ID: 919794494

View in Genome Browser
Species Human (GRCh38)
Location 1:201313156-201313178
Sequence TTCCATTGTAGATCTGGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919794494_919794501 3 Left 919794494 1:201313156-201313178 CCCTGGCCAGATCTACAATGGAA 0: 1
1: 0
2: 0
3: 9
4: 115
Right 919794501 1:201313182-201313204 TCAAGCGGGAGCCTGACAACAGG 0: 1
1: 0
2: 0
3: 3
4: 47
919794494_919794503 28 Left 919794494 1:201313156-201313178 CCCTGGCCAGATCTACAATGGAA 0: 1
1: 0
2: 0
3: 9
4: 115
Right 919794503 1:201313207-201313229 CTTCAGCTCCTACAGCCAGATGG 0: 1
1: 0
2: 2
3: 24
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919794494 Original CRISPR TTCCATTGTAGATCTGGCCA GGG (reversed) Exonic
903780733 1:25818622-25818644 TTCCACTGTGGGTCAGGCCAAGG - Intronic
906845703 1:49189406-49189428 TTACATTAAGGATCTGGCCAAGG - Intronic
908163062 1:61430750-61430772 TTGCATTGTATATCTGGCCCTGG + Intronic
911255782 1:95631728-95631750 TGACTTTGCAGATCTGGCCATGG + Intergenic
911344426 1:96679260-96679282 TTCCATTGAAGATTTGACGAAGG + Intergenic
911922862 1:103789161-103789183 TTTCATTGTACATATGGTCATGG + Intergenic
912434547 1:109651692-109651714 TTCCATTGAAGATTTGACAAAGG - Intergenic
917144166 1:171870044-171870066 GTCCATTGAAGAACTAGCCATGG + Intronic
917607221 1:176644502-176644524 TTCCATTGTACATATGACAATGG + Intronic
919501908 1:198347894-198347916 TTTCCTCGTAGATCTTGCCATGG - Intergenic
919794494 1:201313156-201313178 TTCCATTGTAGATCTGGCCAGGG - Exonic
920088324 1:203434141-203434163 TTACATTGGAGAAGTGGCCATGG - Intergenic
922988621 1:229886246-229886268 CTCCACTGGATATCTGGCCATGG - Intergenic
923734044 1:236584058-236584080 TTACATTGTAAATCTGGCTTTGG - Intronic
923880623 1:238100314-238100336 TTTTATTGTAGATCTTGCTATGG - Intergenic
1075145752 10:119881695-119881717 TGCCACTTTAGATATGGCCAAGG + Intronic
1076415677 10:130286580-130286602 GTCCTTTGAAGATATGGCCATGG - Intergenic
1079400629 11:20103740-20103762 TTCCATTGTTTAACTGGACAAGG - Intronic
1079896240 11:26122074-26122096 TTCAAATGTACATCTGTCCAAGG + Intergenic
1080781763 11:35436032-35436054 TCCCTTTGGAGATCTGCCCATGG - Exonic
1082769344 11:57194436-57194458 ATCCACTGTAGATATAGCCATGG - Intergenic
1090457941 11:126866121-126866143 TTCCATTGTGTATCTGGACCTGG + Intronic
1092115283 12:5996991-5997013 TGCCATTGTAGATGTGGTCGTGG - Intronic
1092884207 12:12911442-12911464 TTCAGATATAGATCTGGCCAGGG - Intronic
1093786142 12:23193956-23193978 ATCCATTGGAACTCTGGCCAAGG + Intergenic
1095368994 12:41443538-41443560 TTCAATTGTAGATTTGGTTATGG + Intronic
1095558958 12:43542915-43542937 CCCCATTTTAGATGTGGCCATGG + Intronic
1096624529 12:52885982-52886004 TTCCATTGAAGATTTGACAAAGG - Intergenic
1097900495 12:64868339-64868361 TTCCATTGAAGATCTGACAAAGG + Intronic
1099210053 12:79773322-79773344 TTCCAATTTAGATTTGTCCAAGG - Intergenic
1099294850 12:80817306-80817328 TTCCATCTGAGATCTAGCCAGGG - Intronic
1107095501 13:36530889-36530911 TTCCACTGTGAATCTGGGCAGGG - Intergenic
1108734128 13:53264669-53264691 TTCCATTGTAGATCAGGCTCTGG + Intergenic
1110405884 13:75150071-75150093 GTCAATTGTAGGTCTGGCTAGGG - Intergenic
1111833187 13:93355536-93355558 TTCTATTGTGGATCTCTCCATGG - Intronic
