752-98492774 CGATATCTGAGGGACTCACTGGG + Intronic
935156194 2:100485636-100485658 CGTTATCTGTAGGAGCAATTGGG + Intergenic
937579388 2:123465266-123465288 TGTTATCTGCAGGGGTAACTGGG - Intergenic
938608019 2:132916300-132916322 CGTTAGCTGGATGAGTAACTGGG + Intronic
940110414 2:150146629-150146651 TGTTATCTGCAGGAGTAATTGGG + Intergenic
940509393 2:154593405-154593427 TATTATCTGCAGGAGTAATTAGG - Intergenic
941717784 2:168781779-168781801 TGTTATCTGCAAGAGTAATTGGG + Intergenic
941852403 2:170196949-170196971 TGTTATCTGCAGGAGTAATTGGG - Intronic
942223721 2:173796429-173796451 CGTTATCTCCAGGAGCAATTTGG - Intergenic
942639086 2:178041558-178041580 CCTTATTTGCAGAAGTCACGTGG - Intronic
942990571 2:182196388-182196410 GGTAATCTTCAGGAGTCTCTGGG + Intronic
943345829 2:186735422-186735444 TGTTATTTGCAGGAGTAATTGGG + Intronic
943367465 2:186979897-186979919 CGTGGTCTACTGGAGTCACTGGG - Intergenic
944054349 2:195507769-195507791 CGTTATCTTCAAGAGTAATTGGG + Intergenic
945332640 2:208557570-208557592 TGTTATCTGCAGGAGTAATTGGG + Intronic
945770827 2:214040113-214040135 TGTTATCTGCAGGAGTAATAGGG + Intronic
946442798 2:219711072-219711094 CCTTATGAGAAGGAGTCACTGGG - Intergenic
946471706 2:219966734-219966756 TGTTATCTTCAGGAGTAATTGGG - Intergenic
947032746 2:225816703-225816725 TATTATCTGCAGGAGTAATTGGG - Intergenic
948011987 2:234656324-234656346 CGTTATTTGCAGCAGTAAGTGGG - Intergenic
948032270 2:234828585-234828607 CGTTATCTACAGGAGCAACTAGG + Intergenic
948309463 2:236974260-236974282 TGTTATCTGCAAGAGTAATTGGG - Intergenic
948565184 2:238881796-238881818 TGTTATCCGGAGGAGCCACTTGG + Intronic
1168821643 20:777327-777349 TGTTATTTGCAGGAGTAATTGGG + Intergenic
1169651929 20:7878448-7878470 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1169781874 20:9318484-9318506 TGTTATTTGCAGAAGTAACTGGG + Intronic
1170220457 20:13936445-13936467 CGTTATTTACAGGAGTCATTGGG - Intronic
1170936076 20:20810885-20810907 TGTTATCTGCAGGAATAATTGGG + Intergenic
1173584616 20:44173223-44173245 TGTTATCTATAGGAGTCGCTGGG - Intronic
1174103004 20:48141501-48141523 TGTTATCTGCAGGAGTAATTGGG - Intergenic
1174105175 20:48156807-48156829 TGTTATCTGCAGGAGTCACTGGG + Intergenic
1174536654 20:51256478-51256500 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1174940187 20:54918451-54918473 TGTTATCTGCAGGAGTAATTAGG + Intergenic
1175299994 20:57935968-57935990 TGTTATTTGCAGGAGTAATTGGG - Intergenic
1176632966 21:9157174-9157196 CGTAATGTGCAGGTGCCACTTGG - Intergenic
1177549399 21:22600395-22600417 TGTCATCTGCAGGAGTAATTAGG + Intergenic
1178970247 21:37168867-37168889 GGTCATCTGCGGGAGTAACTGGG + Intronic
1179795538 21:43780762-43780784 CATTAACTGCAGGACTAACTGGG - Intergenic
1179892110 21:44340889-44340911 TGTTACCTGCAGGAGTAATTGGG - Intergenic
