ID: 919805459

View in Genome Browser
Species Human (GRCh38)
Location 1:201378716-201378738
Sequence GGCAAGATCTTTAAGTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919805459_919805464 11 Left 919805459 1:201378716-201378738 CCCTGGCACTTAAAGATCTTGCC 0: 1
1: 0
2: 0
3: 8
4: 125
Right 919805464 1:201378750-201378772 CACACTCCTCTGTTTCTCCGTGG 0: 1
1: 0
2: 0
3: 8
4: 169
919805459_919805465 12 Left 919805459 1:201378716-201378738 CCCTGGCACTTAAAGATCTTGCC 0: 1
1: 0
2: 0
3: 8
4: 125
Right 919805465 1:201378751-201378773 ACACTCCTCTGTTTCTCCGTGGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919805459 Original CRISPR GGCAAGATCTTTAAGTGCCA GGG (reversed) Intronic
900181531 1:1313164-1313186 GGCAAGGCCTTGAGGTGCCAAGG - Intronic
904955356 1:34279187-34279209 CTCATGATTTTTAAGTGCCAAGG + Intergenic
907354701 1:53862796-53862818 GGCAACATCTTTACGTTGCAAGG - Intronic
916827123 1:168453110-168453132 GGCAGGAGCCGTAAGTGCCATGG - Intergenic
917934204 1:179848801-179848823 GGCAAGATCTTTAATATCCCTGG - Intronic
918384349 1:183990541-183990563 GACAAGGTCTCCAAGTGCCAGGG + Intronic
918969336 1:191394239-191394261 TGCAAGATCGTTAAGTTCTAGGG + Intergenic
919082268 1:192880745-192880767 GGCAATGTCTTTCAGTGTCAAGG - Intergenic
919487957 1:198167691-198167713 GGCAAAATCTCTAAGTGGCAAGG - Intronic
919805459 1:201378716-201378738 GGCAAGATCTTTAAGTGCCAGGG - Intronic
922444289 1:225683597-225683619 GGCAAGACCTTCAACTACCACGG - Intergenic
922660910 1:227429622-227429644 GGAAAGATTTTTAAATGCCATGG - Intergenic
1064156610 10:12907990-12908012 GACAAGATCTTAAATGGCCAGGG + Intronic
1066230059 10:33423574-33423596 GGCACGTTCTTTAAGTGCTTTGG + Intergenic
1069735053 10:70648517-70648539 GACAAGATCTTTATCTTCCAAGG - Intergenic
1072622682 10:97090390-97090412 GGCAAGAGCTGGAAGTGTCAGGG + Intronic
1074458384 10:113614968-113614990 GGAAAGACCTTTAAGTGACCTGG + Intronic
1075431293 10:122384202-122384224 TGCAAGCTCTTTAAATGCTAGGG + Intronic
1076245938 10:128947896-128947918 GACAACATCTGAAAGTGCCAAGG + Intergenic
1080222345 11:29920748-29920770 GACAAGATGTTGAAGAGCCAAGG + Intergenic
1080335673 11:31193026-31193048 GGCAACTTGTTTAAGTTCCAGGG - Intronic
1084599479 11:70136328-70136350 GTCAAGAGGTTTAAGTGCAAGGG + Intronic
1091920414 12:4299704-4299726 GGGATGTTCTTAAAGTGCCAAGG - Intronic
1093294750 12:17375081-17375103 TGCAAGATCTTTGAGGGTCATGG - Intergenic
1095817422 12:46440039-46440061 GGCAAATGCTTTAAGGGCCATGG + Intergenic
1096428060 12:51520924-51520946 GGCTGGATCTTTGAGTGACATGG + Intergenic
1098469829 12:70830450-70830472 GGCAGGAGCTTTAACAGCCAAGG - Intronic
1100936431 12:99673254-99673276 GGCAAAATCTTTTAATTCCAAGG + Intronic
1102420065 12:112796380-112796402 GGTGAGATCCTTAAGGGCCAAGG + Intronic
1103340322 12:120217389-120217411 GGCAAGACACTTAATTGCCATGG + Intronic
1103421823 12:120791624-120791646 GACAATATTTTTAAATGCCAAGG + Intronic
1105070077 12:133228935-133228957 GGCAAGTGCTTTTAGTGGCAAGG - Intronic
1109984457 13:69959882-69959904 GGGAGGATTTTTAAGTGCCAAGG - Intronic
1110769457 13:79322412-79322434 GGCAAGATCTAAAACTGGCATGG - Exonic
1119031470 14:71196179-71196201 GGGAAGATCTTGGAGTGCAATGG - Intergenic
1119463258 14:74829970-74829992 GGCAAGATCATTCAGTCCCACGG - Intronic
1121150119 14:91625203-91625225 GCGAAGATCTTTAAATGACAGGG + Intronic
1121604551 14:95230958-95230980 GCAAAGATCTTTCACTGCCAAGG + Intronic
