ID: 919806360

View in Genome Browser
Species Human (GRCh38)
Location 1:201383077-201383099
Sequence GAGCAGAACCAGCCTCCAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919806360_919806365 9 Left 919806360 1:201383077-201383099 CCGGCTGGAGGCTGGTTCTGCTC 0: 1
1: 0
2: 2
3: 22
4: 211
Right 919806365 1:201383109-201383131 CCGCCAGTTCCTTCTCAAAGAGG 0: 1
1: 0
2: 1
3: 10
4: 103
919806360_919806367 12 Left 919806360 1:201383077-201383099 CCGGCTGGAGGCTGGTTCTGCTC 0: 1
1: 0
2: 2
3: 22
4: 211
Right 919806367 1:201383112-201383134 CCAGTTCCTTCTCAAAGAGGTGG 0: 1
1: 1
2: 0
3: 24
4: 193
919806360_919806369 22 Left 919806360 1:201383077-201383099 CCGGCTGGAGGCTGGTTCTGCTC 0: 1
1: 0
2: 2
3: 22
4: 211
Right 919806369 1:201383122-201383144 CTCAAAGAGGTGGCGCTTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919806360 Original CRISPR GAGCAGAACCAGCCTCCAGC CGG (reversed) Exonic
900326322 1:2110297-2110319 GGGCTGAATCTGCCTCCAGCGGG + Intronic
900628057 1:3618458-3618480 GCGCAAAACCATCCTCCTGCTGG + Intergenic
900718353 1:4159372-4159394 GGGCAGAGCCAGTCTGCAGCCGG - Intergenic
900766209 1:4507458-4507480 GAGGAGACCCAGCCTCTATCAGG + Intergenic
900942878 1:5812338-5812360 GACCAGAACCAGCCCCCATGAGG + Intergenic
901260349 1:7866228-7866250 GAGGAGGCCCAGCCTCCAGATGG - Intergenic
902577802 1:17389358-17389380 GAGCAGTACCATCTTCCTGCAGG - Intronic
902645625 1:17796033-17796055 GAGCAGAGCGAGCCACCAGCTGG - Intronic
903070889 1:20726601-20726623 CAGCAGGACGAGCCTGCAGCAGG + Intronic
904904245 1:33883012-33883034 GACAAACACCAGCCTCCAGCTGG - Intronic
904905937 1:33897212-33897234 CAGCAGCACCTGGCTCCAGCAGG - Intronic
905450948 1:38055810-38055832 GGGCAGGACAAGCCTCCACCAGG - Intergenic
905507214 1:38489490-38489512 TAGAATAACCAGCTTCCAGCTGG - Intergenic
907588208 1:55640425-55640447 GAGAAGCTCCAGTCTCCAGCAGG - Intergenic
912174567 1:107140703-107140725 GATCAGAACCAGCGGCCAGGCGG - Intronic
912797953 1:112704323-112704345 TAGCAGAACCAGCTACCAGGTGG + Intronic
916411786 1:164553441-164553463 GAGCAGGAAGAGCCTCCAACAGG - Intergenic
916505959 1:165428631-165428653 GAGCAGAACCAGCACTCAGCAGG - Intronic
917443188 1:175084633-175084655 CAGCAGAACAAGGCTCCAGGAGG - Intronic
919806360 1:201383077-201383099 GAGCAGAACCAGCCTCCAGCCGG - Exonic
920647194 1:207812365-207812387 GTTCAGAACCAGCCTCCTGCAGG + Intergenic
921044867 1:211468565-211468587 GAGGGGAATCAGACTCCAGCAGG - Intergenic
922786142 1:228283259-228283281 GAGCACAGCCAGCCTCCATGTGG + Exonic
1066176237 10:32910129-32910151 ATCCAGAAACAGCCTCCAGCTGG - Intronic
1066416064 10:35223208-35223230 GAGAAGAACCAGCCACTAGGTGG + Intergenic
1066693587 10:38057948-38057970 GAGCAGAACCAGAATCAAGCTGG + Exonic
