ID: 919781256

View in Genome Browser
Species Human (GRCh38)
Location 1:201222651-201222673
Sequence CCCCTCCAGCCCTACCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919781252_919781256 -6 Left 919781252 1:201222634-201222656 CCGACTGGCCCAGTCTTCCCCTC 0: 1
1: 0
2: 2
3: 26
4: 298
Right 919781256 1:201222651-201222673 CCCCTCCAGCCCTACCTTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 270
919781250_919781256 21 Left 919781250 1:201222607-201222629 CCAGTATGTTGGGATCTCAGCAT 0: 1
1: 0
2: 0
3: 7
4: 109
Right 919781256 1:201222651-201222673 CCCCTCCAGCCCTACCTTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 270
919781249_919781256 22 Left 919781249 1:201222606-201222628 CCCAGTATGTTGGGATCTCAGCA 0: 1
1: 0
2: 1
3: 11
4: 140
Right 919781256 1:201222651-201222673 CCCCTCCAGCCCTACCTTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 270
919781248_919781256 23 Left 919781248 1:201222605-201222627 CCCCAGTATGTTGGGATCTCAGC 0: 1
1: 0
2: 1
3: 9
4: 111
Right 919781256 1:201222651-201222673 CCCCTCCAGCCCTACCTTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919781256 Original CRISPR CCCCTCCAGCCCTACCTTGC TGG Intronic
900108389 1:995829-995851 CACCCCCATCCCTAACTTGCCGG + Intergenic
900189582 1:1347746-1347768 CCCCTCCTGCCCAACCTGACCGG + Intronic
900226035 1:1534115-1534137 CCCTCCCACCCCTGCCTTGCCGG + Exonic
900614241 1:3557427-3557449 CCCCTCCAGGCCAGCCTGGCCGG - Intronic
900732644 1:4272318-4272340 CCCCTCCGGTCCTACCTCCCAGG - Intergenic
900761444 1:4474238-4474260 ACCCTCCCACCCTACCCTGCAGG - Intergenic
900945818 1:5830866-5830888 TCCCTCCACCCCTCCCTCGCTGG + Intergenic
901013965 1:6217226-6217248 CCTCTCCAGCCGTTCCTTCCTGG + Intronic
901087457 1:6620114-6620136 CCCCACGAGTCCCACCTTGCAGG + Exonic
901174453 1:7288744-7288766 CTGCTCCAGCCCTAGCTTTCTGG - Intronic
901646654 1:10720514-10720536 CCCCTCCAGCCTTACAGTCCAGG - Intronic
901647678 1:10725341-10725363 CCCCTCCCGCCCTCCCTCTCCGG + Intronic
901934784 1:12619652-12619674 CCCCTCCTGCACTTCCTGGCTGG - Intergenic
902396687 1:16135745-16135767 GCCCTCCAGCCTCACCTTGGGGG + Exonic
902410533 1:16209011-16209033 ACCCTCCAGCCCCACCTGACTGG - Exonic
902478906 1:16701579-16701601 CCCCTGCAGCCCTACCCGCCCGG + Intergenic
902627767 1:17686690-17686712 CCACTCCTGCCCTTCCTTGTGGG - Intronic
904616679 1:31753795-31753817 TCCCTCCTGCCCAACCTTTCTGG - Intronic
905394212 1:37656963-37656985 CCCTGGCAGCCCTGCCTTGCAGG + Intergenic
905452897 1:38068439-38068461 TCCCACCAGCCCTCCCCTGCAGG - Intergenic
905774641 1:40660753-40660775 CCCCTCCCTCCCTACCTCCCGGG - Intronic
905824885 1:41020135-41020157 CCCCTCCATCCCCACTCTGCAGG + Intronic
905880122 1:41457755-41457777 CCTCTCCAGCTCTTACTTGCAGG + Intergenic
