ID: 919773328

View in Genome Browser
Species Human (GRCh38)
Location 1:201176924-201176946
Sequence ACTGAAGGCAATTAACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919773320_919773328 23 Left 919773320 1:201176878-201176900 CCTCCTCTCCTCACCAGAGTGTC No data
Right 919773328 1:201176924-201176946 ACTGAAGGCAATTAACAGCCTGG No data
919773324_919773328 10 Left 919773324 1:201176891-201176913 CCAGAGTGTCCCTGGCAGAAAAG No data
Right 919773328 1:201176924-201176946 ACTGAAGGCAATTAACAGCCTGG No data
919773321_919773328 20 Left 919773321 1:201176881-201176903 CCTCTCCTCACCAGAGTGTCCCT No data
Right 919773328 1:201176924-201176946 ACTGAAGGCAATTAACAGCCTGG No data
919773326_919773328 0 Left 919773326 1:201176901-201176923 CCTGGCAGAAAAGCTAACAATGA No data
Right 919773328 1:201176924-201176946 ACTGAAGGCAATTAACAGCCTGG No data
919773325_919773328 1 Left 919773325 1:201176900-201176922 CCCTGGCAGAAAAGCTAACAATG No data
Right 919773328 1:201176924-201176946 ACTGAAGGCAATTAACAGCCTGG No data
919773323_919773328 15 Left 919773323 1:201176886-201176908 CCTCACCAGAGTGTCCCTGGCAG No data
Right 919773328 1:201176924-201176946 ACTGAAGGCAATTAACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919773328 Original CRISPR ACTGAAGGCAATTAACAGCC TGG Intergenic
No off target data available for this crispr