1180821950 22:18835888-18835910 TTCTATCTGGAGGAGTCACTTGG + Intergenic
1181191025 22:21140159-21140181 TTCTATCTGGAGGAGTCACTTGG - Intergenic
1181208175 22:21270339-21270361 TTCTATCTGGAGGAGTCACTTGG + Intergenic
1184154235 22:42656708-42656730 TGTTATCTGCAGAAATAACTGGG + Intergenic
1203218750 22_KI270731v1_random:25063-25085 TTCTATCTGGAGGAGTCACTTGG - Intergenic
1203272077 22_KI270734v1_random:61763-61785 TTCTATCTGGAGGAGTCACTTGG + Intergenic
950500522 3:13360632-13360654 CGTCATCTGCAGCACTCACAGGG + Intronic
951643998 3:24867085-24867107 TGTTATCTGTAGGAGTAATTGGG + Intergenic
952648145 3:35687547-35687569 CTTAATCTTCAGGAGTCAATGGG - Intronic
953010318 3:39019160-39019182 TGTTATCTGCAGGAATAATTGGG - Intergenic
953500041 3:43424462-43424484 TGTTATCTGCAGGAGTAACTGGG - Intronic
958628389 3:96656386-96656408 TGTTATCTACAGGAGTAACTGGG - Intergenic
961326239 3:126111060-126111082 CTTTATCTCCAGTAGTCCCTGGG + Intronic
961942741 3:130655068-130655090 TGTTATCTGTAGGAGTAAATTGG + Intronic
962749098 3:138419993-138420015 TGTTATCTGCAGGAGTAACTGGG - Intergenic
964414623 3:156434201-156434223 ATTTAACTCCAGGAGTCACTTGG + Intronic
965639426 3:170816935-170816957 CTTTATCTGAAGGAGTGTCTTGG - Intronic
966162500 3:176983174-176983196 TGTTATCTGCAGGAGTAATTGGG + Intergenic
966973615 3:185066883-185066905 TGTTACCTGCAGGAGTAACTGGG + Intergenic
966993209 3:185254827-185254849 TGTTACCTGCAGGAGTAAATGGG - Intronic
967243635 3:187465543-187465565 TGTTATTTGCAGGAGTAATTGGG + Intergenic
967282654 3:187837035-187837057 AGTTCTCAGCAGGAGTCAGTGGG + Intergenic
968124146 3:196146045-196146067 TGTTATTTACAGGAGTCATTGGG + Intergenic
969922364 4:10552426-10552448 TGTTATCTGCAGGAATAACTGGG - Intronic
970877235 4:20885299-20885321 TGTTATCTGCAGGAGTAATTGGG - Intronic
971615700 4:28788433-28788455 TGTTATCTGCAGGAGTAATTGGG - Intergenic
973245073 4:48002761-48002783 TGTTATTTGCAGGAGTAATTGGG + Intronic
973606765 4:52595104-52595126 TGTCATCTGCAGGAGTGAGTAGG - Exonic
975865572 4:78720416-78720438 TGTGATCTGCAGGAGTAATTGGG + Intergenic
977679883 4:99786768-99786790 TGTTATCTACAGGAGTAATTGGG - Intergenic
978339727 4:107709581-107709603 TGTCATCTGCAGGAGTAACTGGG - Intronic
979807180 4:124988616-124988638 TGTTATTTGTAGGAGTAACTGGG + Intergenic
980753879 4:137130564-137130586 TGAAATCTGCAGGACTCACTTGG + Intergenic
982551118 4:156801044-156801066 TGCTATCTGCAAGAGTAACTGGG - Intronic
983406241 4:167334901-167334923 CGTTGTCTGCAGGAGTAATGGGG - Intergenic
985359907 4:189162497-189162519 TGTTATTTGCAGGAGTAACTGGG + Intergenic
985361284 4:189178452-189178474 TGGTATCTGCAGGAGTAATTGGG + Intergenic
985718586 5:1476609-1476631 CCTGAGCTGCAGGAGCCACTTGG - Intronic
986650804 5:9961687-9961709 CGTTATATGCAAGAGTAATTGGG - Intergenic