1067063829 10:43092602-43092624 AGGCAAAAGCAGCCTCCAGCTGG + Intronic
1067462571 10:46468530-46468552 TAGGAGAAGCAGTCTCCAGCAGG - Intergenic
1067624624 10:47916107-47916129 TAGGAGAAGCAGTCTCCAGCAGG + Intergenic
1067941206 10:50658839-50658861 GAGCTGCACCAGCAGCCAGCAGG - Intergenic
1069604202 10:69729560-69729582 CTGCAGAACCAGGCTCCGGCTGG - Intergenic
1069654877 10:70080378-70080400 GATGAGAACCAGGCTGCAGCAGG + Intronic
1070647472 10:78211638-78211660 GAGAATAGCCAGCCTTCAGCAGG + Intergenic
1072277570 10:93838152-93838174 GAGCAGAGTCAGCTTCCACCTGG + Intergenic
1072716544 10:97756236-97756258 GAGAAGAACAAGCCTACTGCTGG - Intronic
1073266024 10:102228932-102228954 GTGACGAACCAGCCTCCTGCAGG - Exonic
1073455452 10:103634127-103634149 GTGCAGACCCATCCTCCATCCGG + Intronic
1074802495 10:117015247-117015269 CAGCAGAGCCAGAGTCCAGCTGG - Intronic
1075674985 10:124290052-124290074 GAGCAGGAACAGCCTGCCGCTGG + Intergenic
1077130385 11:969143-969165 CCTCAGAGCCAGCCTCCAGCAGG - Intronic
1080049040 11:27839630-27839652 GACCACAACCAGCCTCAACCAGG + Intergenic
1080896465 11:36452496-36452518 GAGAAGAACCAGCAGGCAGCAGG - Intronic
1082802417 11:57424860-57424882 GAGCTGTATCAGCCCCCAGCAGG + Intronic
1083514304 11:63242597-63242619 AGGCAGACCCACCCTCCAGCTGG - Intronic
1084411995 11:69010786-69010808 AAGGTGGACCAGCCTCCAGCAGG - Intronic
1084958648 11:72704484-72704506 GAGCATCCCCAGCCACCAGCAGG - Intronic
1085532076 11:77197844-77197866 GAGCAGACCAAGCATCCCGCAGG - Intronic
1085584954 11:77693520-77693542 GGGCAGAACCATTCTCCATCTGG + Exonic
1089113184 11:116072958-116072980 GAGCATACTCAGCCTCCAGGGGG - Intergenic
1089199538 11:116715523-116715545 GAGCCGAATCAACCTCCTGCAGG + Intergenic
1089685998 11:120147216-120147238 GAGCAGCACATGGCTCCAGCAGG - Intronic
1089960569 11:122614047-122614069 GAGCAGACAGAGCCTACAGCAGG - Intergenic
1090271120 11:125387120-125387142 GAGCAAAACCAGCCTGCAACTGG - Intronic
1090807305 11:130210506-130210528 GAGCAAAACCAGCCCCTTGCTGG - Intergenic
1090828927 11:130407412-130407434 GAACAGAATCAGCCTACAGCAGG - Intronic
1091078497 11:132643445-132643467 GAGCAGAGCCAGCCTCCCTGAGG - Intronic
1091797689 12:3306541-3306563 GAGAGGAACCAGGCTTCAGCAGG + Intergenic
1092140863 12:6182536-6182558 CAGCAGAAAAAGCCTCCAGGCGG + Intergenic
1094024047 12:25943366-25943388 GATCAAAGCCAGTCTCCAGCTGG + Intergenic
1094414166 12:30200916-30200938 CTGCAGACCCAGCCTCCTGCGGG - Intergenic
1095981051 12:47975076-47975098 GAGCAGAAGCAGTGCCCAGCTGG + Intronic
1103048098 12:117755190-117755212 GAGTAGGAAGAGCCTCCAGCGGG + Intronic
1103332222 12:120162200-120162222 AAGCAGACGCAGACTCCAGCCGG - Intronic
1103896918 12:124279068-124279090 GAGCACAACCAGCTCCCCGCGGG - Intronic
