ID: 919772650

View in Genome Browser
Species Human (GRCh38)
Location 1:201172549-201172571
Sequence CAGGCTAAGCCAGCTGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919772650_919772659 9 Left 919772650 1:201172549-201172571 CCAACTGCAGCTGGCTTAGCCTG 0: 1
1: 0
2: 3
3: 23
4: 183
Right 919772659 1:201172581-201172603 CAGTCCAGCCATGGTTAGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 251
919772650_919772657 5 Left 919772650 1:201172549-201172571 CCAACTGCAGCTGGCTTAGCCTG 0: 1
1: 0
2: 3
3: 23
4: 183
Right 919772657 1:201172577-201172599 GGGACAGTCCAGCCATGGTTAGG 0: 1
1: 0
2: 0
3: 10
4: 161
919772650_919772662 14 Left 919772650 1:201172549-201172571 CCAACTGCAGCTGGCTTAGCCTG 0: 1
1: 0
2: 3
3: 23
4: 183
Right 919772662 1:201172586-201172608 CAGCCATGGTTAGGAGGGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 287
919772650_919772658 8 Left 919772650 1:201172549-201172571 CCAACTGCAGCTGGCTTAGCCTG 0: 1
1: 0
2: 3
3: 23
4: 183
Right 919772658 1:201172580-201172602 ACAGTCCAGCCATGGTTAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 116
919772650_919772664 23 Left 919772650 1:201172549-201172571 CCAACTGCAGCTGGCTTAGCCTG 0: 1
1: 0
2: 3
3: 23
4: 183
Right 919772664 1:201172595-201172617 TTAGGAGGGGCAGGCGCAGCAGG 0: 1
1: 0
2: 1
3: 33
4: 323
919772650_919772656 0 Left 919772650 1:201172549-201172571 CCAACTGCAGCTGGCTTAGCCTG 0: 1
1: 0
2: 3
3: 23
4: 183
Right 919772656 1:201172572-201172594 GGACAGGGACAGTCCAGCCATGG 0: 1
1: 0
2: 3
3: 31
4: 273
919772650_919772660 10 Left 919772650 1:201172549-201172571 CCAACTGCAGCTGGCTTAGCCTG 0: 1
1: 0
2: 3
3: 23
4: 183
Right 919772660 1:201172582-201172604 AGTCCAGCCATGGTTAGGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919772650 Original CRISPR CAGGCTAAGCCAGCTGCAGT TGG (reversed) Intergenic
900084683 1:886293-886315 AAGGCTCAGCCAGCTGAACTGGG + Intergenic
900611282 1:3545610-3545632 CAGGATGAGCCAGGTGCAGGTGG - Intronic
901038582 1:6350706-6350728 CAGGCTACACAAGCTGCAGGTGG - Intronic
902657929 1:17882205-17882227 GAGGCTAAGCCACCTGCTATAGG - Intergenic
905166861 1:36088168-36088190 AAGGCTAGGCCAGCTCCAGCTGG - Exonic
905928901 1:41772381-41772403 CAGGTTAAGCCAGCTGCAGGTGG + Intronic
907506516 1:54923015-54923037 CAGGCTAACCCAGCTGGAGCCGG + Intergenic
907968775 1:59360315-59360337 CATGCCAAGACAACTGCAGTAGG - Intronic
908239563 1:62177292-62177314 GAGGCTAAGCCAGGTGGATTAGG + Intergenic
909610003 1:77541582-77541604 CAGGTTAGGCCAGCGGGAGTTGG - Intronic
911548909 1:99255512-99255534 CAGGCTAAGACAGCTCCAAATGG - Intergenic
912555797 1:110515123-110515145 CATGATAAGCCAGCTGATGTGGG - Intergenic
919772650 1:201172549-201172571 CAGGCTAAGCCAGCTGCAGTTGG - Intergenic
922592625 1:226789323-226789345 CATGCTCAGCCAGCTTGAGTCGG + Intergenic
