ID: 919777150

View in Genome Browser
Species Human (GRCh38)
Location 1:201201735-201201757
Sequence GACCCTGATGTGTCTTAAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919777150_919777156 14 Left 919777150 1:201201735-201201757 CCAGCTTAAGACACATCAGGGTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 919777156 1:201201772-201201794 TGCAAAGTTTGACTTGGAGCTGG 0: 1
1: 0
2: 2
3: 15
4: 136
919777150_919777157 23 Left 919777150 1:201201735-201201757 CCAGCTTAAGACACATCAGGGTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 919777157 1:201201781-201201803 TGACTTGGAGCTGGATCTCAAGG 0: 1
1: 0
2: 3
3: 15
4: 184
919777150_919777155 8 Left 919777150 1:201201735-201201757 CCAGCTTAAGACACATCAGGGTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 919777155 1:201201766-201201788 TGGGAATGCAAAGTTTGACTTGG 0: 1
1: 0
2: 0
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919777150 Original CRISPR GACCCTGATGTGTCTTAAGC TGG (reversed) Exonic
900715882 1:4143300-4143322 GACCCTGAAGACTCTTTAGCTGG - Intergenic
906584221 1:46962033-46962055 GACCAAAATGTGTCTTAATCAGG - Intergenic
907268984 1:53279560-53279582 GAATTTGATGTGTCTGAAGCAGG - Intronic
918545034 1:185672628-185672650 AACCCTGAAGTGTCTTAAAAGGG - Intergenic
919777150 1:201201735-201201757 GACCCTGATGTGTCTTAAGCTGG - Exonic
920311820 1:205053029-205053051 GACCCAGATGTGCCTGGAGCTGG + Intronic
920420257 1:205828356-205828378 GTCCCTTATCTGTCTTATGCTGG - Exonic
920431506 1:205921898-205921920 GACCTTGCTGTGACTGAAGCAGG + Intronic
921375882 1:214472801-214472823 GCCCCTGATCTGTCTTATACTGG + Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
924471109 1:244343490-244343512 GACCCTCATATGTGTTGAGCAGG - Intergenic
1065805757 10:29392245-29392267 GACACTGTTGTTTCTTAAGAAGG + Intergenic
1066067374 10:31772182-31772204 GGCACTGATGTGTCTCAATCTGG - Intergenic
1072890534 10:99319816-99319838 GACACTGAAGGGTATTAAGCAGG + Intergenic
1077012651 11:385751-385773 GACCCGGCTGTGCCTTCAGCTGG - Intergenic
1080773868 11:35367395-35367417 GACCCTCATGTGTCTAACACAGG + Intronic
1083704983 11:64508040-64508062 GACCCTGGGGTGACTTAGGCCGG - Intergenic
1086996372 11:93360982-93361004 GACTATGATGTGTCTTAATATGG - Intronic
1087216278 11:95498633-95498655 GACCCACATGTGTTTAAAGCTGG + Intergenic
1088861719 11:113806499-113806521 GACCGAGATGGGTCTGAAGCAGG - Exonic
1090325412 11:125882089-125882111 GAAACTGAAGTGTTTTAAGCAGG - Intergenic
1093200057 12:16175819-16175841 GCCCCTGCTGTCTCTTAAGCAGG - Intergenic
1095043413 12:37470442-37470464 GGCCCAGCTGTGTCTCAAGCAGG + Intergenic
1096100788 12:48969579-48969601 GACCCTGATGACTTTGAAGCTGG - Intronic
1108349747 13:49581112-49581134 ATCCCTGAAGGGTCTTAAGCAGG + Intronic
1109453037 13:62543735-62543757 GACTCTGATTTATATTAAGCAGG - Intergenic
1109504028 13:63275006-63275028 GACTATAATGTGTCTTGAGCAGG - Intergenic
1117211569 14:53506335-53506357 GCCACTGCTGTGTCCTAAGCAGG + Intergenic
1119538908 14:75426339-75426361 GTACTTGATGTGTCTTCAGCTGG - Intergenic
