ID: 919782156

View in Genome Browser
Species Human (GRCh38)
Location 1:201228156-201228178
Sequence ATGTAGTCCCGGAACGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919782152_919782156 -6 Left 919782152 1:201228139-201228161 CCCCAGCTTGTGTACACATGTAG 0: 1
1: 0
2: 1
3: 3
4: 92
Right 919782156 1:201228156-201228178 ATGTAGTCCCGGAACGAAGATGG 0: 1
1: 0
2: 0
3: 2
4: 37
919782153_919782156 -7 Left 919782153 1:201228140-201228162 CCCAGCTTGTGTACACATGTAGT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 919782156 1:201228156-201228178 ATGTAGTCCCGGAACGAAGATGG 0: 1
1: 0
2: 0
3: 2
4: 37
919782151_919782156 8 Left 919782151 1:201228125-201228147 CCACTCTCGAAACACCCCAGCTT 0: 1
1: 5
2: 5
3: 13
4: 112
Right 919782156 1:201228156-201228178 ATGTAGTCCCGGAACGAAGATGG 0: 1
1: 0
2: 0
3: 2
4: 37
919782154_919782156 -8 Left 919782154 1:201228141-201228163 CCAGCTTGTGTACACATGTAGTC 0: 1
1: 0
2: 1
3: 29
4: 285
Right 919782156 1:201228156-201228178 ATGTAGTCCCGGAACGAAGATGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919782156 Original CRISPR ATGTAGTCCCGGAACGAAGA TGG Intronic
904744390 1:32702372-32702394 ATGTAGTCCCGGGAGGGGGAGGG + Intronic
919782156 1:201228156-201228178 ATGTAGTCCCGGAACGAAGATGG + Intronic
924586305 1:245364056-245364078 AGGTAGTACAGGAACCAAGAAGG + Intronic
1070837491 10:79459097-79459119 AGGTAGTTAAGGAACGAAGAGGG - Intergenic
1081028074 11:38040545-38040567 AAGTAGTCCATGAACGAAGAAGG - Intergenic
1083290831 11:61689089-61689111 ATGTAATCCCGGCCCGCAGAAGG - Intronic
1085554716 11:77410115-77410137 AGGTAGCCCAGGAAAGAAGAGGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1089576431 11:119447655-119447677 ATGCAGCCCCGGAACGATGCTGG - Intergenic
1092860341 12:12714753-12714775 ATGGAGTCCCTGAAGGAACAGGG - Intergenic
1115370126 14:32603623-32603645 ATGTAGTCCCTGCAGGAAAAGGG - Intronic
1116948369 14:50856929-50856951 TTGTAGTCACCTAACGAAGAAGG - Intergenic
1126482994 15:49147779-49147801 ATGTAGTCACAAAACGAAGAGGG - Intronic
1126713075 15:51483345-51483367 ATGTAGGCTTGGAATGAAGACGG - Intronic
1133928135 16:10210320-10210342 ATTTAGTCCTGGAAAGGAGAAGG - Intergenic
1147564352 17:41527541-41527563 TTGGAGCCCCGGGACGAAGAAGG - Intronic
1153017135 18:594045-594067 ATGTCCTCCAGGAACAAAGAGGG - Intergenic
929043140 2:37765799-37765821 ATTTAGTCCTGGAACCAAAATGG - Intergenic
935535051 2:104284168-104284190 AGGTAGGCCCAGAATGAAGAAGG - Intergenic
938403818 2:131016100-131016122 ATCTAGTCCCAGAAGCAAGAGGG - Intronic
939988630 2:148856146-148856168 ATCTAGTGCAGGAACAAAGACGG - Intergenic
1172732086 20:37096483-37096505 AAGTAGCCCCTGGACGAAGAGGG + Intergenic
1177834365 21:26172365-26172387 ATGCAGACCCGGAACAAATACGG - Intergenic
1203295307 22_KI270736v1_random:37304-37326 ATTTAGTCCTGGAACCAAAATGG - Intergenic
950358964 3:12437018-12437040 GTGGAGCCCAGGAACGAAGAGGG + Intergenic
959056722 3:101574437-101574459 ATGTAGGCCCGGAGCCCAGAGGG - Intronic
959523759 3:107351561-107351583 ATGTGGTGCTGGAACAAAGATGG - Intergenic
976488709 4:85641518-85641540 ATGAAGACCCGGAGAGAAGATGG - Intronic
978979861 4:114929995-114930017 ATGTAGCCCCAGAATGAAAAGGG + Intronic
981264960 4:142771462-142771484 ATGTAGTTCAGGAAAGAATATGG + Intronic
989748569 5:44862336-44862358 ATTTAGTCCCGGAAAGAGAAGGG + Intergenic
1013298675 6:108782433-108782455 TCGTAGTCCGGGAACGATGAAGG + Intergenic
1019568698 7:1697679-1697701 ATAAAGTCCCGGAAGGAGGAGGG - Intronic
1022513097 7:30954383-30954405 ATGTAGTGCTGGCACAAAGATGG - Intronic
1027542705 7:79488008-79488030 ATGTAGTCACTGAACTAAAATGG - Intergenic
1035163614 7:156969698-156969720 ATGTAGTCAGGGAAGGAAGGAGG + Exonic
1037804121 8:22049779-22049801 AGGTAGTCTCAGAAAGAAGAGGG - Intronic
1038141128 8:24846322-24846344 ACGTCTTCCCGGAAAGAAGATGG + Intergenic
1048499208 8:134960517-134960539 ATGTATTCCCTGTAAGAAGAGGG - Intergenic
1194427417 X:93756763-93756785 GTGTAGTCCCGGAATAAATATGG + Intergenic