1062769533 10:87963-87985 CAGGCTAACCCAGGAGCAGATGG + Intergenic
1067517840 10:46968848-46968870 CAGTCTAAGTCAGCAGCAGTGGG - Intronic
1067575161 10:47404199-47404221 CAAGCTCAGGCAGCTGGAGTTGG + Intergenic
1067581768 10:47450857-47450879 CAGGACAAGCCAGCTGAAGTCGG + Intergenic
1067644408 10:48082981-48083003 CAGTCTAAGTCAGCAGCAGTGGG + Intergenic
1067844364 10:49708194-49708216 CAGTTTAAGCCAGCTGCAATTGG + Intronic
1070230357 10:74559265-74559287 CAGGCGGAGCCAGCAGCACTAGG + Intronic
1072552993 10:96493493-96493515 GAGGGCAAGCCAGCTGGAGTGGG + Intronic
1072615476 10:97046609-97046631 CAGGGTGGGCCAGCTGCAGGAGG - Intronic
1073098675 10:100995981-100996003 CTGGCTAAGCCAGGTCCAGTTGG + Intergenic
1073472770 10:103733353-103733375 CAGCCCAAGGCATCTGCAGTTGG - Intronic
1073583270 10:104686380-104686402 CAGTCTAAGCCTGCAGCAGTTGG - Intronic
1080582870 11:33657937-33657959 GAGGCAAAGACAGCTGCAGCAGG - Intronic
1081782729 11:45724342-45724364 CAGGGTAACCCATCTGTAGTAGG - Intergenic
1083253735 11:61484024-61484046 CAGGCTGACCCAACAGCAGTTGG - Intronic
1084021552 11:66420925-66420947 TGGGCTAAGCAAGCTGCAGCGGG - Intergenic
1084566389 11:69931190-69931212 GAGGCTCAGCCACCTGCACTGGG - Intergenic
1084646051 11:70458903-70458925 CAAAATAAGCCAGCTGCAGAAGG + Intergenic
1085527332 11:77172054-77172076 CAGGCTTAGCCGGCAGCAGCAGG - Intronic
1085834703 11:79940280-79940302 CAGGTTAAGCCAGGTGGAGCAGG - Intergenic
1087238581 11:95749953-95749975 CAGCCTCAGCCATCAGCAGTTGG + Intergenic
1088157151 11:106820682-106820704 TAGGCTAGGCCAGGTGCAGTGGG - Intronic
1088225775 11:107618225-107618247 CTGGCTGAGCCCTCTGCAGTGGG + Intronic
1088288061 11:108207612-108207634 GAGGCTGAGCCTGCTGCTGTCGG - Intronic
1090398785 11:126435441-126435463 CAGGCTAGCCCAGCTGAACTTGG + Intronic
1090831273 11:130422378-130422400 TAGCCGAAGCCAGCTGCGGTGGG + Intronic
1091132370 11:133157323-133157345 CAGGTCCAGGCAGCTGCAGTCGG + Intronic
1097059867 12:56274845-56274867 CTGGCTAACACAGCTGCAGAAGG - Exonic
1097163808 12:57070567-57070589 CAGCCTAAGACAGCTCCAGTTGG - Intronic
1097271893 12:57780565-57780587 CCCGCTGAGCCAGCTCCAGTTGG - Exonic
1101649923 12:106668104-106668126 GAAGGTAACCCAGCTGCAGTTGG + Intronic
1104820485 12:131674575-131674597 GCGGCTAAGCCAGCTCCAGTGGG - Intergenic
1104925431 12:132311619-132311641 CAGGCCAGGGCAGCTGCCGTGGG + Intronic
1105818575 13:24059255-24059277 CAGGCCAGGCCGGATGCAGTGGG - Intronic
1105922877 13:24982086-24982108 CAGGCTAAGTCAGCTGAGGAGGG + Intergenic
1106111928 13:26785160-26785182 GAGCCTGAGCCAGATGCAGTGGG - Intergenic
1108581015 13:51828232-51828254 CAGATTAAGCCAGGTACAGTGGG - Intergenic
1110258874 13:73462946-73462968 CAGGCTAATGCATGTGCAGTAGG + Intergenic
1111595521 13:90404914-90404936 CCAGGTATGCCAGCTGCAGTAGG - Intergenic