1105862292 13:24426215-24426237 CAGAAGCGCCAGCCTCCAGCGGG + Intronic
1106335280 13:28778012-28778034 GAGCACACCCAGCCTGCAGCCGG - Intergenic
1110703929 13:78582957-78582979 GAGCAGAGCCTGGCACCAGCAGG + Intergenic
1113536400 13:111069862-111069884 GAGCAGAGCCAGGTTCTAGCAGG + Intergenic
1117466579 14:56000348-56000370 AAGGAGAACCAGCCTACAGAGGG + Intergenic
1117656730 14:57963242-57963264 GAGCCAGTCCAGCCTCCAGCAGG + Intronic
1118073449 14:62271356-62271378 GAGTAAAAGCAGCCTGCAGCTGG - Intergenic
1119866842 14:77981246-77981268 GCGCAGGAGCAGCCTCCACCTGG + Intergenic
1121761150 14:96446172-96446194 CAGCAGGACCGGCCCCCAGCAGG - Intronic
1122627077 14:103090255-103090277 GGGCAGAACCAGCCTCCTCCAGG + Intergenic
1124051319 15:26199521-26199543 GAGCTGAACCAGGAGCCAGCTGG - Intergenic
1124270248 15:28274226-28274248 GGTAAGAACCAGCCTCAAGCAGG + Intronic
1124604625 15:31161132-31161154 AGGCTGAACCAGCCTCCGGCCGG - Exonic
1125318935 15:38461290-38461312 TAGAAGAACCAGCCTTGAGCTGG + Intronic
1125493793 15:40170553-40170575 GAGCAGAACTATCCTCAAGGTGG + Exonic
1128903590 15:71447830-71447852 GAGCAGAACAAGACTCTAGAAGG - Intronic
1131507378 15:93030247-93030269 GAGCAGGACCAGCCCACAGGAGG - Intergenic
1132318081 15:100904856-100904878 AAGCAGAATGAGCCTCCAGGTGG - Intronic
1132801738 16:1757989-1758011 GAGAGGGAGCAGCCTCCAGCAGG - Intronic
1132938132 16:2492433-2492455 GAGCAGCACCAGCCTCCACTCGG - Intronic
1133280315 16:4661390-4661412 GAGCCGACCCAGCCTCCTCCGGG - Intronic
1137769665 16:51005816-51005838 GACCAGAAGCAGACCCCAGCTGG - Intergenic
1139670210 16:68487718-68487740 GAGCAGAGCCAGCCGTGAGCTGG - Intergenic
1139941996 16:70612112-70612134 CAGGAGAGCCAGCCTCCAACAGG + Intronic
1140729884 16:77846291-77846313 AAGCAGAAACAGCCCCCAGCAGG + Intronic
1141597346 16:85105374-85105396 CAGCCGCACCACCCTCCAGCTGG - Exonic
1141627077 16:85266964-85266986 GAGCAGAGCCATCCCCCTGCAGG - Intergenic
1142105971 16:88302964-88302986 CAGCAGTGCCAGCCTCCTGCAGG + Intergenic
1142402926 16:89870463-89870485 GAGAAGAAACAGCCTCCCCCAGG - Exonic
1143994581 17:10995629-10995651 TAGCAGCTGCAGCCTCCAGCAGG - Intergenic
1144554263 17:16267894-16267916 GAGCAGAGCCTGCCTCCACCAGG - Intronic
1144644461 17:16962788-16962810 GAGCAGAGCCGGCAGCCAGCAGG + Intronic
1146841408 17:36158058-36158080 AAGCAGAACCAGCCTTCTGGTGG - Intergenic
1146853659 17:36245692-36245714 AAGCAGAACCAGCCTTCTGGTGG - Intronic
1146869567 17:36369584-36369606 AAGCAGAACCAGCCTTCTGGTGG - Intronic
1147072443 17:37970208-37970230 AAGCAGAACCAGCCTTCTGGTGG - Intergenic
1147083967 17:38049745-38049767 AAGCAGAACCAGCCTTCTGGTGG - Intronic
1147099914 17:38173712-38173734 AAGCAGAACCAGCCTTCTGGTGG - Intergenic
