ID: 919773327

View in Genome Browser
Species Human (GRCh38)
Location 1:201176909-201176931
Sequence AAAAGCTAACAATGAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919773318_919773327 30 Left 919773318 1:201176856-201176878 CCATAGTTCCAGGTTCTTCTCAC No data
Right 919773327 1:201176909-201176931 AAAAGCTAACAATGAACTGAAGG No data
919773319_919773327 22 Left 919773319 1:201176864-201176886 CCAGGTTCTTCTCACCTCCTCTC No data
Right 919773327 1:201176909-201176931 AAAAGCTAACAATGAACTGAAGG No data
919773324_919773327 -5 Left 919773324 1:201176891-201176913 CCAGAGTGTCCCTGGCAGAAAAG No data
Right 919773327 1:201176909-201176931 AAAAGCTAACAATGAACTGAAGG No data
919773323_919773327 0 Left 919773323 1:201176886-201176908 CCTCACCAGAGTGTCCCTGGCAG No data
Right 919773327 1:201176909-201176931 AAAAGCTAACAATGAACTGAAGG No data
919773321_919773327 5 Left 919773321 1:201176881-201176903 CCTCTCCTCACCAGAGTGTCCCT No data
Right 919773327 1:201176909-201176931 AAAAGCTAACAATGAACTGAAGG No data
919773320_919773327 8 Left 919773320 1:201176878-201176900 CCTCCTCTCCTCACCAGAGTGTC No data
Right 919773327 1:201176909-201176931 AAAAGCTAACAATGAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919773327 Original CRISPR AAAAGCTAACAATGAACTGA AGG Intergenic
No off target data available for this crispr