ID: 919775933

View in Genome Browser
Species Human (GRCh38)
Location 1:201194074-201194096
Sequence GTGGATGCCCATTCTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919775924_919775933 23 Left 919775924 1:201194028-201194050 CCAAAAGTAGGAGCGAGAAGGGG 0: 1
1: 0
2: 0
3: 15
4: 135
Right 919775933 1:201194074-201194096 GTGGATGCCCATTCTGTTGAAGG 0: 1
1: 0
2: 0
3: 16
4: 164
919775920_919775933 29 Left 919775920 1:201194022-201194044 CCTGACCCAAAAGTAGGAGCGAG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 919775933 1:201194074-201194096 GTGGATGCCCATTCTGTTGAAGG 0: 1
1: 0
2: 0
3: 16
4: 164
919775922_919775933 24 Left 919775922 1:201194027-201194049 CCCAAAAGTAGGAGCGAGAAGGG 0: 1
1: 0
2: 1
3: 15
4: 143
Right 919775933 1:201194074-201194096 GTGGATGCCCATTCTGTTGAAGG 0: 1
1: 0
2: 0
3: 16
4: 164
919775932_919775933 -9 Left 919775932 1:201194060-201194082 CCTGGGGTGAGTGGGTGGATGCC 0: 1
1: 0
2: 0
3: 17
4: 203
Right 919775933 1:201194074-201194096 GTGGATGCCCATTCTGTTGAAGG 0: 1
1: 0
2: 0
3: 16
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919775933 Original CRISPR GTGGATGCCCATTCTGTTGA AGG Intronic