987456575 5:18154638-18154660 TGTTATCTACAGGAGTAATTGGG + Intergenic
988250021 5:28745265-28745287 CTTTATCTGTAGTATTCACTTGG - Intergenic
988285633 5:29212693-29212715 TGTTATTTACAGGAGTAACTGGG + Intergenic
988372387 5:30388274-30388296 TATTATTTGCAGGAGTAACTGGG - Intergenic
988849066 5:35160617-35160639 TGTTATCTGCAGGAGTAATTGGG - Intronic
988879529 5:35486120-35486142 TGTTATCTGCAGGAGTAATCAGG - Intergenic
989608423 5:43268610-43268632 TGTTATCTGCATGAGTAATTGGG + Intronic
990307319 5:54506012-54506034 TGTTATCTGCAGGAGTAATTGGG + Intergenic
990634503 5:57709563-57709585 TGTTAACTGCAGGAGTAATTGGG + Intergenic
990915958 5:60906085-60906107 TGTTATATGCAGGAGTAATTGGG + Intronic
991492180 5:67194340-67194362 TGTTATCTACAGGAGTAATTGGG - Intronic
991675954 5:69090144-69090166 TGTTATCTGCAGGAGTAATTAGG + Intergenic
991997319 5:72400796-72400818 TGTTATCTGCAGGAATAACTGGG - Intergenic
993039030 5:82791072-82791094 TATTATCTACAGGAGTAACTGGG - Intergenic
993344466 5:86765363-86765385 CATTATCTGCAGGAGTATGTGGG + Intergenic
993466355 5:88251298-88251320 TGTTATCTGTAGGAGTAACTGGG + Intronic
994784157 5:104134207-104134229 TGTTATTTACAGGAGTAACTGGG - Intergenic
996404475 5:123091658-123091680 TGTTATCTCCAGAAGTCTCTGGG - Intronic
997695821 5:135859879-135859901 TGTTATCGGCAGGAGTAATTGGG + Intronic
998628359 5:143871296-143871318 TGTTATCTACAGGAGTAATTAGG - Intergenic
998699706 5:144684037-144684059 TTTTATCTGCAGGAATAACTGGG + Intergenic
999896781 5:156042788-156042810 TGTTATCTGCTGGAGTAATTGGG + Intronic
1000089931 5:157921431-157921453 TGTTATTTGCAGGAGTAATTGGG + Intergenic
1000233625 5:159337619-159337641 TGTTATCTGCTGGAGTAATTGGG - Intergenic
1000718642 5:164678903-164678925 TGTTACCTGCAGGAGTAATTGGG + Intergenic
1001922601 5:175612047-175612069 TGTTATTTGCAGGAGTGCCTGGG + Intergenic
1002578852 5:180195047-180195069 TGTTCTCTGCAGCAGGCACTGGG - Intronic
1003054558 6:2806515-2806537 TGTTATCTTCAGGAGTCATTGGG - Intergenic
1004468225 6:15905436-15905458 CGTTACCTGCAGGGGTAATTGGG + Intergenic
1004474537 6:15959125-15959147 TGTTATCTGCAGGAGTAATATGG + Intergenic
1005652182 6:27894582-27894604 CGTTATCTGCAGGAGTGCATCGG + Intergenic
1005709035 6:28485752-28485774 TGTTATCTGCAAGAGTAATTGGG + Intergenic
1007210080 6:40186406-40186428 TGTTATCTACAGGAGTAATTGGG + Intergenic
1007392977 6:41561161-41561183 CGGCATCTGCAGGAGCCTCTAGG + Intronic
1008138129 6:47800514-47800536 TGTTATTTGCAGGAGTAATTGGG + Intronic
1008549463 6:52613874-52613896 CGTGCTCTGTAGTAGTCACTAGG - Intergenic
1008888918 6:56462801-56462823 GGTAGTCTGCAGGAGTGACTGGG + Intronic
1008909467 6:56717575-56717597 TGCTATCTGCAGGAGTAATTGGG - Intronic
1011219302 6:85036979-85037001 CTTTATTTACAGGAATCACTAGG - Intergenic