1149613349 17:57975283-57975305 GGGAAGAGCCAACCTCCAGCAGG + Intronic
1149858117 17:60102831-60102853 AAGCAGAACCAGCCTTCTGGTGG + Intergenic
1150082918 17:62257002-62257024 AAGCAGAACCAGCCTTCTGGTGG - Intergenic
1151482741 17:74379932-74379954 GAGCAGAACCCGAGGCCAGCAGG - Intergenic
1152047156 17:77944694-77944716 GGGCAGAACCTGTCTCCAGGTGG + Intergenic
1152217749 17:79044253-79044275 CTGCAGGACCAGCCTCCAGCAGG - Intronic
1152822063 17:82442409-82442431 GAGCCCCCCCAGCCTCCAGCAGG - Exonic
1153380575 18:4434627-4434649 GAGAAGAACCAGCCTCTTGCAGG - Intronic
1155258396 18:24018250-24018272 AAGCAGAAGCGCCCTCCAGCAGG - Intronic
1155571199 18:27195858-27195880 GAACACAACCAGCATCCACCGGG - Intergenic
1158744530 18:60184197-60184219 GCACAGAACCTGCCTCCAGAAGG + Intergenic
1160125738 18:76169723-76169745 GACCAGGTCCAGCCTCCTGCGGG + Intergenic
1160467783 18:79096479-79096501 GCGCAGACTCATCCTCCAGCTGG - Exonic
1160711966 19:556218-556240 ACACAGAACCAGCCACCAGCAGG + Intergenic
1161470562 19:4454990-4455012 CAGCAGAACCAGCCTCGCCCTGG + Intronic
1162026106 19:7895034-7895056 AACCAGAGCCAGGCTCCAGCCGG + Intronic
1165065251 19:33224910-33224932 GGGCAGACCCAGCCTGCAGAAGG - Intronic
1165583662 19:36892946-36892968 GAGCAGAAGCGGCATCCTGCTGG - Intronic
1166735112 19:45079398-45079420 GACCAGAACGTCCCTCCAGCCGG - Intronic
1167253432 19:48413885-48413907 GACCAGCCCCAGCCCCCAGCTGG - Intronic
1168215590 19:54923028-54923050 GAGCAGAACCAGCGTGAGGCAGG + Intergenic
925987827 2:9230532-9230554 GGGCAGACTCAGCCTCCTGCAGG + Intronic
927191467 2:20519856-20519878 GATCAGCAGCAGCCTCCACCGGG + Intergenic
928649691 2:33391209-33391231 GAGCAGTGCCAGCCTCCAGAAGG + Intronic
932085237 2:68751840-68751862 GGCCAGGACCAGCCTTCAGCAGG - Intronic
932417619 2:71583385-71583407 GAGGGTAGCCAGCCTCCAGCTGG + Intronic
934105414 2:88691074-88691096 GTGCAGAACCAGTCTCCAAATGG + Intergenic
936286159 2:111182928-111182950 GAGCAGAGCTAGCCTTCAGTGGG - Intergenic
937008142 2:118536508-118536530 AAGCAGATCCAGCATCCAGGAGG - Intergenic
937120820 2:119439038-119439060 GAGCTGACCCACCCACCAGCAGG + Intergenic
937236089 2:120432658-120432680 GAGCAGAGCCAGCCCTCAGCAGG + Intergenic
937530057 2:122817498-122817520 GAGCCGACCCAGCCTCATGCAGG + Intergenic
938095274 2:128457321-128457343 GAGCAGAAGCAGGCAGCAGCAGG - Intergenic
938464579 2:131517670-131517692 GCGCAGACCCCGCCTCCAGTTGG + Intergenic
939006056 2:136788292-136788314 GAGCAGAACCATACTCCAATTGG - Intronic
945992595 2:216408610-216408632 GAGCATTGCCAGCCCCCAGCGGG - Intergenic
947030635 2:225788996-225789018 GAGCAGACCCACCCTCAAGCTGG - Intergenic
947708962 2:232299246-232299268 GAGCAGAAGCAACATCCTGCAGG - Intronic
947986488 2:234452068-234452090 GAACTGAACCACCCTTCAGCTGG + Intergenic