1114074033 14:19142848-19142870 TTCCATTGTTGATCTTGCATAGG + Intergenic
1114088233 14:19257128-19257150 TTCCATTGTTGATCTTGCATAGG - Intergenic
1114883489 14:26816490-26816512 TTCCATTATAGATGAAGCCAAGG - Intergenic
1115503304 14:34068325-34068347 TCCCTCTGTAGATCAGGCCAAGG + Intronic
1117300942 14:54426784-54426806 TTCCTTTTTAGATCTAGGCATGG + Exonic
1127284929 15:57524269-57524291 TTCCAGTGTGGACATGGCCAGGG + Intronic
1128192835 15:65719958-65719980 TACCATTGTAGAATTGTCCATGG - Intronic
1139067583 16:63337231-63337253 TTCCCTTGTGCTTCTGGCCAAGG + Intergenic
1142372422 16:89690542-89690564 TTCCATTCCAGATCGGGCCCGGG + Exonic
1143947218 17:10604050-10604072 TGACATTGCAAATCTGGCCAAGG - Intergenic
1146515223 17:33483862-33483884 TTACATTAAAGATCTTGCCATGG + Intronic
1149853523 17:60057131-60057153 TTCCATTGTCGTACTGCCCAAGG - Exonic
1150492498 17:65584099-65584121 TTCCATCCAAGGTCTGGCCAAGG + Intronic
1150841735 17:68613960-68613982 TTCCACAGTAGCTCTGACCATGG - Intergenic
1151809629 17:76430767-76430789 TTCCATTAAAGATCTGACAAAGG + Intronic
1152018634 17:77768811-77768833 TTTCACTGGAGACCTGGCCATGG - Intergenic
1154341871 18:13510238-13510260 TTCCATTCTAGATCTAACCACGG - Intronic
1156485090 18:37460277-37460299 TTCCATTTTAAATGTGTCCAGGG - Intronic
1161829726 19:6593665-6593687 TTCCATTGAAGATTTGACAAAGG - Intronic
1162233365 19:9285087-9285109 TTCCTTTGGAGATCTTGGCAAGG - Intergenic
925608522 2:5683685-5683707 TTCCAGGGCAGCTCTGGCCAGGG - Intergenic
929092369 2:38231906-38231928 TTCCATTGAAGATTTGACGAAGG - Intergenic
938488212 2:131737904-131737926 TTCCATTGTTGATCTTGCATAGG + Intronic
941638463 2:167961688-167961710 TTCCATTGTTGGTATGGCCAGGG - Intronic
941817092 2:169807027-169807049 TTTCTTTGTACTTCTGGCCAGGG - Exonic
1170287561 20:14727159-14727181 TTCCATTGAAAATCTGGCTATGG + Intronic
1179557525 21:42189939-42189961 TCCCAGTGAAGATGTGGCCAGGG + Intergenic
1179910976 21:44448756-44448778 TGCCATTGCTGAGCTGGCCAGGG - Intergenic
1180289684 22:10835788-10835810 TTCCATTGTTGATCTTGCATAGG + Intergenic
1180492481 22:15865210-15865232 TTCCATTGTTGATCTTGCATAGG + Intergenic
1181767345 22:25101267-25101289 TTCCATTTTAGAGAAGGCCAGGG + Intronic
1181770325 22:25120423-25120445 TTCCTTTATAGATCTAGCCTGGG + Intronic
1182296738 22:29314675-29314697 TCCCATTGTAGCTCTGCTCAAGG + Intronic
1182706771 22:32287274-32287296 GTCCATTTCAGATGTGGCCAAGG + Intergenic
1184395077 22:44230352-44230374 GTCCATTTGAGATGTGGCCAAGG + Intergenic
951144837 3:19214553-19214575 TTCCCCTGTGGATCAGGCCAAGG + Intronic
955651633 3:61200889-61200911 TTTGACTGTAGATTTGGCCAAGG - Intronic
956197837 3:66671091-66671113 TTCAATCATAAATCTGGCCAAGG - Intergenic
959562250 3:107796017-107796039 TACCATCAGAGATCTGGCCAGGG - Intronic
961095492 3:124152333-124152355 TTCCATTGAAGATTTGACGAAGG + Intronic
962875171 3:139530639-139530661 TTCCACTGTAAAGCTGGCAAAGG + Intronic
964892040 3:161548738-161548760 TTTCATTGAAGTACTGGCCATGG - Intergenic
966161193 3:176970223-176970245 TTCCATTGTTGATGGTGCCATGG - Intergenic
967700927 3:192591531-192591553 TTCCAATGGAGTTCAGGCCAAGG + Intronic
974660845 4:64886790-64886812 TTCTATGATAGATCTGGGCAAGG - Intergenic