907513722 1:54980572-54980594 CCCCGCCAGCCCAATCGTGCTGG + Intergenic
907907626 1:58798853-58798875 CCACTCCAGCCCCATCATGCTGG - Intergenic
907918544 1:58892714-58892736 TCCCTCCACCCCTATCTTTCTGG - Intergenic
911184032 1:94885984-94886006 CCCCTCCACCCCCACCTCGGTGG - Intronic
911514599 1:98851835-98851857 CCTCTCCAGCCCTCCCTCCCAGG + Intergenic
912567012 1:110594830-110594852 CCTTTCCAGCCCCACCTGGCAGG + Intronic
914400807 1:147318265-147318287 CACCACCAGGCCTGCCTTGCAGG + Intergenic
916188330 1:162154534-162154556 CCCCTCCAGCCCTACCTAGAAGG - Intronic
917305416 1:173619100-173619122 CACCACCAGCCCTGCCTTGCAGG + Intronic
917455977 1:175186408-175186430 ACCCTCAGGCCCTACCTTGAAGG + Intronic
919191849 1:194230693-194230715 GCCCTCCTCCCCTACCTTGCAGG - Intergenic
919781256 1:201222651-201222673 CCCCTCCAGCCCTACCTTGCTGG + Intronic
920357052 1:205381553-205381575 AGCCTGCAGCCCTCCCTTGCAGG - Exonic
922574408 1:226652499-226652521 CCCCTCCAGCCCTCCCTTGTGGG + Intronic
922769633 1:228175022-228175044 CCACCCCACCCATACCTTGCAGG - Exonic
923997259 1:239509480-239509502 CAACTCCAGCTCTACCTTGAGGG - Intronic
1070427457 10:76303463-76303485 CCCGTCCAGCGCTCACTTGCTGG + Intronic
1070602838 10:77877777-77877799 CCCCTCCACCCCCACCTTCCAGG - Intronic
1070813880 10:79311538-79311560 TCCCTCCAGCCCTCCCTGCCCGG - Intronic
1070903357 10:80050135-80050157 CACCTAGAGCCCTACCATGCAGG + Intergenic
1073729187 10:106270025-106270047 TCCCTCCAGCCCTGCCTCACTGG + Intergenic
1074421695 10:113314872-113314894 CCCATCCATCCATTCCTTGCTGG + Intergenic
1074501631 10:114030141-114030163 CCCCTGCAACTCTACCCTGCAGG - Intergenic
1075053226 10:119198759-119198781 CCCCTCCAGCCCTAGCTCCAGGG + Intergenic
1075073768 10:119336650-119336672 CCCCTTCAGGCCTGCCTGGCTGG + Intronic
1075375198 10:121973295-121973317 CCCCTCCAGCCCTCTCTGACGGG - Intronic
1076574257 10:131453510-131453532 CCACTGCAGCCCCGCCTTGCAGG - Intergenic
1076841338 10:133047336-133047358 CCCCTCCAGTCACACCTTTCCGG + Intergenic
1077026391 11:441821-441843 CCCCGCCAGCCCCACCTGGAAGG - Intronic
1077218073 11:1403374-1403396 CCCCACCAGGGCTACCCTGCTGG + Intronic
1077343966 11:2037961-2037983 CCCCTCCAGCTCTACCAAGGAGG + Intergenic
1077407003 11:2387137-2387159 CACCCCCAGCCCTCCCTGGCTGG - Intronic
1078340875 11:10497230-10497252 CCTTTCCAGCCCCACCTGGCAGG - Intronic
1079691094 11:23417987-23418009 CCCCTCCAGCCTCTCATTGCAGG - Intergenic
1083855271 11:65390142-65390164 AGCCTCCAGCCCTGCCTGGCTGG + Intronic
1083885164 11:65569973-65569995 CCCCTCCTGGCCAGCCTTGCCGG + Intergenic
1084516343 11:69639630-69639652 CCCCCCCACCCCCACCTTTCAGG - Intergenic
1085402189 11:76241757-76241779 CCACTCCAGGCCTTCCTTCCAGG + Intergenic
1085769482 11:79312006-79312028 CCGCACCAGCCCTGCCTTGGAGG - Intronic