1011256922 6:85432001-85432023 TGTTATCTGCAAGAGTAATTGGG - Intergenic
1013795494 6:113883569-113883591 CGATAGCTGAAGGAGACACTGGG + Intergenic
1014421982 6:121257647-121257669 GGTTACCTGCTGAAGTCACTAGG - Intronic
1015277616 6:131400586-131400608 TGTTATCTGCAGGAGCAATTGGG - Intergenic
1016704266 6:147088721-147088743 TGTTATCTGCAGGAGTAATTGGG - Intergenic
1016733250 6:147448897-147448919 TGGTATTTGCAGGAGTAACTGGG - Intergenic
1017347867 6:153405615-153405637 TGTTGTCTGCAGGAATAACTGGG + Intergenic
1018345983 6:162899701-162899723 CCTGAGCTACAGGAGTCACTTGG + Intronic
1020057180 7:5125911-5125933 CGTTTTCTGCAGCAGAAACTTGG + Intergenic
1020145386 7:5638391-5638413 GGTTATCCGCAGGAGACAGTTGG - Intronic
1020170731 7:5842993-5843015 CGTTTTCTGCAGCAGAAACTTGG - Intergenic
1021738342 7:23660808-23660830 TGTTATCTGCAGGAGGAATTGGG - Intergenic
1022662313 7:32378568-32378590 TATTATCTGCAGGAGTAACTGGG - Intergenic
1023189844 7:37568549-37568571 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1023699799 7:42881956-42881978 TGCTATCTGCAGGAGTAATTGGG - Intergenic
1026085014 7:67255734-67255756 TGTTATCTGTAGGAGTTATTGGG + Intergenic
1026211376 7:68308773-68308795 CATTTTCTGGAGGAGTTACTAGG + Intergenic
1026247660 7:68635503-68635525 TGTTATCTCCAGGAGCAACTTGG + Intergenic
1026274895 7:68867952-68867974 TGTTACCTGCAGGAATCATTGGG + Intergenic
1026288285 7:68983373-68983395 CGTTATCTGAAGGACTAATTGGG - Intergenic
1026290467 7:69001421-69001443 TGTTATCTGCAGGAATAACTGGG + Intergenic
1026663937 7:72325780-72325802 CGTTCCCTTCATGAGTCACTTGG - Intronic
1026692160 7:72559189-72559211 CGTAATCTGTAGGAGTTATTGGG - Intronic
1027407621 7:77878437-77878459 TGTTATCTGTAGGAGCAACTGGG + Intronic
1027531686 7:79342276-79342298 CGTTCTCTGCAAGAATAACTCGG + Intronic
1032428099 7:131838005-131838027 CGCTATTTACAGGAGTCACGGGG - Intergenic
1032491571 7:132328138-132328160 CGTTAAGTGAAGGGGTCACTGGG + Intronic
1033077124 7:138260075-138260097 TGTTATCTGCAAGAGTAATTGGG - Intergenic
1033341744 7:140497537-140497559 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1033626182 7:143111887-143111909 TGTTATCTGCAGAAGTAACTGGG - Intergenic
1034541494 7:151761359-151761381 TGTTATCTACAGGAGTAATTGGG - Intronic
1034686738 7:152978427-152978449 TGTTATCTACAGGAGTAATTGGG + Intergenic
1034706928 7:153154129-153154151 TGTTATTTGCAGGAGTAATTGGG + Intergenic
1035474215 7:159130394-159130416 TGTCATCTGCAGGGGTAACTGGG - Intronic
1036213727 8:6863005-6863027 TGGTTTCTGCAAGAGTCACTGGG + Intergenic
1036525413 8:9530080-9530102 TATTATCTGCAGGAGTAATTGGG - Intergenic
1037135590 8:15455903-15455925 TGTTATCTGCAGGAATAAATGGG - Intronic
1038339125 8:26669425-26669447 TGTTATTTGCAGGAGTAATTGGG + Intergenic