1124169871 15:27363264-27363286 GGCAAGATCTTTATATGTTAAGG + Intronic
1127618772 15:60713081-60713103 GGTATGATCTTTTATTGCCAGGG - Intronic
1128521311 15:68376700-68376722 GGCAAGGTCATTAACTGCCTTGG + Intronic
1128783481 15:70378255-70378277 GGCAAGTTCTTTAATTTCCCTGG + Intergenic
1130013846 15:80172843-80172865 GGCAAGAGCATTCAATGCCAAGG - Intronic
1130058100 15:80546598-80546620 GGCAAGATCTGGAACTGCAAAGG + Intronic
1136931890 16:34426046-34426068 TGGAAGATTTTAAAGTGCCAAGG + Intergenic
1136972682 16:34985769-34985791 TGGAAGATTTTAAAGTGCCAAGG - Intergenic
1138828199 16:60346859-60346881 GGAAAGATTTTTAGGTGGCAAGG + Intergenic
1141019642 16:80483165-80483187 GGCAGCACCTTTATGTGCCATGG + Intergenic
1141197114 16:81868311-81868333 GGCAAGGTCACTAAGGGCCAGGG - Intronic
1143023148 17:3926979-3927001 GGCAAGGGCCTTGAGTGCCAAGG - Intronic
1145891999 17:28423622-28423644 GGCAGGATCTTGATGTGCCCAGG + Intergenic
1148582145 17:48751640-48751662 GGCAAGATCTTTAAAAGCAAAGG + Intergenic
1151767699 17:76140659-76140681 GGGAGGATCTTTTAGTGCCGAGG + Intronic
1155022695 18:21911007-21911029 GGCAGGGTCTCTAAGTGCAAAGG + Intergenic
1156279027 18:35614905-35614927 GGCAAGATCTTTAAATAGAAAGG + Intronic
1157824717 18:50802417-50802439 GGCAAGTTCCTTAAGTGCCTTGG - Intronic
1159060096 18:63505690-63505712 GGGAAGATCTCTATGTCCCAAGG - Intergenic
1160836204 19:1125766-1125788 GGCGAGATCTTTTGGGGCCAGGG + Intronic
925171969 2:1755462-1755484 GACAAGAGCTTTAGGTGCCCAGG - Intergenic
928231592 2:29503545-29503567 GCCCAGATCTCTATGTGCCATGG - Intronic
932593393 2:73080197-73080219 GCCAAGCTCTTTGAGTGACAGGG + Intronic
933468637 2:82690985-82691007 GGAAATATCTTTTAATGCCATGG + Intergenic
933995229 2:87663276-87663298 TGCAAGGTCCTTGAGTGCCAAGG - Intergenic
936298631 2:111287637-111287659 TGCAAGGTCCTTGAGTGCCAAGG + Intergenic
939659681 2:144872650-144872672 GGCATGATCTCAAAGTGCTACGG + Intergenic
945182874 2:207109888-207109910 GGCAATCTCTTCAAGTGGCAAGG + Intronic
947304776 2:228732294-228732316 GGAATGATCTTTAACTGGCATGG - Intergenic
1170427542 20:16249963-16249985 AGGAAGATCTTTAAGTTGCAGGG - Intergenic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1174225283 20:48993843-48993865 GCCAACAACTTTAAGTGCCAGGG + Intronic
1174277398 20:49413880-49413902 GGCAGGAACTGTAAGTGCAAAGG - Intronic
1174872857 20:54199621-54199643 GGTAAGAAATTTAAGTGCAATGG + Intergenic
1175266055 20:57704173-57704195 GGCCAGATCTTTCCGTTCCAGGG - Intronic
1175855007 20:62116134-62116156 GGCATGTTCTTTAACTGCCCTGG + Intergenic
953738169 3:45513837-45513859 CACAAGATCTTCAGGTGCCATGG + Intronic
958913684 3:100024125-100024147 GGAAAGGTCTTTCAGTGTCATGG + Intronic
961020927 3:123506288-123506310 GGCAAGGTCTTCAAGGGCCCAGG + Intronic
961454876 3:127018982-127019004 GCCAAGATCTCTATGTGCCCAGG - Intronic
962737912 3:138342219-138342241 GGCCAGATCTTGAAGCTCCATGG - Intergenic
962781917 3:138727143-138727165 TGGAAGATGTTCAAGTGCCAGGG + Intronic
977918922 4:102622973-102622995 GGTAGGATCTTAAAGGGCCAGGG - Intergenic
978318040 4:107462163-107462185 AGTAAGATCTCTAAGTTCCAGGG - Intergenic
979465308 4:121030788-121030810 GGTAAGAACTTTAAGTGAGAGGG - Intergenic
980708750 4:136536264-136536286 GGAGAGATCTTCAAGTGTCAGGG + Intergenic
988150800 5:27376844-27376866 GACAAGATCTCAAAGTGTCAGGG - Intergenic
991079334 5:62580172-62580194 GGCAAGTCCTTTAAATGCAAAGG - Exonic