1089498228 11:118918493-118918515 CCCCACCCGCCCCACCCTGCGGG - Intronic
1089639773 11:119839991-119840013 GCCCTCCAGCCCCAGCTTCCAGG + Intergenic
1089810724 11:121129277-121129299 CCCCTCCTTCCCTGCCTTTCTGG - Intronic
1202826952 11_KI270721v1_random:93150-93172 CCCCTCCAGCTCTACCAAGGAGG + Intergenic
1091815225 12:3432556-3432578 TCCCTCCAGCCCTTCCTGCCTGG - Intronic
1091980163 12:4858243-4858265 CCAGCCCAGCCCTCCCTTGCTGG - Intergenic
1092183711 12:6463322-6463344 ACCCACCAGCCCCACCTTGGGGG - Intronic
1096072383 12:48782540-48782562 GCCCTCCATCCCTACCTCCCTGG + Intronic
1097233670 12:57526334-57526356 CCCATCCAGCCCTCCCTGCCTGG + Exonic
1102234863 12:111287925-111287947 CCCTTCCACCCCTACCCTGCTGG - Intronic
1102572609 12:113836207-113836229 CACCTCCCTCCCTTCCTTGCTGG - Intronic
1102644175 12:114393229-114393251 CCCCTCCACCCCAGCCTTGCTGG + Intronic
1106454192 13:29912156-29912178 TCCCCCCAGCCCTTCCTTCCAGG - Intergenic
1107390896 13:39963010-39963032 CCCCTCCATGCCTTCCTTGTTGG + Intergenic
1108567664 13:51716996-51717018 CCCCTCTAGTCCTAGTTTGCTGG - Intronic
1111348936 13:87000325-87000347 CCCCTCAACCCCTACCTCCCAGG - Intergenic
1114269065 14:21090548-21090570 CCCCCCCAGCCCTGCCTCTCCGG + Exonic
1118558447 14:67051924-67051946 CACCACCAGGCCTGCCTTGCAGG + Intronic
1119659097 14:76437877-76437899 CCCCTCCACCCCGGCCATGCTGG - Intronic
1119765451 14:77184795-77184817 CTCCTGTAACCCTACCTTGCAGG - Intronic
1121259208 14:92553889-92553911 CCCCTACAGCCCTGCCTTCAGGG + Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1124013609 15:25859186-25859208 CTCCTCCAGCCCTGCCCAGCAGG + Intronic
1128736939 15:70058710-70058732 CCCCACCAGCCCTGCCTCGGTGG - Exonic
1129426825 15:75469462-75469484 CCCATCCAGCCCTCCCTGGAGGG - Intronic
1129542061 15:76358496-76358518 CCTCACCAGCCCCACCATGCTGG - Intronic
1129705246 15:77790613-77790635 TCCCTCCACCCCTGCCTTCCTGG - Intronic
1129883167 15:79020165-79020187 CCCCTCCAACCCTATCATCCAGG - Intronic
1130098152 15:80871553-80871575 TCCCTCCTGCCCTAACTTGTTGG - Intronic
1131265452 15:90912689-90912711 CCCCTCCTGCCCTCCCTGCCAGG - Intronic
1133000848 16:2850694-2850716 CCTCTCCAGCCCTCCTTTGCTGG - Intergenic
1134073940 16:11277473-11277495 CCCCTCCCGCTCGGCCTTGCCGG + Intronic
1134134769 16:11671013-11671035 CCCCAGCAGCCCAAGCTTGCAGG - Intronic
1137743588 16:50804373-50804395 CCCCTCAGGCCTTGCCTTGCAGG + Intergenic
1138098465 16:54232181-54232203 CCCATCCATCCCTGCCTTGGAGG - Intergenic
1138715871 16:59021510-59021532 ACCCTCCAGCCCCTCCCTGCTGG - Intergenic
1140034889 16:71364472-71364494 CCTCTCCAGCCCCAGCCTGCCGG + Intronic
1140270815 16:73464948-73464970 CCCCTCCCGCCCAGCCTTGGTGG - Intergenic
