ID: 919777163

View in Genome Browser
Species Human (GRCh38)
Location 1:201201824-201201846
Sequence CTGTATAAGGTGAGGCTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919777163 Original CRISPR CTGTATAAGGTGAGGCTGGA GGG Exonic
900033127 1:385619-385641 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
900053966 1:615509-615531 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
901180750 1:7340288-7340310 CTGGAGAAGGTAAGACTGGAGGG + Intronic
901505291 1:9681343-9681365 CTTGAGAGGGTGAGGCTGGAGGG - Intronic
901913858 1:12482265-12482287 CTGGATAAGGGGAGGCTGGGTGG - Intronic
902389786 1:16096514-16096536 ATATATAAGCTGAGGCTTGAAGG - Intergenic
903970010 1:27112585-27112607 CTATCAAAGGTGAGGCTGGCTGG + Intronic
904428896 1:30449202-30449224 CTGTTGATGGTGAGGCTCGATGG + Intergenic
904734629 1:32621543-32621565 CTCTCTGGGGTGAGGCTGGAGGG + Exonic
904937328 1:34140935-34140957 CTGCAGGAAGTGAGGCTGGAGGG - Intronic
906065684 1:42978663-42978685 CTGTGTAAGATGAGGTGGGAAGG - Intergenic
906532239 1:46530533-46530555 CTACACATGGTGAGGCTGGAGGG - Intergenic
907193567 1:52668400-52668422 CTCTCTAAGCTGACGCTGGAAGG - Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907278527 1:53329854-53329876 GTGCCTCAGGTGAGGCTGGAGGG + Intergenic
907911804 1:58833729-58833751 CTGTAAAAGTGGAGGCAGGAAGG + Intergenic
907964922 1:59319733-59319755 CTGTATTAGGCGGGGCTGGATGG + Intronic
909361991 1:74771385-74771407 ATGTACAAGATGAGCCTGGAAGG - Intergenic
909989588 1:82206747-82206769 CTGTATAAAGTGAGGCCGCCAGG - Intergenic
911857561 1:102899810-102899832 GAGAATAAGGTGAGGCAGGAGGG + Intronic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
915363524 1:155300675-155300697 CTGCATAGGGTGAGGCTGCTGGG - Intronic
917805235 1:178607179-178607201 CTGTAGAAGGTGATGTTGGTTGG - Intergenic
919683057 1:200455040-200455062 CTGTGCAAGATGAGACTGGAAGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG + Intronic
920720772 1:208384768-208384790 CTGTGAAAGTTGAGGCTGCAGGG + Intergenic
922770070 1:228176871-228176893 CTGCAGCGGGTGAGGCTGGACGG - Exonic
923314726 1:232768858-232768880 CAGTAGGAGCTGAGGCTGGAAGG - Intergenic
923619652 1:235568040-235568062 CTTTATAGGGTCATGCTGGAGGG - Intronic
924273889 1:242365216-242365238 CTGTATGAGGTGGTGCAGGAAGG + Intronic
924336690 1:242992639-242992661 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
1062948357 10:1477398-1477420 CTGTATAGGGTCATGCTGGAGGG - Intronic
1063201878 10:3791696-3791718 CTGTATAATGTGAGGAGGTAGGG - Intergenic
1064705299 10:18066817-18066839 CCTTCTTAGGTGAGGCTGGATGG + Intergenic
1066710824 10:38231460-38231482 CTGTATGAGGTGGTGCAGGAAGG - Intergenic
1067919453 10:50438491-50438513 CTGTCTTACCTGAGGCTGGATGG - Intronic
1069571142 10:69495124-69495146 CTGTAAAACAAGAGGCTGGATGG + Intronic
1070434016 10:76370839-76370861 CATTATAAGTTGAGGATGGAAGG + Intronic
1072314074 10:94184628-94184650 GTGTATAAAGTTAGGTTGGAGGG - Intronic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1075717617 10:124566148-124566170 CTGGAGAAGGTGATGCTGGGAGG - Intronic
1076668219 10:132104794-132104816 TTGGACATGGTGAGGCTGGATGG - Exonic
1079105982 11:17572740-17572762 GTGTATGAGGTGAGGCAGGAGGG - Intronic
1081967885 11:47180441-47180463 CTGAAGGAGGTGAGGCTGGGTGG - Exonic
1082837590 11:57663003-57663025 CTGTACAAGATGAGGCTGGAGGG + Intergenic
1083681341 11:64353232-64353254 CAGTGTGAGGTGTGGCTGGAGGG + Exonic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1083763865 11:64832980-64833002 GTGGATGAGGTGAGGCTGGGAGG + Intronic