1119709023 14:76807908-76807930 GACCCTGATGTGAGTGAAGAGGG - Exonic
1122950687 14:105042851-105042873 GATCCTGATGTGTGTGAAGGTGG - Intergenic
1123006340 14:105325586-105325608 GAGCCAGGTGTGTCTTGAGCTGG + Intronic
1202941958 14_KI270725v1_random:158054-158076 GGCCCAGCTGTGTCTCAAGCAGG + Intergenic
1123984286 15:25631084-25631106 GACCCAGAAGTGGCTTCAGCTGG - Intergenic
1126291494 15:47085410-47085432 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1130792405 15:87169550-87169572 GCACCTGCTGTGTCCTAAGCAGG + Intergenic
1132110243 15:99097463-99097485 GACCCCGCTGTGTCTTGGGCAGG - Intergenic
1134640694 16:15827360-15827382 GTCCCTGCTTTGTCTTGAGCTGG - Intronic
1135188538 16:20335660-20335682 GCCCCTGATGGGTCTGAAGTAGG - Intronic
1143401629 17:6649164-6649186 ACCCCTGCTTTGTCTTAAGCAGG - Intronic
1149411912 17:56417433-56417455 GTCCCTGCTGTTTCTCAAGCAGG + Intronic
1154010169 18:10567545-10567567 GGCCCTGCTGTGACATAAGCAGG + Intergenic
1155130439 18:22929255-22929277 GACCCTGAAATGCTTTAAGCAGG + Intronic
1158318528 18:56238088-56238110 CACCCTGATGCTTTTTAAGCAGG - Intergenic
1162090408 19:8276065-8276087 GACCCTGCTGTATCTTAAAAAGG - Intronic
1162092641 19:8290898-8290920 GACCCTGCTGTATCTTAAAAAGG - Intronic
1163311618 19:16518377-16518399 CAACCTGAAGTGTCTTAGGCTGG + Exonic
1163845404 19:19635628-19635650 GACCCTGGTGAGGCTGAAGCAGG - Exonic
1166209378 19:41296393-41296415 GACCCACATGTCCCTTAAGCAGG - Intronic
1167788105 19:51652319-51652341 GAACCTGCTGTGCCTGAAGCCGG + Intergenic
1168651662 19:58096118-58096140 GAGCCTGGGGAGTCTTAAGCAGG + Intronic
925346618 2:3176392-3176414 GACCTTGTTTTGTCTTTAGCCGG - Intergenic
936019679 2:108985384-108985406 GACCGTGAAGTGAGTTAAGCTGG + Intronic
937024214 2:118683909-118683931 GACCCTGATGTGTCTTCTTCAGG + Intergenic
940600605 2:155854638-155854660 GACCCTGAAGGATGTTAAGCAGG - Intergenic
941357087 2:164507190-164507212 TACCCTGATATCTCTTAAGTTGG + Intronic
944358150 2:198818461-198818483 TACCCTGATGTGGCTTCTGCAGG + Intergenic
945493025 2:210477760-210477782 GCCCATGGTGAGTCTTAAGCTGG + Exonic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
1169179777 20:3553542-3553564 GACACTGATGGGTTTTAAGAAGG - Intronic
1169883094 20:10368506-10368528 AAACTTGATGTGTCTGAAGCAGG + Intergenic
1171803318 20:29648603-29648625 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1171840803 20:30208511-30208533 GGCCCAGCTGTGTCTCAAGCAGG + Intergenic
1172707757 20:36895117-36895139 GACACTGAAGGGTTTTAAGCAGG - Intronic
1173876839 20:46378105-46378127 TGCCCTGATGTTTCTTAAGTTGG - Intronic
1176581210 21:8528880-8528902 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1177390093 21:20457515-20457537 GGCCCTTTTGTGTCTTAAGCTGG + Intergenic
1180116022 21:45705547-45705569 CACCCTGACATGCCTTAAGCAGG - Intronic
1181603804 22:23967653-23967675 GACCCTGATGTGTCCTTACTGGG - Intronic
1181604709 22:23973654-23973676 GACCCTGATGTGTCCTTACTGGG + Intronic
1182170276 22:28221639-28221661 CACCCTGCTGTGTCCTAAACAGG + Intronic