1140547030 16:75820724-75820746 GAACTCCAGCCCTTCCTTGCAGG - Intergenic
1141944138 16:87298051-87298073 CCCCTCCAGCCCTGGCCTTCTGG + Intronic
1142215368 16:88827129-88827151 CCCCTCCAGGCCCACCTGTCCGG + Intronic
1142603374 17:1068365-1068387 TCCCTTCAGCCCTCCCTGGCTGG - Intronic
1142756383 17:2018773-2018795 CACCTCCACCCCCACCCTGCAGG - Intronic
1142766161 17:2065390-2065412 CTCCTTCAGCCCTTCCTTCCTGG + Intronic
1143247719 17:5500366-5500388 CGCCTCCACCCCTAACCTGCAGG + Intronic
1145973078 17:28968340-28968362 CTCTTCCAGCCCTTCCTTGGAGG + Intronic
1146501732 17:33370482-33370504 CCCCTCCAGCCTTTGCTTGCAGG - Intronic
1146817163 17:35951975-35951997 CACCACCAGGCCTGCCTTGCAGG - Intergenic
1147042558 17:37729978-37730000 TCCCTCCAGCCCTAGCTCTCTGG + Intronic
1148540570 17:48477244-48477266 CCACTCCATTCCCACCTTGCTGG + Intergenic
1148876517 17:50690486-50690508 CCCCTCCTGCCGTACCCTGGTGG + Intronic
1149446684 17:56718636-56718658 CCTCTCCAGCCCTAGCTGGAGGG - Intergenic
1149901891 17:60487989-60488011 CCACTCCAGACCTTACTTGCTGG + Intronic
1151242823 17:72771503-72771525 GCCCTCCAGGCTCACCTTGCAGG + Intronic
1151730966 17:75910806-75910828 CCCATCCAAACCTGCCTTGCAGG - Exonic
1151802368 17:76385667-76385689 CCCCTACAGCCCTTCCCAGCAGG - Intronic
1151984727 17:77534924-77534946 CCCCTCCCGCCATAACTTTCTGG - Intergenic
1152246676 17:79188185-79188207 CCCCAGCAGCCCTTCCTCGCAGG - Intronic
1152356188 17:79808783-79808805 TCCCTCCAGCCCCACACTGCTGG + Intergenic
1152591689 17:81216678-81216700 CCTGTCCTGCCCGACCTTGCGGG - Intronic
1152646842 17:81473128-81473150 CCCTCACAGCCCCACCTTGCAGG + Intergenic
1152687339 17:81701087-81701109 CCCCAGCAGCCCTACATCGCGGG + Exonic
1156230547 18:35150374-35150396 CACCACCAGGCCTGCCTTGCAGG - Intergenic
1156498289 18:37540490-37540512 CCCCACCAGCCTGACCGTGCTGG - Intronic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1157307026 18:46524969-46524991 CCACTCCAGCCCCACCCTTCTGG + Intronic
1157468176 18:47966590-47966612 CTCCTTCAACCCTACCTTCCTGG + Intergenic
1158301609 18:56058748-56058770 CACATCCAGCCTTACCTTCCTGG + Intergenic
1160680106 19:408495-408517 CCCCTCCACCCCCACCCCGCCGG - Intronic
1160824704 19:1074257-1074279 TCCCTCCAGACCCACCCTGCTGG - Intronic
1160898081 19:1412194-1412216 CCCCTCCAGCCCACGCCTGCAGG - Intronic
1160898584 19:1415214-1415236 CCCCTCCACCCCCACCTCACTGG - Intronic
1162018669 19:7858776-7858798 CCCCCTCAGCCCCACCCTGCTGG - Intronic
1162530460 19:11233188-11233210 CCCCCGTTGCCCTACCTTGCTGG + Exonic
1162906754 19:13828623-13828645 TCTCCCCACCCCTACCTTGCAGG + Exonic
1163082962 19:14956741-14956763 TCCCTCCTGACCTCCCTTGCAGG + Intronic
1165159819 19:33809487-33809509 CCCCACCAGCTCTCCCATGCAGG - Intronic
1165962488 19:39547001-39547023 ACTCTCTAGCCCTACCTTGCAGG + Intergenic