1083868415 11:65471469-65471491 CTGTATTTGGAGAGGCTGAAGGG + Intergenic
1086846444 11:91755582-91755604 CTAGTTAAGGTGATGCTGGAGGG - Intergenic
1087504803 11:99005876-99005898 CTGTAGAAGGTGAGGTGGGTAGG - Intergenic
1087642579 11:100771365-100771387 CTTTAAAAGGTGGGGGTGGAGGG - Intronic
1088247969 11:107837901-107837923 GTGTATAAGGTGGGGGTGGGTGG - Intronic
1088754962 11:112878174-112878196 GTGTATTAGGTAAGGCTGCATGG + Intergenic
1089115474 11:116091613-116091635 CTTTATCAGGTGACACTGGAAGG - Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089964787 11:122647050-122647072 GTGTGCAAGGTGAGCCTGGACGG - Intergenic
1090441635 11:126729559-126729581 CTGTAAACAATGAGGCTGGAAGG + Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1092068926 12:5616755-5616777 CTGTATAAGGTGATGGGTGAGGG - Intronic
1092531936 12:9352142-9352164 CTGTAGAAGGAGAGGCTGCCGGG - Intergenic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1093560585 12:20534092-20534114 CTGCATAACGTGTGGCTTGAAGG - Intronic
1093598727 12:20995245-20995267 CTGAAAAGGGTGAGGTTGGAAGG - Intergenic
1093972044 12:25384552-25384574 TGGTATGAGGTGAGCCTGGAAGG + Intergenic
1095384267 12:41631693-41631715 CTGTGTAAGCTGAGGTGGGATGG + Intergenic
1096973950 12:55687957-55687979 CTGTGGAAGGTGAGGCTTGGAGG - Exonic
1101119248 12:101562115-101562137 GTTTTTCAGGTGAGGCTGGAGGG - Intergenic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1106801121 13:33256944-33256966 CTGTATATAGTGAGTCTGTAAGG - Intronic
1107927895 13:45281177-45281199 CTGTATAAGGTGTGGGAGGTAGG + Intronic
1110226908 13:73129261-73129283 ATATATAATGTGAGGCTGGCTGG - Intergenic
1112005448 13:95249703-95249725 CTGTATGAGGTTCTGCTGGAAGG - Intronic
1114423008 14:22600311-22600333 CTTGAAAAGCTGAGGCTGGAAGG + Intronic
1117351243 14:54883881-54883903 CTAAAGAAGGTGAGGCAGGAAGG + Intronic
1119440414 14:74624485-74624507 CTGTCTGAGCTGGGGCTGGAAGG + Intergenic
1120180408 14:81337275-81337297 CTGTATCAGATGTGCCTGGAGGG - Intronic
1121114672 14:91335348-91335370 CGGTGAGAGGTGAGGCTGGAGGG - Intronic
1121812204 14:96901075-96901097 CTGTTTAAAGTGAGGGTGGGTGG + Intronic
1121856047 14:97271036-97271058 CTTTATAAAGAGAGGATGGATGG - Intergenic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1124364467 15:29062250-29062272 CTGCATACGGGGAGGCTGCACGG + Intronic
1125520689 15:40346350-40346372 CTGCATGAGGTGGGGCTGGAGGG + Intergenic
1126015199 15:44344015-44344037 CTGGATAGGCTGAGGCGGGAGGG + Intronic
1127620607 15:60730184-60730206 CTGTACTAGATGATGCTGGAAGG + Intronic
1129668635 15:77594114-77594136 GTGAATAAGTAGAGGCTGGACGG + Intergenic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133980725 16:10631421-10631443 CTGTGTAAGATGAGATTGGAAGG + Intronic
1136223641 16:28844647-28844669 CTGCAGAGGGTGGGGCTGGATGG - Intronic
1136925698 16:34371575-34371597 ATGTCTAAGGTCAGGCTGGCTGG + Intergenic
1136978876 16:35040231-35040253 ATGTCTAAGGTCAGGCTGGCTGG - Intergenic
1138907413 16:61353949-61353971 CTGTGTTAAGTGAGGCAGGAAGG - Intergenic
1139174872 16:64674789-64674811 CTTTTTAGGGTGAGGCTGGAGGG - Intergenic
1139519767 16:67474422-67474444 CAGAAGAAGGTGAGGCTAGAAGG - Intronic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1140190514 16:72811891-72811913 CCGGAGCAGGTGAGGCTGGAAGG - Exonic
1140841080 16:78839668-78839690 TAGAATAAGGTTAGGCTGGAGGG + Intronic
1141490509 16:84369180-84369202 CTGTAGGAAGTGAGGCTGGGAGG - Intronic
1141616138 16:85210682-85210704 CTGTGTAAGTTGAGGCTGGGAGG + Intergenic