1111873532 13:93864731-93864753 CAGGCTAAGCTAGTTGCATAAGG + Intronic
1112415839 13:99202708-99202730 CAGGCCAAGACAGCTGCAGAGGG - Intronic
1112511948 13:100017504-100017526 CAGGCAAAGCTATCTTCAGTGGG - Intergenic
1113327673 13:109298114-109298136 AAGGCTCAGCAAACTGCAGTCGG + Intergenic
1113768883 13:112896141-112896163 CAGGCACAGCCAGGTGCAGAGGG + Intronic
1113863065 13:113502793-113502815 CAGGCTCAACCAGCAGCAGAGGG - Intronic
1114458718 14:22873395-22873417 CAGGATGAGCCAGGTGCAGTTGG - Exonic
1114665969 14:24377387-24377409 CAGGCTAAGCCAGCAGGAAAGGG + Exonic
1117497429 14:56319546-56319568 CAGGTTAAGCCAGCTGTGGATGG - Intergenic
1119705142 14:76778697-76778719 CTGGCTAATCTGGCTGCAGTTGG - Intronic
1122869905 14:104633763-104633785 CAGGCTAAGTCAGGGGCAGCTGG - Intergenic
1124186392 15:27533321-27533343 CAGGCTGAGCCAGCAGGAGTGGG - Exonic
1124341033 15:28889173-28889195 CAGGCTGAGTCAGCTGTCGTGGG + Intronic
1124366691 15:29076948-29076970 CAGGCTAATCCAGTTCCAATTGG + Intronic
1124959645 15:34384873-34384895 GAGGCTGAGTCAGCTGCTGTGGG - Intronic
1124976271 15:34531094-34531116 GAGGCTGAGTCAGCTGCTGTGGG - Intronic
1124997179 15:34735286-34735308 CAGCCTATTCCAGCTGCACTAGG + Intergenic
1125094414 15:35834496-35834518 CAGGATAATCCAGCTGCATGTGG - Intergenic
1127598549 15:60511960-60511982 TAGCCTAAGCCAGCTGCACGGGG - Intronic
1128143578 15:65319101-65319123 GAGGCCAGGCCAGCTGCAGGAGG + Intergenic
1129401760 15:75288517-75288539 GGGGCTAAGTCAGCTGCTGTGGG + Intronic
1130250190 15:82295037-82295059 CAGGTTAGGACACCTGCAGTAGG - Intergenic
1130404191 15:83583457-83583479 CAGCCTAAGCCTTTTGCAGTTGG + Intronic
1132116387 15:99139042-99139064 CAGGCTAAGGCACCTGCTGCAGG - Intronic
1132458667 16:38509-38531 CAGGCTAACCCAGGAGCAGACGG + Intergenic
1133950305 16:10385937-10385959 CAGGCACAGCCAGCTAGAGTGGG - Intronic
1134254721 16:12601604-12601626 CTGGCTAAGCAGGCTGCACTTGG - Intergenic
1134913586 16:18050778-18050800 GAGGCTAAGGGAGATGCAGTGGG - Intergenic
1135589722 16:23696081-23696103 CATGCTCAGCCTGGTGCAGTGGG + Intronic
1136568813 16:31084885-31084907 CAGGCTGGGCCAGCAGCAGGAGG + Exonic
1138108094 16:54301531-54301553 CAGTCTATGCCATCTGCATTTGG + Intergenic
1140947576 16:79784381-79784403 CAGGCTAAGGGAGCAGAAGTTGG - Intergenic
1141677515 16:85525334-85525356 CGGGCTGAGCCAGCCGCACTGGG - Intergenic
1142509617 17:385698-385720 CAGGCGAGGCCAGGTGCAGAGGG + Intronic
1142743539 17:1943632-1943654 CAGGCCAGGCCGGCTGCACTTGG + Intronic
1143827624 17:9624874-9624896 CAGGCTAAAAAAGCAGCAGTGGG - Intronic
1145321174 17:21768223-21768245 CAGGAGAAGCCAGCTGCCGTGGG + Intergenic
1146213652 17:30961370-30961392 CAAGCAAAGCTATCTGCAGTAGG + Intergenic
1147140884 17:38460088-38460110 CAGGCTAAGTCAGCTGGATGTGG - Intronic