1166906745 19:46115845-46115867 CCACTCCAGCCCCTCATTGCAGG + Intergenic
1167467789 19:49659217-49659239 CCCCTCCAGCCCCACGTGGAGGG + Intergenic
1167478181 19:49712909-49712931 CCCCTCCACCCCCACTATGCAGG - Intronic
1167504501 19:49863949-49863971 CCCTTCCAGCCATACCTGGAAGG + Exonic
1167574603 19:50312107-50312129 CCCCTCCCTCCCTGCCCTGCGGG + Intronic
1168056390 19:53867393-53867415 CGCCCCCACCCCTTCCTTGCCGG - Intronic
1202712947 1_KI270714v1_random:27486-27508 CCCCTGCAGCCCTACCCGCCCGG + Intergenic
925297754 2:2789475-2789497 ACACTCAAGCCCTACCTTTCCGG - Intergenic
925388864 2:3482325-3482347 CCCCTGCAGCTCTGCTTTGCCGG - Intronic
929604560 2:43226162-43226184 CCCCTCCCGCCCTGCCTTTCAGG - Intronic
930021441 2:47004326-47004348 TCCCTCCAGCCCTGCGCTGCAGG + Intronic
930566184 2:53023371-53023393 CCCCTGCAGCCATTCCTTTCAGG + Intergenic
931193529 2:60028309-60028331 CCCTTCCAGCCCTGCTTTCCAGG + Intergenic
932397762 2:71459931-71459953 CCCCTCAAGCCCTTCCTTCCAGG + Intronic
934544763 2:95205788-95205810 CCCCACCAGCCCTAGCTGCCTGG + Intergenic
935076385 2:99748436-99748458 CACCTCCACCGCTAACTTGCTGG - Intronic
936004273 2:108868561-108868583 CTCCTCCAGCCTTTCATTGCTGG + Intronic
939839790 2:147173130-147173152 CCTGCCCAGCCCTGCCTTGCTGG + Intergenic
940638531 2:156326101-156326123 CCCCTCCAGAACTGCCTAGCAGG - Intronic
945428163 2:209733383-209733405 CTTCTCCAGCCGTACCTAGCTGG - Exonic
946027337 2:216679723-216679745 CCCCTCCGGGCCTACATTTCTGG - Intronic
946366967 2:219254324-219254346 CCCTTCCAGCCCTGCCTCCCAGG + Intronic
947635799 2:231680354-231680376 CCACTCCAACCCCACCTTTCTGG - Intergenic
947699241 2:232218566-232218588 CCCCTCCAGCTCTCCCTCCCAGG - Intronic
947859668 2:233349555-233349577 CTTCTCCAGCCCTTCATTGCTGG - Intergenic
948273038 2:236688413-236688435 CCCCTCCCACCCTCCCTTGGAGG + Intergenic
948364522 2:237446105-237446127 TCCCGCTAGCCCCACCTTGCCGG + Intergenic
1168808045 20:684431-684453 CCCCTACAGCCCTACTTAGCAGG - Intergenic
1169025679 20:2369175-2369197 CCACCCCATCCCTCCCTTGCTGG + Intergenic
1169732574 20:8802166-8802188 CCCATCCAGTCCTACCTGGCCGG - Intronic
1172529711 20:35621455-35621477 CCCCTCCACCGGTACCTAGCAGG - Intergenic
1173501377 20:43556563-43556585 CCCCTCCCACCCTCCCTGGCTGG - Intronic
1173605731 20:44330050-44330072 CCTCTCCAACCCCGCCTTGCTGG + Intergenic
1173665110 20:44757629-44757651 GACCTCCACCCCCACCTTGCAGG + Intronic
1174920042 20:54692161-54692183 CCCCTCAACCCCTCCCTGGCAGG + Intergenic
1175806063 20:61830046-61830068 CCCCCACAGCCCTACCTTCATGG + Intronic
1176199961 20:63855676-63855698 CACCCCCAGCCCTTCCTTCCTGG - Intergenic
1178237448 21:30859027-30859049 TACCTCCAGCTCTACCTGGCAGG - Intergenic