1143090941 17:4448873-4448895 CTGGAGAATGTGATGCTGGATGG + Intronic
1143370791 17:6437798-6437820 CTGTTTAGGGTGAGGGTGGTGGG - Intergenic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1144705547 17:17365386-17365408 CTGTGTGAGGTGAGCCAGGAGGG - Intergenic
1145043844 17:19596820-19596842 CTGTTTAAGCTGAGACTTGAAGG + Intergenic
1146953374 17:36921649-36921671 CTGTGGAAGGTGAGGCTTGGCGG - Intergenic
1148074816 17:44929148-44929170 CTGTCTGGGGTGAGGCAGGAGGG - Intronic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149688239 17:58551339-58551361 CTGTTGAATGTGAGACTGGATGG + Intergenic
1152829423 17:82488047-82488069 CTGTACCAGGAGTGGCTGGAGGG + Exonic
1152962135 18:86384-86406 CTTCATCAGGTGAGGGTGGAGGG - Intergenic
1158844645 18:61428860-61428882 CTGTATCAGGAATGGCTGGAGGG - Intronic
1160006577 18:75073083-75073105 CTGGATATGGGGAGGCTGGTGGG + Intergenic
1160719829 19:592233-592255 CTGTCGAAGGTCATGCTGGAGGG - Intronic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1163015420 19:14451404-14451426 CTGTGGAAGGTGGGGCTGGCTGG - Intronic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1164455612 19:28404138-28404160 GTGTACATGGGGAGGCTGGATGG + Intergenic
1165833740 19:38742543-38742565 CAGGATTAGGTGAGGATGGAAGG + Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166870027 19:45865326-45865348 TTGTCTGAGGTGAGACTGGATGG - Intronic
1168608881 19:57783018-57783040 CTGTATAAGGCCAGGCTTGGTGG + Intronic
929288201 2:40159982-40160004 CTGTAGAAGATGAGCCTGGAGGG + Intronic
929435877 2:41927924-41927946 CTTTAGAAGGATAGGCTGGAGGG + Intergenic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930233373 2:48865307-48865329 CAGTCAAAGGAGAGGCTGGAGGG + Intergenic
931075764 2:58709853-58709875 CTGTCTAAGGTGGTGCTGCAGGG + Intergenic
931723498 2:65085396-65085418 CTGAATAAGGTGAGACTAAAGGG + Exonic
932635728 2:73386184-73386206 CTGGAGAAGGTGAGGCGGGCCGG + Exonic
935390846 2:102551194-102551216 CTTTATAAGGGGAGGCAGCAGGG + Intergenic
935904055 2:107824347-107824369 CTGAACAAAATGAGGCTGGAAGG - Intergenic
936678522 2:114743715-114743737 CTGTAAAAGGTGAGGTTGTAAGG + Intronic
938172172 2:129088842-129088864 CTGGAAAATGTGAGGCTGGGAGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
939047050 2:137262028-137262050 CTGTAAAAGCTGAGGATGCAAGG + Intronic
939365588 2:141226275-141226297 ATGTATTAGGTAAAGCTGGATGG - Intronic
940378301 2:152983457-152983479 ATGTATATGGGGAGGTTGGAGGG + Intergenic
943792159 2:191945360-191945382 CTGTCCACGGTGAGGCTGGAAGG + Intergenic
948217715 2:236244241-236244263 CTATATGAGCAGAGGCTGGAGGG + Intronic
949065598 2:241988371-241988393 CTCTCTAAGGCGAGGCAGGAGGG + Intergenic
1168861629 20:1049819-1049841 CCTTCTAAGGTGAGACTGGAAGG - Intergenic
1169210630 20:3764488-3764510 CTGTCGAAGGTGTGGCTGGGAGG - Intronic
1170614098 20:17935212-17935234 CTGGAACAGGTGTGGCTGGATGG + Intergenic
1172096228 20:32461892-32461914 CTGTATTGGGTGGGCCTGGATGG + Intronic
1172679451 20:36701247-36701269 CTTTTTAAGGTCAGGCAGGATGG + Intronic
1173524270 20:43720062-43720084 CCAGATCAGGTGAGGCTGGATGG - Intergenic
1173619800 20:44428368-44428390 CTGCATCAGGTGAGGGTGCAGGG - Exonic
1173866828 20:46317730-46317752 CTCTGCAAGGTGAGGCTGGTGGG - Intergenic
1173927567 20:46792199-46792221 CCAGATAAGGTGAGGCGGGAGGG - Intergenic
1177099731 21:16885430-16885452 CTGTTTCAGCTGAAGCTGGATGG + Intergenic
1178149648 21:29779614-29779636 CTATATAAGGGGAGGCTTTATGG + Intronic
1178282026 21:31291910-31291932 CTGAAGAAGGAGAGTCTGGAAGG - Intronic