1182755798 22:32677930-32677952 GACCATGCTGTGTCTTCTGCAGG - Intronic
951168592 3:19511522-19511544 TGCCCTGTTGTGTCTTTAGCTGG + Intronic
951472758 3:23073665-23073687 GATTCTGATGTGTCTTTATCGGG + Intergenic
954444719 3:50540527-50540549 AACCCTGATGTGTTAGAAGCTGG + Intergenic
955078648 3:55637389-55637411 GAACCTGATGAGTCCTCAGCAGG - Intronic
963020285 3:140867209-140867231 TTCTCTGATGTGTCTTAATCTGG + Intergenic
964753285 3:160071704-160071726 GACCCTGAAGTGCAATAAGCAGG + Intergenic
964870968 3:161313447-161313469 GACCCTGAAGAATCTTAAGCTGG - Intergenic
965000540 3:162947187-162947209 GAACCAGTTGTGTCTAAAGCTGG - Intergenic
968705055 4:2073829-2073851 GTCCCTGGTGTGTCCTGAGCAGG + Intronic
972520944 4:39856015-39856037 GACCCTGATGTGTCTCAGTGTGG - Intronic
974718696 4:65707125-65707147 GACCCTAAAATGTCTTAAGAGGG - Intergenic
980754811 4:137144327-137144349 TACACTGAAATGTCTTAAGCTGG - Intergenic
982307277 4:153945828-153945850 GACTCTGATGTGTCTCAATGTGG + Intergenic
987424366 5:17756174-17756196 GTCCTTGATGTGTCTAAGGCTGG + Intergenic
989522689 5:42420432-42420454 CTCCCTGCTGTTTCTTAAGCAGG - Intergenic
991114973 5:62944908-62944930 GTCACTGAAGTTTCTTAAGCTGG + Intergenic
991137092 5:63194419-63194441 GAACCTGCTGTGGCTAAAGCAGG - Intergenic
994240675 5:97416833-97416855 GACCCTAATATGTGTTAAGTGGG - Intergenic
996318162 5:122184696-122184718 TACCTTGATGTGTCTCAAGCTGG - Intergenic
1003398738 6:5774701-5774723 GATCCTGAGGTGTCTTTAGGTGG + Intergenic
1004058714 6:12169534-12169556 TTACCTGATCTGTCTTAAGCAGG - Intergenic
1011177542 6:84581308-84581330 GACACTGATGGGTCTGTAGCAGG + Intergenic
1015086320 6:129296802-129296824 AACCCTGAAGTATTTTAAGCAGG + Intronic
1018288233 6:162263945-162263967 GTCCTTGCTGTGTCTTAAGAGGG - Intronic
1019351843 7:557683-557705 GACCGTGGTGCGTCTCAAGCTGG - Intronic
1020248650 7:6449911-6449933 GACCCTGATGTCTTTTCAGAGGG - Intronic
1020248777 7:6450626-6450648 GACCCTGATGTCTTTTCAGAGGG - Intronic
1021265936 7:18522722-18522744 GCCCATGATATGTCTTAAGAAGG + Intronic
1021588585 7:22236776-22236798 GACCCTCATGTGCTCTAAGCAGG - Intronic
1028108305 7:86906552-86906574 AATCCTGATGTGACATAAGCAGG + Intronic
1031376515 7:121033234-121033256 CACCCTCATGTTTCTTCAGCAGG - Intronic
1035279802 7:157770729-157770751 GACCTTGCTGTGTCTGGAGCTGG - Intronic
1038461226 8:27718685-27718707 ACCCCTGTTGTGTCTTCAGCTGG - Intergenic
1041300358 8:56405074-56405096 GCCCCAGCTGTGTCTCAAGCAGG + Intergenic
1041392725 8:57361035-57361057 GAGTCAGGTGTGTCTTAAGCAGG - Intergenic
1048826196 8:138429668-138429690 GACTGTGTTTTGTCTTAAGCTGG + Intronic
1049314120 8:141950657-141950679 TTCCCTGAGGTGTCATAAGCCGG + Intergenic
1058255781 9:102760801-102760823 TACCCTAATGTGTCTGGAGCTGG - Intergenic
1059992592 9:119879125-119879147 GACCCTGAGGTCTCTTTGGCGGG - Intergenic
1203611228 Un_KI270749v1:6925-6947 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1190710310 X:53063294-53063316 GCCCCTGCTGTGGCTCAAGCAGG - Intronic