1179553571 21:42158907-42158929 CCCCGCCAGCCTCACCTTCCCGG + Intergenic
1179924312 21:44525638-44525660 CCACTCCTGCCCTACCTTCCCGG + Exonic
1179986170 21:44921375-44921397 CCCCTCCCGCCCTCACATGCAGG - Intronic
1180011025 21:45051633-45051655 TCCCTCCGGCCCTACCGTGGGGG - Intergenic
1180042634 21:45288005-45288027 CCCCTCCCGCCCCTGCTTGCCGG - Intergenic
1181085854 22:20439007-20439029 CTCCTCCAGCCCCACCCTTCGGG - Intronic
1181556697 22:23675437-23675459 CCCCTGCAGCCCTCACTTCCTGG - Intergenic
1181697135 22:24599398-24599420 CCCCCCTTGTCCTACCTTGCTGG - Intronic
1181697690 22:24602148-24602170 CCCCTGCAGCCCTCACTTCCTGG + Intronic
1181733904 22:24867153-24867175 CCCCACAGTCCCTACCTTGCTGG - Exonic
1181980410 22:26761995-26762017 CCACTCCTGCCCTCCCTTTCGGG - Intergenic
1182096123 22:27627156-27627178 CCTCTCCCTCCCTACCCTGCTGG - Intergenic
1182109293 22:27711421-27711443 CCCCTCCAAGCCTGCCTTGCTGG - Intergenic
1182419230 22:30240839-30240861 CCAGTCCAGCTCTGCCTTGCCGG - Exonic
1182778311 22:32847464-32847486 CCCCTTCAGACCTTCCCTGCCGG - Intronic
1183201111 22:36386727-36386749 CACCCCCAGCACTAGCTTGCCGG - Intronic
1183531108 22:38353829-38353851 CCTCTCCATCCCTCCCTTGCAGG + Intronic
1184164838 22:42720938-42720960 CCCGTCCCGACCTACCCTGCGGG + Intronic
1184639105 22:45859612-45859634 CTCCTCCAGCCCTCCCTCTCTGG + Intergenic
1185335522 22:50269542-50269564 CCCCTCCAGCCCTGGCTACCCGG + Intronic
1185402482 22:50626098-50626120 CCCCACCACCCCAACCTTGATGG - Intronic
950104744 3:10380935-10380957 TCCCTCCTGCCCCACCTTGCAGG - Intronic
950303428 3:11900919-11900941 CCCCCACAGCCCTTCCTTTCTGG + Intergenic
950497595 3:13343303-13343325 CACCTCCGCCCCAACCTTGCAGG - Exonic
950668925 3:14513681-14513703 CACCTCCAGCACGACCTTGTGGG + Exonic
950748285 3:15108196-15108218 CCCCTCCAGTTCTAGCTTGTGGG + Intergenic
951916721 3:27808756-27808778 CCACTCCAGCCCTTCCTAGTTGG - Intergenic
953389469 3:42526126-42526148 CTCCTCCAGGCCTGCCTTTCTGG + Intronic
954538738 3:51380173-51380195 CCCCCCCAGCCCTCCCTGCCCGG + Exonic
954966159 3:54612874-54612896 CCCCCACAGTCCTACATTGCTGG + Intronic
956322006 3:68007855-68007877 GCCCTCCAGCAATACCTTCCGGG + Intronic
956539082 3:70314020-70314042 CATCTCCACCCCTACCTTGAAGG + Intergenic
961116230 3:124332377-124332399 CACCTCATTCCCTACCTTGCTGG + Intronic
961423597 3:126827792-126827814 CCACCCCTGCCCCACCTTGCTGG - Intronic
961821410 3:129577451-129577473 GCCCTCAAGCCCCACCCTGCAGG - Intronic
964071478 3:152638895-152638917 CCCCTTCAATCCTACCTGGCAGG - Intergenic
964110148 3:153079130-153079152 CCCCTCCAGCGCTGCCTAGGGGG + Intergenic
964905037 3:161709021-161709043 CACCACCAGGCCTACCTTACAGG + Intergenic
967313318 3:188127133-188127155 CACCTCCAGCCCCACCTGGCAGG + Intergenic