1148544116 17:48503888-48503910 CAGGCTCAAGCTGCTGCAGTGGG - Intergenic
1149649883 17:58270044-58270066 AGGGATAAGCCAGCTGCAGCTGG - Exonic
1150767941 17:68017254-68017276 CAGGCTAGGCCAGGTGCAGTGGG + Intergenic
1152059362 17:78058566-78058588 CAAGCTAAACCAGCAGCAGTGGG + Intronic
1152891742 17:82885817-82885839 CAGGGTAAGCTAGGTGCACTCGG - Intronic
1155936264 18:31757783-31757805 CAGGCTAACCCACCTGCCCTGGG + Intergenic
1157475235 18:48019811-48019833 CAGGCTCAGGCAGGTGCAGTGGG - Intergenic
1161610384 19:5238818-5238840 CAGGCGGGGCCTGCTGCAGTGGG - Intronic
1162495662 19:11022042-11022064 CAGGCCCAGCCAGCTGTAGCTGG - Intronic
1162610709 19:11748753-11748775 CAGGCTGGGCCGGGTGCAGTGGG + Intergenic
1163193444 19:15696804-15696826 CAGGCTGAGCTGGGTGCAGTTGG + Intronic
1163562969 19:18031558-18031580 CTGGCTAACACAGCTGCAGAAGG + Intergenic
1164266830 19:23626693-23626715 CAAGCAAAGCTATCTGCAGTAGG - Intronic
1167883399 19:52481111-52481133 CAGGCTAACCCACCTGCCCTGGG - Intronic
1202665534 1_KI270708v1_random:115535-115557 AAGGCCAAGCCAGGTGCAGAGGG + Intergenic
925290903 2:2748168-2748190 CAGGCCCAACCAGCTGCAGCAGG - Intergenic
925979696 2:9166830-9166852 CAGGCCTGCCCAGCTGCAGTTGG + Intergenic
925994044 2:9277271-9277293 CAGGCTCAGCCAGCACCAGTGGG - Intronic
926994048 2:18714788-18714810 CAGGCAAAGCCAGCTTATGTAGG + Intergenic
932179966 2:69638126-69638148 CAGGCAAAGACATCTGAAGTGGG + Intronic
932432412 2:71683844-71683866 TGGGCATAGCCAGCTGCAGTGGG - Intronic
933666529 2:84969941-84969963 CAGGCTAAGTCAACTGAAATTGG - Intergenic
933831793 2:86217214-86217236 CAGCCCTAGCCAGCTGCATTTGG - Intronic
935222450 2:101027235-101027257 CAGGCTAAGACAGCTTCAAGGGG + Intronic
937262982 2:120598197-120598219 CAGGCCAAGACAGACGCAGTGGG - Intergenic
938097628 2:128473984-128474006 CAGGCCATGCCAGCTGGAGGGGG + Intergenic
938299454 2:130199755-130199777 CAGGCTAGGCCAGCCGAGGTAGG - Intergenic
938562485 2:132486332-132486354 CGGGCTAATGCAGCTGCAGCTGG - Intronic
940833020 2:158489568-158489590 CCAGCTAAGGCAGCTGCAGGGGG - Intronic
945924655 2:215790826-215790848 CAGGCTCAGCCATCTTCAGGAGG - Intergenic
945974522 2:216259821-216259843 CAGGCTCAGCAAGTTCCAGTAGG + Intronic
946531250 2:220572670-220572692 CAGGCTATGGCAGCTGTACTCGG - Intergenic
946582280 2:221142604-221142626 CAAGCTAAGAAAGCTGCAGTGGG - Intergenic
1169248538 20:4042874-4042896 CAGAATAGGCCAGGTGCAGTGGG - Intergenic
1171391843 20:24806612-24806634 CAGGTGAGGCCAGCTGCAGTGGG - Intergenic
1174451229 20:50621807-50621829 TAGCTTAAGCCAGCTGGAGTTGG + Intronic
1178569869 21:33726278-33726300 TAGGCTTGGCCGGCTGCAGTGGG - Intronic
1179284965 21:39969507-39969529 CAGCCTCTGCCAACTGCAGTAGG + Intergenic
1180196182 21:46195714-46195736 CAGGCCAAACCAGGTGCCGTAGG + Exonic
