ID: 919774575

View in Genome Browser
Species Human (GRCh38)
Location 1:201185696-201185718
Sequence GCCACTGTGCGGAGAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919774567_919774575 18 Left 919774567 1:201185655-201185677 CCAGCCTCTAGGCCAGTCTTCCA No data
Right 919774575 1:201185696-201185718 GCCACTGTGCGGAGAGAGCCAGG No data
919774569_919774575 14 Left 919774569 1:201185659-201185681 CCTCTAGGCCAGTCTTCCAAGGC No data
Right 919774575 1:201185696-201185718 GCCACTGTGCGGAGAGAGCCAGG No data
919774570_919774575 6 Left 919774570 1:201185667-201185689 CCAGTCTTCCAAGGCCATTGTGA No data
Right 919774575 1:201185696-201185718 GCCACTGTGCGGAGAGAGCCAGG No data
919774572_919774575 -2 Left 919774572 1:201185675-201185697 CCAAGGCCATTGTGAGCTGGAGC No data
Right 919774575 1:201185696-201185718 GCCACTGTGCGGAGAGAGCCAGG No data
919774566_919774575 26 Left 919774566 1:201185647-201185669 CCTCTCTGCCAGCCTCTAGGCCA No data
Right 919774575 1:201185696-201185718 GCCACTGTGCGGAGAGAGCCAGG No data
919774564_919774575 30 Left 919774564 1:201185643-201185665 CCTTCCTCTCTGCCAGCCTCTAG No data
Right 919774575 1:201185696-201185718 GCCACTGTGCGGAGAGAGCCAGG No data
919774573_919774575 -8 Left 919774573 1:201185681-201185703 CCATTGTGAGCTGGAGCCACTGT No data
Right 919774575 1:201185696-201185718 GCCACTGTGCGGAGAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919774575 Original CRISPR GCCACTGTGCGGAGAGAGCC AGG Intergenic
No off target data available for this crispr