1038398733 8:27267005-27267027 TGTTACTTGCAGGAGTGACTGGG - Intergenic
1038744235 8:30242704-30242726 AGTTATCTGCAGGCTTCACTGGG - Intergenic
1039073183 8:33664422-33664444 TGTTATCTGTAGGAGTAATTGGG + Intergenic
1039089667 8:33814414-33814436 GGTTATCTGCAGGAGTAACTGGG + Intergenic
1039961363 8:42250373-42250395 TGTTATCTGCAGGGGTAATTGGG + Intergenic
1042398004 8:68313507-68313529 TGTTATCTGCAGGAGTAATTGGG - Intronic
1042922471 8:73933357-73933379 TGTTATCTACAGGAGTAATTGGG + Intergenic
1042979490 8:74509300-74509322 TGTTATTTGCAGGAGTAATTGGG + Intergenic
1043004993 8:74808214-74808236 TGTTTTTTGCAGGAGTAACTGGG - Intronic
1046071302 8:109257889-109257911 CATTATCTGCAAGACTCAGTGGG - Intronic
1047028879 8:120854216-120854238 CCTTATCTGAAAGAGTCATTTGG + Intergenic
1047053953 8:121143826-121143848 TGTTATCTGCAGGAGTAATTGGG - Intergenic
1048016685 8:130503440-130503462 TGTTATCTACAGGAGTAACTGGG + Intergenic
1048743331 8:137586352-137586374 TGTTATCTGCAGAAGTAATTGGG + Intergenic
1048743550 8:137588673-137588695 TATTATCTGCAGGAGTAATTGGG - Intergenic
1049449577 8:142653326-142653348 TGTTATCTGCAGGAGTAATTGGG - Intergenic
1049505594 8:142994864-142994886 TGTTATCTGCAGGAATAACTGGG + Intergenic
1049522901 8:143103483-143103505 AGTTATCTGCAGGAGGAATTGGG + Intergenic
1050324252 9:4484942-4484964 TGTTATCTACAGGAGTAAATTGG - Intergenic
1050441735 9:5671054-5671076 TGTTACCTGCAGGAGTAATTGGG + Intronic
1050493737 9:6217228-6217250 TGTTATTTACAGTAGTCACTGGG + Intronic
1050944500 9:11500402-11500424 TGTTATCTGCAGAAGTAATTGGG - Intergenic
1051248815 9:15138398-15138420 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1052545582 9:29873844-29873866 TGTTATCTACAGGAGTAATTGGG - Intergenic
1053346585 9:37382844-37382866 TGTTTTCTGCAGGAGGCCCTGGG - Intergenic
1055121258 9:72663366-72663388 TGTTATTTGCAGGAGTAATTGGG + Intronic
1055141043 9:72877269-72877291 TGTTATCTACAGGAGTCACTGGG + Intergenic
1055352946 9:75408066-75408088 TGTTATCTGCAGGAGTACTTGGG - Intergenic
1056897467 9:90564271-90564293 TGTTATCTGCAAGAGTGATTGGG + Intergenic
1056921363 9:90792164-90792186 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1057629814 9:96710560-96710582 TGTTATCTGCAAGTGTAACTGGG - Intergenic
1058048544 9:100383409-100383431 TGTTATCTGCAGGAGTAATTGGG - Intergenic
1058823982 9:108758722-108758744 TGTTATTTGCAGGAGTAATTGGG - Intergenic
1058829446 9:108802244-108802266 TGTTATTTGCAGGAGTAATTGGG - Intergenic
1062222323 9:135423599-135423621 TGTTATGTGCAGGAGTAATTGGG - Intergenic
1203755801 Un_GL000218v1:124797-124819 CGTAATGTGCAGGTGCCACTTGG - Intergenic
1185849855 X:3475245-3475267 TGTTATCTGCAGGAGTAATTGGG - Intergenic
1186027366 X:5327665-5327687 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1186036094 X:5425158-5425180 TGTTATTTGCAGGAGTAATTGGG - Intergenic
