ID: 919773320

View in Genome Browser
Species Human (GRCh38)
Location 1:201176878-201176900
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919773320_919773329 24 Left 919773320 1:201176878-201176900 CCTCCTCTCCTCACCAGAGTGTC No data
Right 919773329 1:201176925-201176947 CTGAAGGCAATTAACAGCCTGGG No data
919773320_919773328 23 Left 919773320 1:201176878-201176900 CCTCCTCTCCTCACCAGAGTGTC No data
Right 919773328 1:201176924-201176946 ACTGAAGGCAATTAACAGCCTGG No data
919773320_919773327 8 Left 919773320 1:201176878-201176900 CCTCCTCTCCTCACCAGAGTGTC No data
Right 919773327 1:201176909-201176931 AAAAGCTAACAATGAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919773320 Original CRISPR GACACTCTGGTGAGGAGAGG AGG (reversed) Intergenic
No off target data available for this crispr