1179339082 21:40487455-40487477 TTGCATGAGGTGAGGCTGGAGGG + Intronic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1183002417 22:34872424-34872446 GTGTTCAAGGAGAGGCTGGATGG - Intergenic
1183680350 22:39325017-39325039 CTGGATTAGGAGAGGATGGAAGG + Intergenic
1183933644 22:41249715-41249737 CTGCTCAAGGTGAGGCCGGAAGG - Exonic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184236355 22:43185340-43185362 CGGCCTAAGGTGAGGCAGGAGGG + Intronic
1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG + Intronic
949310773 3:2695414-2695436 CTGAAAAAGGTGAGGCTTGGGGG - Intronic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952728564 3:36615554-36615576 TTGTATAAGGTGAGGATTAAGGG + Intergenic
952901076 3:38112089-38112111 CTGACCAAGGAGAGGCTGGAGGG + Intronic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
959712936 3:109402810-109402832 CTCTATAAGGTTAGGCAGGTTGG - Intergenic
961032480 3:123618588-123618610 ATGAATAGGGTGTGGCTGGATGG - Intronic
962485793 3:135841055-135841077 CAGTATGGGGTGAGGGTGGAGGG - Intergenic
962708487 3:138067054-138067076 CTGGATTTGGGGAGGCTGGAGGG + Intronic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
963641469 3:147865689-147865711 TTTTATAAGGTCATGCTGGAGGG - Intergenic
964389815 3:156185330-156185352 TTGGAGATGGTGAGGCTGGAAGG - Intronic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
967546153 3:190731262-190731284 CTGAAGGAGGTGAGGCTGTAGGG + Intergenic
969462695 4:7337149-7337171 TTGCAGAAGGTGGGGCTGGAAGG + Intronic
972228336 4:37041134-37041156 CTGAATTATGTGAGGCTGGATGG - Intergenic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
975251687 4:72186799-72186821 TTGTATAAAGTGAGGCCAGAAGG - Intergenic
979190218 4:117847980-117848002 CTGTATAATCTGAGTCTGGGTGG + Intergenic
979708300 4:123747600-123747622 CTGCATATGGTGGTGCTGGAAGG + Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
985800636 5:2003538-2003560 CAGTGTAGGGTGAGGCTGGGAGG + Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
999015036 5:148093412-148093434 CTGTCTAAGGTGAGGGTGAAAGG + Intronic
999719953 5:154392207-154392229 CTATATAAGCTGAGATTGGAAGG - Intronic
999780644 5:154847387-154847409 GGGAATAAGGTGAGGCTGGAAGG + Intronic
1002740693 5:181433249-181433271 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1002853316 6:1015880-1015902 CTGTATAAGGGGTGGCTGCAGGG + Intergenic
1004116514 6:12773420-12773442 GTGAATCAGGTGAGGCTAGATGG - Intronic
1007910656 6:45510864-45510886 CTGTAAAAGGTGAGGAAGGAGGG - Intronic
1010186913 6:73155537-73155559 CATTATAAGATGAGGCTGAATGG + Intronic
1012135774 6:95554090-95554112 CAGAATAGGGTGAGGGTGGAGGG - Intergenic
1013130326 6:107226590-107226612 TGGTAGAAAGTGAGGCTGGAGGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013779044 6:113710293-113710315 ATGTTTAAGGTGGGGCTGAAAGG + Intergenic
1014761734 6:125363962-125363984 CTCTTTCAGGAGAGGCTGGAGGG + Intergenic
1016725129 6:147355409-147355431 TTGTATCAGGTGCAGCTGGATGG + Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1019245803 6:170708845-170708867 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1020855523 7:13416731-13416753 GTGTATCACGTGATGCTGGATGG + Intergenic
1021820073 7:24488081-24488103 CTGTATGAGATGAGGTTGGTGGG - Intergenic
1021827316 7:24568369-24568391 CTGTTTGAGGTGAGGCAGAAAGG + Intergenic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1023986363 7:45099458-45099480 GTCTCTAAGGAGAGGCTGGAAGG + Intergenic