977724754 4:100283127-100283149 TTCCAGGGTAGATCTGGCAGAGG - Intergenic
978372852 4:108046570-108046592 TTCAAATGAAGTTCTGGCCAGGG + Intergenic
980214760 4:129837400-129837422 TTAGAATGTAGAGCTGGCCATGG - Intergenic
980526814 4:133999821-133999843 TTCCAATGCAAATCTGCCCAGGG + Intergenic
981108198 4:140905454-140905476 TTTCATTGCACATCTGGCAATGG - Intronic
986124805 5:4875065-4875087 CTCCATGGGAGAACTGGCCAAGG + Intergenic
987283562 5:16435370-16435392 TTACAATGAAGATCTGGCAAGGG + Intergenic
989621638 5:43390221-43390243 TTCCATTATATACCTGACCAAGG - Intronic
992523548 5:77582714-77582736 TTCCATTGAAGATTTGACGAAGG - Intronic
999235974 5:150094640-150094662 TTCCATTGAAGATTTGACGAAGG - Intronic
1002179231 5:177421574-177421596 TTCCATTGCAGAGGTGCCCATGG + Intronic
1003394573 6:5742059-5742081 TTTCTCTGTAGATCTGGCCTTGG + Intronic
1008113115 6:47515114-47515136 GTGCATTGTAGGTCTGGCAAAGG + Intronic
1009687529 6:66982984-66983006 TTCCTTTGTTTATCTGGCTAAGG + Intergenic
1010999839 6:82575575-82575597 TGCTATTGCAGATGTGGCCAAGG + Intergenic
1021373068 7:19874135-19874157 TTCCACTGTAGATTGGCCCAGGG - Intergenic
1022892027 7:34711094-34711116 TTCCATTGAAGATCTGACAAAGG - Intronic
1030316763 7:108123872-108123894 CTTCTTTGTAGATTTGGCCATGG + Intronic
1030353014 7:108510568-108510590 TTCCATTGTAGATTTGACGAAGG - Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1033051427 7:138007940-138007962 TTCCATTGTTTATCTGCTCATGG + Intronic
1037595430 8:20350456-20350478 TTCCCTCGTAGCTGTGGCCATGG - Intergenic
1038455447 8:27669580-27669602 TTCCATTGTTGAGTTAGCCAGGG - Intronic
1041246232 8:55891017-55891039 TTCCATTGTATGGCTGGGCACGG - Intronic
1042081809 8:65061788-65061810 TTCCATTGCCACTCTGGCCAGGG - Intergenic
1042858525 8:73291840-73291862 TTCCATTGAAGATTTGACGAAGG + Exonic
1042962098 8:74314875-74314897 TTCCACTTTGGTTCTGGCCATGG + Exonic
1043180351 8:77081251-77081273 TTTTATTATAGCTCTGGCCAGGG - Intergenic
1045750618 8:105479857-105479879 TTACATTACAGATCTGGCAAAGG - Intronic
1045958265 8:107935457-107935479 TTCTATTAGAGTTCTGGCCAAGG - Intronic
1048030167 8:130623607-130623629 GTCCATTTTAGGTCTGGCTATGG + Intergenic
1055284609 9:74715039-74715061 TTCCATATTAGGTCTTGCCATGG + Intergenic
1055729310 9:79264329-79264351 TTCCATTTTAGAGCTGGAAAAGG - Intergenic
1056467613 9:86873466-86873488 TTGTATGCTAGATCTGGCCAGGG + Intergenic
1058613711 9:106803180-106803202 TTCAATTTTAGATTGGGCCAAGG + Intergenic
1059095899 9:111414459-111414481 GGCCAATGTAGATCTGGACAGGG + Exonic
1061834054 9:133317620-133317642 CTCCATTGCAGAACTGGCCGTGG + Intergenic
1186141638 X:6580535-6580557 TTCAAATGGACATCTGGCCAAGG - Intergenic
1191582478 X:62779649-62779671 TTTCTTTGTACTTCTGGCCAGGG - Intergenic
1196195225 X:112832401-112832423 TTCCATTTTAGAACTGGAGAGGG + Intronic
1198453427 X:136791372-136791394 TTCCATTGAAGATTTGACGAAGG - Intergenic
1199810545 X:151344478-151344500 TTCCAGTGCAGATATGTCCATGG - Intergenic
1202262772 Y:22987004-22987026 TTCATATGTGGATCTGGCCACGG + Intronic
1202415762 Y:24620745-24620767 TTCATATGTGGATCTGGCCACGG + Intronic
1202455025 Y:25049341-25049363 TTCATATGTGGATCTGGCCACGG - Intronic