969073488 4:4558536-4558558 CTCCTGCAGCTCTGCCTTGCTGG + Intergenic
969726418 4:8920851-8920873 CCCCTCCAGCCCTCCCACTCAGG - Intergenic
981079300 4:140622754-140622776 CCGCTCCCGCCCTCCTTTGCAGG + Exonic
982065956 4:151654616-151654638 CCCCTCTAGATCTACCTTGAAGG + Intronic
985822673 5:2170604-2170626 CCCCTCCAGGCCTTCCTCCCAGG + Intergenic
985894647 5:2741009-2741031 CGCGTCCTGCCCCACCTTGCTGG + Intergenic
987216244 5:15740319-15740341 CCCCACCATCCATAACTTGCAGG - Intronic
993017589 5:82552475-82552497 TCCCTCCAGCTCTACGCTGCTGG - Intergenic
995396746 5:111694986-111695008 CCCCTCCAACCCCACCTCCCAGG - Intronic
999652678 5:153783009-153783031 CACCTCCAGCCTGACCCTGCTGG - Intronic
1001117859 5:168954719-168954741 CCCCTCCTGCCTTACCTGCCTGG - Intronic
1001775462 5:174326219-174326241 CCCCGCCACCCCTGGCTTGCAGG + Intergenic
1002194908 5:177496483-177496505 CCCCTCCAGCACTACTTTGAAGG + Exonic
1002759521 6:190951-190973 CCCCTCCCGTCCTACCTGGGAGG + Intergenic
1003645628 6:7910928-7910950 TCGCTCCAGCCCTTCCCTGCCGG - Intronic
1003977668 6:11359142-11359164 CCCCTCTAGCCTTTCCTTTCTGG - Intronic
1004204146 6:13575238-13575260 CCCCTCCAGCCCTGCCCCTCTGG - Intronic
1004426438 6:15510310-15510332 TCCCTGCACCCCTGCCTTGCGGG + Intronic
1006519276 6:34562130-34562152 ACCCTGCAGCCCTAGCTTGGGGG + Intergenic
1007397115 6:41584290-41584312 CCCAGCCAGGCCTACCTTGCAGG + Intronic
1007628972 6:43262294-43262316 ACCCTCCAGGCCTGCCTGGCTGG - Intronic
1007679355 6:43623824-43623846 ACCCACCAGCCCTACTTGGCAGG - Intronic
1011704784 6:89990040-89990062 ACACTCCAGCTCAACCTTGCGGG + Intronic
1013288100 6:108697922-108697944 ACCCTCAAGCCCTACCCTGTGGG - Intergenic
1018218100 6:161550522-161550544 TACCTCCAGCACTACCTTCCCGG - Intronic
1018402002 6:163432516-163432538 CCCCTGCAGTCCTACCTCTCTGG - Intronic
1018430718 6:163719569-163719591 CCTCTCCAGCCTCAGCTTGCAGG + Intergenic
1018767280 6:166944486-166944508 CCTCTCCTGCCCCACCATGCTGG + Intronic
1019165816 6:170097037-170097059 CCCCTGCTGCCCCACCTGGCAGG + Intergenic
1019485132 7:1285835-1285857 CCCCCCCAGCCCTGCCTTCCTGG + Intergenic
1019543277 7:1560883-1560905 CCCAGCCAGCCCTACCTGCCTGG + Intergenic
1020256640 7:6506153-6506175 CCGCTGCAGTCCCACCTTGCTGG - Intronic
1021914827 7:25421041-25421063 CCCCTCCAGCCCCACTGTTCTGG + Intergenic
1023059776 7:36316041-36316063 TCCCTCCATCCCTACCTTCCTGG - Intergenic
1029552412 7:101244493-101244515 CCCATCCTGCCCCACCCTGCCGG + Intronic
1030063153 7:105639118-105639140 CCCCTCCAGGGCTGCCTTTCAGG + Intronic
1032071084 7:128807409-128807431 CCGCTCCAGCTCGTCCTTGCTGG - Exonic
1033645706 7:143301927-143301949 CCCCTCCATGGCAACCTTGCTGG - Intronic
1034306714 7:150049321-150049343 CCCTTCCAGCCCTTCCCGGCCGG + Intergenic