1180332247 22:11492455-11492477 AAGGCCAAGCCAGGTGCAGAGGG + Intergenic
1180638437 22:17279069-17279091 CAGAGTAAGCCAGGCGCAGTGGG - Intergenic
1180939055 22:19645009-19645031 CAGGCTGATCAAGCGGCAGTTGG - Intergenic
1180948506 22:19709736-19709758 CAGGCAGAGACAGCTGCTGTGGG + Intergenic
1182029491 22:27146745-27146767 CAGTAAATGCCAGCTGCAGTGGG + Intergenic
1184374658 22:44104061-44104083 CAGGGCACGCCAGCTGCAGCTGG - Intronic
1184789863 22:46693469-46693491 CAGGCAAAGCAAGCAGCAGCTGG - Exonic
1185388569 22:50547432-50547454 CAAGCAAAGCCGGCTGCAGCCGG + Intergenic
949900379 3:8809711-8809733 CAGGCTAAGCCAGCTTCTCCAGG + Intronic
950414132 3:12858681-12858703 CAGGATCAGCCAGCTGGGGTGGG + Intronic
952326453 3:32324712-32324734 CAGGCCCAGCCAGATGCAGGGGG - Intronic
952404755 3:32995533-32995555 CAGGTTGAGCCAGCTGCAAGTGG - Intergenic
953963089 3:47281986-47282008 CAGCCAAGGCCAGGTGCAGTTGG - Intronic
955563474 3:60219149-60219171 TAAGCAAAGCCAGATGCAGTAGG - Intronic
956149205 3:66223391-66223413 TAGGCAAAGCCAGCTGAGGTGGG + Intronic
956728599 3:72176987-72177009 CAGGCAAAGCCAGCAGTTGTTGG + Intergenic
961853456 3:129845112-129845134 CAGGCGATGGAAGCTGCAGTTGG + Intronic
962704461 3:138029720-138029742 CAGGCACAGCCAGGTGCAGTGGG + Intronic
962989603 3:140566208-140566230 CAGGCAAGCCCAGCTGGAGTGGG + Exonic
967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG + Intergenic
967706945 3:192662019-192662041 CAGGCTGAGTCAGATGCAGTAGG - Intronic
968052165 3:195662635-195662657 CAGGCTTTGCGAGCTGCATTTGG + Intergenic
968301948 3:197623296-197623318 CAGGCTTTGCGAGCTGCATTTGG - Intergenic
969452501 4:7282758-7282780 GAGGCTCAGCCAGCGGCAGGTGG + Intronic
969515134 4:7643236-7643258 AAGGCTCAGCCGACTGCAGTAGG + Intronic
970324141 4:14905599-14905621 CAGACTATGCCAGCTACAGAGGG + Intergenic
970601128 4:17641968-17641990 CAGGCTCAGCCAGCCGCAGTAGG + Intronic
979268326 4:118729620-118729642 CAGGCCAATCCAGCTGCACGTGG + Intronic
983490842 4:168387242-168387264 CAAGCCAAACCAGCTGCTGTTGG + Intronic
983987195 4:174073698-174073720 CAGGCTCAGCCAGCAGAAGGAGG - Intergenic
985103675 4:186482070-186482092 CAGGCTGAGGCAGCGGCAGCTGG - Intronic
986328912 5:6703116-6703138 CAGGCTCAGGAGGCTGCAGTGGG - Intergenic
1001197396 5:169686039-169686061 AAGGCTAAGCCAGGTGAATTGGG - Intronic
1002541980 5:179912471-179912493 CTTGCTGAGCCAGCTGCAGGAGG - Intronic
1006059663 6:31410878-31410900 CAGCCTGAGCCAGATCCAGTGGG - Intronic
1007175977 6:39897825-39897847 CAAGCAAAGCTATCTGCAGTAGG - Intronic
1010247552 6:73675748-73675770 CAGGAAAAGCCTGCTGCAGCTGG - Intergenic
1012974422 6:105764782-105764804 CAGGAAAAGTCAGCTGAAGTTGG - Intergenic
1013621032 6:111889443-111889465 AAGGCTCAGCCAGCAGCAGCAGG + Intergenic