1186047930 X:5556513-5556535 CATTATCTACAGGAGCAACTGGG - Intergenic
1186055891 X:5649295-5649317 TGTTATTTGCAGGAGTGATTGGG + Intergenic
1186181988 X:6982596-6982618 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1186310829 X:8316869-8316891 AGTTATCTGAAGGACTGACTGGG - Intergenic
1186427912 X:9478694-9478716 TGTTATCTGCGGGAGTAACTGGG - Intronic
1186820617 X:13284316-13284338 CTTCATCTGGAAGAGTCACTTGG - Intergenic
1187087041 X:16051463-16051485 TGTTATCTGCAGGAGCAACTGGG + Intergenic
1187112749 X:16318345-16318367 TGTTATCTACAGGGGTAACTGGG - Intergenic
1187292679 X:17970258-17970280 AGTTATCTGCAGCCTTCACTTGG + Intergenic
1187841566 X:23494168-23494190 TATTATCTGCAGGAGTAATTGGG + Intergenic
1188898511 X:35698974-35698996 TGTCATTTGCAGGAGTAACTGGG + Intergenic
1188911591 X:35854560-35854582 TGTTATCTACAGGAGTAATTAGG + Intergenic
1189366557 X:40393505-40393527 GGTTATCTGCAGGTTTGACTGGG - Intergenic
1189675991 X:43461119-43461141 CGTTTTCTAGGGGAGTCACTGGG - Intergenic
1191675494 X:63788058-63788080 TGTTTTTTGCAGGAGTCCCTAGG - Intergenic
1191675497 X:63788085-63788107 CGTTTTTTGCAGGAGTCTCTAGG - Intergenic
1192414886 X:70970238-70970260 TATTATCTGCAGGAGTAATTGGG + Intergenic
1193084540 X:77437555-77437577 TGTCATCTGCAGGAGTAATTGGG + Intergenic
1193356253 X:80523093-80523115 AGTTATCTGCAGAAGACAGTAGG - Intergenic
1193968636 X:88021836-88021858 TGTTATTTACAGGAGTAACTGGG + Intergenic
1193993920 X:88342213-88342235 TGTTACTTGCAGGAGTAACTGGG + Intergenic
1194523770 X:94950672-94950694 TGTTATTTGCAGGAGTAATTGGG + Intergenic
1194758209 X:97762865-97762887 TGTTATTTACAGGAGTAACTGGG + Intergenic
1195079082 X:101354286-101354308 TTTTATCTGCAGTTGTCACTGGG + Intronic
1195220772 X:102743908-102743930 TGTTATCTGCAGGAATAATTGGG + Intronic
1195544662 X:106101069-106101091 CCCCCTCTGCAGGAGTCACTGGG + Intergenic
1195715375 X:107812996-107813018 TGTTATCTGCAGGAGTAATTAGG + Intergenic
1195722613 X:107880626-107880648 TGTTATCTGCAGGAGTAACTGGG + Intronic
1195960093 X:110377247-110377269 CGCTATATGCATTAGTCACTTGG + Intronic
1196184483 X:112731392-112731414 TGTTATCTGCAGGAGTAATTGGG - Intergenic
1196862886 X:120044111-120044133 TGTTATCTGGAGGAGTAATTGGG - Intergenic
1196880216 X:120192233-120192255 TGTTATCTGGAGGAGTAATTGGG + Intergenic
1197723428 X:129760243-129760265 CAATATCTGCAGGAGACACTTGG - Intronic
1198081986 X:133248859-133248881 CGTTATCTGCAGGAGTAATTGGG - Intergenic
1198382203 X:136094425-136094447 TGTTATCTGTAGGAGTAATTGGG - Intergenic
1200812475 Y:7500264-7500286 TGTTATCTGCAGGAGTAATTGGG + Intergenic
1201642096 Y:16190986-16191008 TGTTATCTGAAGGAGTAATTGGG - Intergenic
1201660719 Y:16394335-16394357 TGTTATCTGAAGGAGTAATTGGG + Intergenic