1034800131 7:154051322-154051344 CCCTTCCAGCCCTTCCCGGCCGG - Intronic
1035243970 7:157550514-157550536 CCCCACCTGCCCTGCCTGGCTGG + Intronic
1035985508 8:4427129-4427151 CCTCACCACCCCTACCTGGCAGG - Intronic
1036186400 8:6626187-6626209 CCCCAGCTGCCCCACCTTGCTGG + Intronic
1037823752 8:22148380-22148402 GCCCTGCAGCCCTTCCTTGTGGG - Exonic
1038761902 8:30392174-30392196 CAGCTCCATCCCTTCCTTGCAGG - Intronic
1039792995 8:40890702-40890724 CCCCTCCCTCCCTACCTGGTGGG + Intronic
1040007038 8:42629486-42629508 CCCCTCCAGCAGTGCCTAGCAGG - Intergenic
1040414213 8:47182509-47182531 CCCCTCCAGGCCTTCCATGTGGG + Intergenic
1044878878 8:96701740-96701762 CCCCTCCTGCCAAACTTTGCAGG - Intronic
1045254804 8:100510385-100510407 CCTCTCCAGTCCTGCCCTGCAGG - Exonic
1047432014 8:124800871-124800893 CTCCTCCATCCCTCCCTTGGTGG + Intergenic
1049062469 8:140286746-140286768 CACCTCCAGCCCTTCCCAGCTGG - Intronic
1049424581 8:142532406-142532428 CCCCTGCAGCCCAGCCTCGCTGG - Intronic
1049462266 8:142735661-142735683 CCCATCCATCCCCACCTTGAGGG - Exonic
1049480957 8:142822376-142822398 CCTCTACACACCTACCTTGCTGG - Intergenic
1049564822 8:143332517-143332539 CCCCAACAGCACTACCTGGCTGG - Intronic
1055522637 9:77097177-77097199 CCCCACAAGTCCTTCCTTGCTGG + Intergenic
1055643140 9:78336617-78336639 CACCACCAGGCCTACCTTACAGG + Intergenic
1058835351 9:108855005-108855027 CTCTTCCAGCCCTCCCTGGCAGG - Exonic
1059395876 9:114033707-114033729 CCCCTCCTGCCCTGCCTCTCAGG - Intronic
1060586623 9:124790629-124790651 CTCCTCCAGCCCCACCTGCCGGG - Intronic
1061005173 9:127924831-127924853 CCCCTCCTGCCCTACCAGCCAGG + Intronic
1061207092 9:129171089-129171111 CCACTCCAGCCCTATCCTGCTGG + Intergenic
1061993983 9:134174877-134174899 CCCCAACAGCCCTACCAAGCAGG - Intergenic
1062152758 9:135030364-135030386 CTCCCCCAGGCCTGCCTTGCTGG - Intergenic
1062519575 9:136952085-136952107 CCCCTCCTACCCCACCTGGCTGG + Intronic
1062534130 9:137014153-137014175 CCCTGCCACCCCCACCTTGCAGG + Exonic
1188020495 X:25151698-25151720 CCCCTCCCCCCCCACCTTTCTGG - Intergenic
1189074736 X:37904285-37904307 TTCCTCGAACCCTACCTTGCAGG - Intronic
1191690591 X:63934208-63934230 TTCCTCCAGCCCTACCTCTCTGG + Intergenic
1191791445 X:64976273-64976295 CCTCTCCAACCCTTCGTTGCGGG - Intronic
1192633992 X:72801393-72801415 CCCCTCCAGCCCTATCCCACGGG - Intronic
1192647718 X:72919408-72919430 CCCCTCCAGCCCTATCCCACGGG + Intronic
1195751470 X:108164730-108164752 CCCTACCACCCCTACCATGCCGG - Intronic
1197564139 X:128060400-128060422 CACCACCAGGCCTGCCTTGCAGG + Intergenic
1198512146 X:137362903-137362925 CCCATCCAGCCATGCCATGCGGG + Intergenic
1199760061 X:150898507-150898529 CCCCGCCCGCCTTACCTCGCTGG + Exonic
1199907686 X:152251083-152251105 TCCCTCCAGGCCCACCTTCCTGG + Intronic