1026158423 7:67847930-67847952 CTGTCTGATGTGGGGCTGGAAGG - Intergenic
1028506621 7:91578655-91578677 CTGTGTCAGATGAAGCTGGAGGG - Intergenic
1031932603 7:127701315-127701337 CTGTTAATGGTGAGGCTGGTGGG + Exonic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1033375363 7:140756359-140756381 CTGTAGAATGAAAGGCTGGAAGG + Intronic
1035095662 7:156352735-156352757 CTGTACTAGATGAGGCAGGATGG - Intergenic
1035502321 8:99353-99375 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
1035520324 8:271012-271034 CTCTGTGTGGTGAGGCTGGAGGG - Intergenic
1035635244 8:1139301-1139323 CTGTCTCAGCTGAGGCTGCAGGG + Intergenic
1035653995 8:1291813-1291835 CAGTACAAAGTGTGGCTGGAGGG - Intergenic
1035902240 8:3469727-3469749 CTGCCTAAGGTGAGGATGTAGGG - Intronic
1035946511 8:3969280-3969302 CTGCAAAAGATGAGGCTGGGTGG + Intronic
1038561891 8:28588031-28588053 CTGTACAAGGTCATGCTAGAAGG + Intergenic
1039080735 8:33731777-33731799 GTGTATATGTTGAGGCTGTAGGG + Intergenic
1040139350 8:43892811-43892833 CTTCATAAGCTGAGGCTGTATGG + Intergenic
1041820910 8:62031953-62031975 TTTTATAAGGTCATGCTGGAAGG + Intergenic
1041974795 8:63785209-63785231 CTGCATTTGGTGAGGCAGGAGGG + Intergenic
1044507188 8:93035726-93035748 CTGTGCAAAGTGAGGTTGGAGGG - Intergenic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1046270909 8:111896983-111897005 CTGTAAAAGGTTTGGCTGTAGGG - Intergenic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1050360620 9:4827363-4827385 CTGTGGTAGCTGAGGCTGGAGGG + Intronic
1050802045 9:9627536-9627558 CTCTGTAAGGTGGGGCTGGAGGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1053063048 9:35046156-35046178 CTCTATAGGGTGAGGCTACAGGG + Intergenic
1053314686 9:37041351-37041373 CTGGAAAGGGGGAGGCTGGAGGG + Intergenic
1053524359 9:38813596-38813618 CTTTGTAAGGTGAGGCAGAAAGG - Intergenic
1054196593 9:62038005-62038027 CTTTGTAAGGTGAGGCAGAAAGG - Intergenic
1054641812 9:67550680-67550702 CTTTGTAAGGTGAGGCAGAAAGG + Intergenic
1055111721 9:72566500-72566522 CTGTTTCAGGTGGGGTTGGAGGG + Intronic
1056191689 9:84190541-84190563 CAGTATGAGATGAGGGTGGAAGG - Intergenic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1059116513 9:111604568-111604590 GGGTAGAAGGAGAGGCTGGAAGG - Intergenic
1060205435 9:121680163-121680185 GTGTAGGAGGTGAGGCTGGGAGG + Intronic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1061851289 9:133417606-133417628 CTGCAAGAGGTGAGGCTTGAGGG - Exonic
1061930277 9:133828822-133828844 GTGTGGAAGGCGAGGCTGGAGGG - Intronic
1062423711 9:136496596-136496618 CTGCACCAGGTGAGGCTGGGTGG + Exonic
1062480324 9:136748036-136748058 CTGTAGAACTGGAGGCTGGAGGG - Intronic
1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG + Intergenic
1203606001 Un_KI270748v1:58056-58078 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1187270753 X:17777025-17777047 ATCTATAAAGTGAGGCTGGGAGG + Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187733184 X:22277572-22277594 CTGTAAAACGTGAGGCAGGAAGG - Intergenic
1188596413 X:31906803-31906825 AAGTAGAAGGTGAGGTTGGAGGG - Intronic
1189701148 X:43717022-43717044 GTGGTTAAGGTGAGGCAGGATGG + Intronic
1190056706 X:47185419-47185441 CTGTAGAGGGTGAGGGTGGGCGG - Intronic
1191871597 X:65751021-65751043 TTTTATAAGGTCATGCTGGAGGG - Intergenic
1200886508 Y:8277584-8277606 CAGGATCAGTTGAGGCTGGATGG - Intergenic
1202388168 Y:24344493-24344515 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1202482619 Y:25325635-25325657 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic