ID: 919801502

View in Genome Browser
Species Human (GRCh38)
Location 1:201357314-201357336
Sequence GTCATGATGGGCCGTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919801502_919801510 14 Left 919801502 1:201357314-201357336 CCAGACACACGGCCCATCATGAC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 919801510 1:201357351-201357373 AGGAGACACTGAGGCATAGGCGG 0: 1
1: 0
2: 6
3: 51
4: 511
919801502_919801505 -6 Left 919801502 1:201357314-201357336 CCAGACACACGGCCCATCATGAC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 919801505 1:201357331-201357353 CATGACCTCTTGTTGCACCAAGG 0: 1
1: 0
2: 0
3: 13
4: 111
919801502_919801509 11 Left 919801502 1:201357314-201357336 CCAGACACACGGCCCATCATGAC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 919801509 1:201357348-201357370 CCAAGGAGACACTGAGGCATAGG 0: 1
1: 0
2: 1
3: 34
4: 307
919801502_919801512 25 Left 919801502 1:201357314-201357336 CCAGACACACGGCCCATCATGAC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 919801512 1:201357362-201357384 AGGCATAGGCGGTGGAGCCAAGG 0: 1
1: 0
2: 1
3: 9
4: 191
919801502_919801513 28 Left 919801502 1:201357314-201357336 CCAGACACACGGCCCATCATGAC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 919801513 1:201357365-201357387 CATAGGCGGTGGAGCCAAGGCGG 0: 1
1: 0
2: 1
3: 34
4: 329
919801502_919801507 5 Left 919801502 1:201357314-201357336 CCAGACACACGGCCCATCATGAC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 919801507 1:201357342-201357364 GTTGCACCAAGGAGACACTGAGG 0: 1
1: 0
2: 0
3: 9
4: 163
919801502_919801511 17 Left 919801502 1:201357314-201357336 CCAGACACACGGCCCATCATGAC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 919801511 1:201357354-201357376 AGACACTGAGGCATAGGCGGTGG 0: 1
1: 0
2: 0
3: 16
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919801502 Original CRISPR GTCATGATGGGCCGTGTGTC TGG (reversed) Intergenic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
913318775 1:117574458-117574480 GTCTTGCTGGGCCCTGTGTTTGG + Intergenic
913699456 1:121360605-121360627 GTGATGGTGGGCACTGTGTCTGG - Intronic
914138089 1:144919431-144919453 GTGATGGTGGGCACTGTGTCTGG + Intronic
914255623 1:145959837-145959859 ATCATGATAGGCTGTGTTTCAGG + Exonic
919801502 1:201357314-201357336 GTCATGATGGGCCGTGTGTCTGG - Intergenic
920486865 1:206379313-206379335 GTGATGGTGGGCACTGTGTCTGG - Intronic
921946521 1:220889554-220889576 ACCAGGATGGGCCTTGTGTCAGG + Intergenic
923868755 1:237968102-237968124 GTCAAGCTGGGACCTGTGTCGGG - Intergenic
1068392120 10:56411299-56411321 GTCATACTGGGCCTTGTGTGTGG - Intergenic
1073177397 10:101564874-101564896 GTATGGATGGGCCGTGTGGCTGG - Intergenic
1078823401 11:14905294-14905316 GCAATGATGGTCCGTGTGTCCGG + Intronic
1083894254 11:65612259-65612281 GCCATGATGGGCAGCGTGTCGGG + Intronic
1083994534 11:66265598-66265620 GCCAGGATGGGCCCTGGGTCTGG + Intronic
1084364541 11:68689049-68689071 GTCCTGTTTGGCTGTGTGTCGGG + Intronic
1088739782 11:112757778-112757800 ATCAGGTTGGGCTGTGTGTCAGG - Intergenic
1091654158 12:2333157-2333179 GTCTTGATGGGCTGTGTGCTGGG + Intronic
1091771362 12:3153328-3153350 GTCATGATGGCAGGTTTGTCAGG - Intronic
1100626120 12:96334090-96334112 GTCATGATGTGCAGAGTATCTGG - Intronic
1101687247 12:107037180-107037202 GTCATGAGGTCCCATGTGTCTGG - Intronic
1104664934 12:130641303-130641325 GTGATGCCGGGCCGAGTGTCCGG - Intronic
1104664956 12:130641397-130641419 GTGATGCCGGGCCGAGTGTCCGG - Intronic
1104664967 12:130641444-130641466 GTGATGCCGGGCCGAGTGTCCGG - Intronic
1104664978 12:130641491-130641513 GTGATGCCGGGCCGAGTGTCCGG - Intronic
1107772862 13:43807074-43807096 GTCATGAGGGGGAGTGTGTGTGG + Intergenic
1113888474 13:113724329-113724351 GTCTTGAGGGTCCGCGTGTCGGG + Intronic
1114483709 14:23050647-23050669 GTAAAGATGGGGCCTGTGTCTGG - Intronic
1125136378 15:36348983-36349005 GGCAGGATGGGCTGTGTGTCTGG - Intergenic
1128876851 15:71208838-71208860 GTCATGATGGGCCATGAGCCAGG - Intronic
1129103508 15:73288437-73288459 GTCATGATGGGGTTTGGGTCTGG - Exonic
1132108846 15:99087506-99087528 GACAGGATGGGCTGTGAGTCTGG + Intergenic
1132652120 16:1026013-1026035 GTCATCGTGCGCCGTGTTTCCGG - Intergenic
1140336085 16:74106405-74106427 GTCACGAAGGCCCGTGTGGCAGG + Intergenic
1144311256 17:14016159-14016181 GACATGAAGGCCCGTGTGGCTGG - Intergenic
1144945478 17:18967519-18967541 GGGATGAAGGGCCATGTGTCTGG + Intronic
1150304382 17:64071857-64071879 GACATGATGGGACCTGTGTTTGG + Intronic
1151316079 17:73323516-73323538 CTCTTGATGGGAAGTGTGTCTGG + Intergenic
1155229824 18:23762074-23762096 GTCATGATGGCACGTGTCTGTGG + Intronic
1158781885 18:60662568-60662590 GGCATGAGGGGCCGTCTGGCTGG - Intergenic
1159233074 18:65634262-65634284 TTCATGATGGGCAGTGTGAAAGG + Intergenic
1161014309 19:1976093-1976115 GTGAGGATGGACCGTGTGGCAGG + Intronic
1164863651 19:31584124-31584146 GGCAGTATAGGCCGTGTGTCTGG + Intergenic
1167233296 19:48298345-48298367 GTCATGGAGGGCCGGTTGTCAGG + Intronic
926214199 2:10894007-10894029 GTCCTGATGGGCTGTGGGCCAGG + Intergenic
931828198 2:66023341-66023363 GTGATGAAGGGCTGTGTGGCAGG + Intergenic
931944140 2:67286439-67286461 ATCTTGATGGGCTTTGTGTCTGG + Intergenic
937258700 2:120572075-120572097 GACAAGATGGGCCGTGTTTGCGG - Intergenic
937312852 2:120912681-120912703 GTCATGAGGGGCAGTGCGGCAGG - Intronic
944412003 2:199455806-199455828 GTGATAATGGCCCGGGTGTCAGG - Intronic
944673372 2:202015012-202015034 ATCTTGATGGGCCTGGTGTCAGG + Intergenic
1172572644 20:35982493-35982515 GTCATGGTGGTCCCTGTGCCTGG + Intronic
1174280419 20:49435049-49435071 GCCATGGTGGGCCCTGTGTTAGG - Intronic
1176143700 20:63556102-63556124 GCCAGGAAGGGCCGTGGGTCTGG - Exonic
1176150189 20:63586849-63586871 CTCTTGCTGGGCCGTGAGTCTGG + Intergenic
1177639655 21:23830571-23830593 GTCATGATGGGCCAGGGGTCTGG - Intergenic
953914546 3:46909955-46909977 GTCATGCTGGGCACTGTATCCGG - Intergenic
953983770 3:47426236-47426258 GTCCTGATGGACCCTCTGTCCGG - Intronic
985519608 5:367413-367435 GTCATGATGGGCGGTGAGGAAGG - Intronic
993179316 5:84530589-84530611 CTCATGATGGGACAAGTGTCAGG + Intergenic
1005198806 6:23319547-23319569 GTCATGAAAGGCTGTGTGTCTGG + Intergenic
1006257808 6:32844983-32845005 GCCCTGATGGGCCCTGTGGCTGG + Intronic
1006393412 6:33772037-33772059 GACCTGAGGGACCGTGTGTCTGG + Exonic
1007513411 6:42391940-42391962 GTCAGGCTGGGCTGTGTCTCAGG + Intronic
1017065589 6:150526281-150526303 GTCAAGATGGGCACTGTGTCAGG + Intergenic
1018825275 6:167404141-167404163 GTCATGCTGGTCCGTCTCTCAGG + Intergenic
1021693823 7:23256513-23256535 GTCATGATGTCAAGTGTGTCAGG + Intronic
1031871744 7:127095246-127095268 GTCATGATGGACCCTGTGTATGG - Intronic
1032952964 7:136937865-136937887 GTCATCATGGACTGTGTGTTTGG - Intronic
1034070373 7:148179188-148179210 CTCCTGATGGGCCTTGAGTCAGG - Intronic
1036729899 8:11253559-11253581 GACAGGAGGGGCCGTGTGGCTGG - Intergenic
1037450828 8:19014138-19014160 CTCAGGAAGGGCCGTGTGACTGG + Intronic
1038772403 8:30495397-30495419 GTGATGCTGGGCCATGAGTCTGG - Intronic
1050388749 9:5114621-5114643 GTCATGCTGTGCCAAGTGTCCGG - Intronic
1056349519 9:85735209-85735231 TTCATGTTGTACCGTGTGTCAGG - Intronic
1057271093 9:93651893-93651915 GTCATGAGGGCCCTTGTGGCAGG + Intronic
1189988818 X:46575752-46575774 GTCATAATGAGCCGTGAGACTGG + Intronic
1193041624 X:77009911-77009933 GTCATGCTGGGCTGGGTGCCTGG - Intergenic
1196832719 X:119788759-119788781 GTCCTGATGGGCCTTGAGACAGG - Intronic