1016559244 6:145376473-145376495 CAGGCTAGGACAGCTGAACTTGG - Intergenic
1016871631 6:148823540-148823562 CAGGATAAGGCAGCACCAGTAGG - Intronic
1018344123 6:162882839-162882861 CAGGGTAAGCCTGCTAAAGTGGG - Intronic
1019164550 6:170089275-170089297 CAGGGGAAGCCAGCAGCAGGAGG - Intergenic
1019713957 7:2529941-2529963 GAGGCGATGCCAGCTGCAGGCGG - Intergenic
1019847485 7:3520759-3520781 CATGCTATGCCAGCAGCAGCTGG - Intronic
1023775789 7:43605589-43605611 AAGGCTAAGACAGCTGGAATTGG - Intronic
1023795958 7:43792345-43792367 CAGGCAAAGCTAGCCGCTGTGGG + Intronic
1024404422 7:48962365-48962387 CAGGCAAAGACAGATGGAGTCGG - Intergenic
1024690981 7:51803016-51803038 ATGGATAAGCCTGCTGCAGTGGG - Intergenic
1029335598 7:99896866-99896888 CAAGCTGTGGCAGCTGCAGTTGG + Intronic
1032703643 7:134403808-134403830 CAGGGTAAGGCAGCTGCTGTGGG + Intergenic
1034044362 7:147912429-147912451 CAGGCTGAGACAGCTGCAGCTGG - Intronic
1035354786 7:158270527-158270549 CAGGCCAGGCCCCCTGCAGTGGG + Intronic
1035650334 8:1259263-1259285 CAGGCTGAGCCACCGACAGTCGG - Intergenic
1036219607 8:6910391-6910413 CAGGCTAAGCCATCAGCACAAGG - Intergenic
1037777657 8:21846493-21846515 GAGGCTAAAGAAGCTGCAGTCGG + Intergenic
1045610457 8:103835056-103835078 CAGTCTTGGCCAGATGCAGTGGG - Intronic
1048885880 8:138909448-138909470 CAGGCGAGGCCAGCTCCAATTGG + Intronic
1049476561 8:142799666-142799688 CAGGCAAAGCCAGCTAGAGAGGG - Intergenic
1049744384 8:144257046-144257068 CAGGCCAGGCCAGCCGCAGGCGG - Intronic
1050748479 9:8906742-8906764 TAGGCTAAGAGAGCTGCTGTTGG - Intronic
1051371075 9:16359780-16359802 CAGGCTCAGTAACCTGCAGTTGG + Intergenic
1052990777 9:34518364-34518386 CAGGCCAAGCCAGCACCAGAGGG - Intronic
1053001617 9:34579895-34579917 CAGGCTGAGGCAGCTTCTGTGGG - Intronic
1053406753 9:37883608-37883630 CAGGCTAACCCACCTGCCCTGGG + Intronic
1054929169 9:70618542-70618564 CAAGCAAAGCCAGCTGCACCAGG - Intronic
1058407002 9:104688018-104688040 CAGGATAATCTAGCTGGAGTAGG + Intergenic
1059730346 9:117050867-117050889 CAGGCAAATCTAACTGCAGTAGG - Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061834945 9:133322687-133322709 CAGGGTCAGCCAGAAGCAGTGGG - Intergenic
1185908875 X:3964132-3964154 CAAGCTAAGCTATCTTCAGTAGG - Intergenic
1186302731 X:8218232-8218254 CAAGCTAAGCCATCTTCAATAGG + Intergenic
1188067550 X:25680411-25680433 CAGCCAAAGCCAGCTGAAGCTGG - Intergenic
1190044780 X:47102835-47102857 CATGCTTAACCTGCTGCAGTTGG - Intergenic
1192172014 X:68861599-68861621 CAGGCCAGGCCAGGAGCAGTAGG + Intergenic
1193108666 X:77705320-77705342 CATGCTTAGGCAGCTGCAGCAGG + Intronic
1193999355 X:88408696-88408718 CAAGCAAAGCTAGCTTCAGTAGG + Intergenic
1197708565 X:129650784-129650806 GAGGCTGAAGCAGCTGCAGTGGG - Intronic
1200397755 X:156001187-156001209 CAGGCTAACCCAGGAGCAGACGG - Intronic