994140899 5:96339980-96340002 GGCAAGACTTTTAAGTGTCTAGG - Intergenic
994170718 5:96657159-96657181 AGCAAGATTTTTATGTTCCAAGG - Intronic
994416695 5:99481075-99481097 GGCTAGAACTTTCAGTGCTAGGG - Intergenic
994463279 5:100094085-100094107 GGCTAGAACTTTCAGTGCTAGGG + Intergenic
994933506 5:106220757-106220779 GGCAAAATATCTAGGTGCCATGG - Intergenic
995714866 5:115072485-115072507 GGCCAGATCACTAAATGCCAAGG + Intergenic
996002466 5:118381069-118381091 GAAAAGATCATTAATTGCCAGGG - Intergenic
999609643 5:153354872-153354894 GGCAACAGCTTGAAGGGCCAGGG - Intergenic
1002881353 6:1255174-1255196 GGGAAGATATTTACCTGCCACGG - Intergenic
1004422250 6:15481151-15481173 GGCAAAATCTTTAAATCCAAAGG - Intronic
1006611945 6:35299341-35299363 GGCAAGATATTAAAGGGACAGGG - Intronic
1011043355 6:83055385-83055407 GTTAAGATTTTTAATTGCCAAGG - Intronic
1011920154 6:92564539-92564561 GGCTAGATATTTATGTTCCAGGG + Intergenic
1013536607 6:111068291-111068313 TGCAACATCTTTCACTGCCAAGG - Intergenic
1019211176 6:170406325-170406347 GGAAATGTCTTTAGGTGCCAGGG - Exonic
1020733178 7:11910403-11910425 GGCTATATCTCAAAGTGCCATGG + Intergenic
1021865651 7:24954325-24954347 GTCAAAATCTTTCAGTCCCAAGG + Intronic
1023897756 7:44448288-44448310 GGCAAGTCCTCTAAGAGCCAGGG + Intronic
1028673150 7:93428083-93428105 GACAAAAACTTTAAGTGCTAAGG + Intronic
1031757159 7:125659708-125659730 GGCAATATCTTTCAGTTCTAAGG - Intergenic
1031757444 7:125662682-125662704 GGCAATATCTTTCAGTTGCAAGG + Intergenic
1033469972 7:141637929-141637951 GGCAAGGTCTTTATATACCAAGG + Intronic
1036012932 8:4748176-4748198 AGCATGATGTTTATGTGCCAAGG - Intronic
1038750025 8:30286260-30286282 GGTAAGTTCCTTAAGGGCCAGGG + Intergenic
1039614616 8:38945284-38945306 GGAAACATCTTTAAGTGCTGAGG - Intronic
1039838342 8:41275751-41275773 GGCAAACTCTTTAAGAGACAGGG + Intronic
1045399224 8:101795260-101795282 AGCAAAAATTTTAAGTGCCAGGG + Intronic
1046323384 8:112607930-112607952 GGCTAGAACTTTCAGTGCTATGG - Intronic
1049007919 8:139867748-139867770 GGTAATATCTTAAAGTGTCAAGG + Intronic
1049029230 8:140022035-140022057 GGCCAGATCCTTAAGCACCATGG + Intronic
1049081464 8:140446491-140446513 GGCAATTTGTTTAAGTGTCAGGG - Intronic
1051065137 9:13093728-13093750 GGAAAGTTCTGTAAGAGCCAGGG - Intergenic
1055903351 9:81265811-81265833 GGAAAGATCTTAAAGTGCAATGG + Intergenic
1057897216 9:98918966-98918988 GGTAAGCTCTTTAACAGCCAAGG + Intergenic
1058792066 9:108457956-108457978 GGTAAGGTGTTTAAATGCCAAGG + Intergenic
1060078987 9:120623686-120623708 TGCTAGATCTTTAAGTACCTTGG - Intronic
1061190913 9:129082119-129082141 GGTAAGATGGTTGAGTGCCAGGG + Intronic
1186567564 X:10679996-10680018 TGCAAAGTTTTTAAGTGCCATGG - Intronic
1187852018 X:23600423-23600445 AGCAAGATCTTTGATTTCCAGGG + Intergenic
1189914493 X:45843443-45843465 GGCAGGATCTTGAGGTGCTAAGG + Intergenic
1197873237 X:131079869-131079891 GGGAACATCTTTAATTGCAATGG - Intronic
1202279909 Y:23172381-23172403 GGCAAGATTTTTGAGCCCCAGGG + Intronic
1202280638 Y:23183226-23183248 GGCAAGATTTTTGAGCCCCAGGG + Intronic
1202281367 Y:23194074-23194096 GGCAAGATTTTTGAGCCCCAGGG + Intronic
1202284524 Y:23224445-23224467 GGCAAGATTTTTGAGCCCCAGGG - Intronic
1202433039 Y:24808459-24808481 GGCAAGATTTTTGAGCCCCAGGG + Intronic
1202436198 Y:24838831-24838853 GGCAAGATTTTTGAGCCCCAGGG - Intronic
1202436926 Y:24849681-24849703 GGCAAGATTTTTGAGCCCCAGGG - Intronic