948547099 2:238740528-238740550 AAGTAGACCCAGCCTCCAGGTGG - Intergenic
948608134 2:239148965-239148987 CAGCAGAACCAGAGTCCACCTGG - Intronic
1170024249 20:11871866-11871888 GAGGAGGACCATCCTCCTGCTGG - Intergenic
1170326612 20:15161636-15161658 CAGCTGAACCAGCATCCAGATGG - Intronic
1172118224 20:32583939-32583961 GCGCAGGAGCAGCCTCCCGCGGG - Intronic
1172765163 20:37346849-37346871 GAGCAGGCCCAGCTACCAGCCGG + Intronic
1174445133 20:50585841-50585863 CAGCAGTACCAGCCTAGAGCAGG - Intergenic
1175308538 20:57994916-57994938 GAGGAGATCGAGGCTCCAGCAGG + Intergenic
1175719789 20:61279199-61279221 GGGCAGAGCCAGGCTCCAGAGGG + Intronic
1176011735 20:62900476-62900498 GAGTAGCACCATCCTCCAGTGGG - Intronic
1177144733 21:17395090-17395112 AAGCAGAAGCAGCTTCCAGAAGG + Intergenic
1180965827 22:19787506-19787528 GAGTGGCACCAGCCTCCTGCAGG - Exonic
1182031789 22:27164879-27164901 GAGCAGAGCTAGGCCCCAGCTGG - Intergenic
1182104786 22:27681690-27681712 GCCCAGAACCAGCCTGAAGCTGG + Intergenic
1183064268 22:35352764-35352786 GTGCAGGGCCAGCCTGCAGCAGG - Intergenic
1183437069 22:37802500-37802522 GCGCAGAGCCATCTTCCAGCTGG - Intergenic
1184861343 22:47174749-47174771 GGGCAGAACCAGTATACAGCGGG - Exonic
951191498 3:19777383-19777405 GAACTGAACCAGCCTCCCACTGG - Intergenic
952885862 3:38010586-38010608 CGTCAGAGCCAGCCTCCAGCAGG + Intronic
953141232 3:40231141-40231163 GAAGGGAACCAGCTTCCAGCTGG - Intronic
954198903 3:49012716-49012738 GACCAGGAGCTGCCTCCAGCAGG - Exonic
954397327 3:50299629-50299651 GCGCAGGCCCCGCCTCCAGCTGG + Intergenic
955267918 3:57465162-57465184 GAGCAGAACAAGACTGCAACTGG + Intronic
959650000 3:108742268-108742290 AAGCAGAACCACCCTCAATCTGG - Intergenic
961622892 3:128238829-128238851 GAGTTGACCCAGCGTCCAGCAGG - Intronic
962746956 3:138403949-138403971 TAGCAGAATCATTCTCCAGCTGG - Exonic
963733577 3:148994226-148994248 GAGCACGACCAGCCTCCTGGTGG - Exonic
965665295 3:171087406-171087428 CAGCAGAGCCATTCTCCAGCTGG - Exonic
967085989 3:186095842-186095864 CAGCTGCCCCAGCCTCCAGCTGG - Intronic
968546624 4:1202236-1202258 GGGCAGACCCACCCTCCAGCCGG - Intronic
968759231 4:2433516-2433538 GATCAGAGCCAGCCCCCCGCAGG + Intronic
968995186 4:3940973-3940995 GTGCTGAACCAGTCTCCAGGGGG + Intergenic
969429265 4:7144803-7144825 AGGCAGACCCAGCCACCAGCAGG - Intergenic
969435465 4:7186685-7186707 CAGCACTAGCAGCCTCCAGCTGG - Intergenic
969605370 4:8199726-8199748 GAGCAGAGCCAGCCTGTCGCTGG + Intronic
971250466 4:24969744-24969766 GAGCTGGAGCAGCCACCAGCAGG - Intronic
978102119 4:104854310-104854332 GTGCACACTCAGCCTCCAGCAGG + Intergenic
978478790 4:109163781-109163803 GATCAGAACCAGAAACCAGCAGG - Intronic
982306055 4:153932261-153932283 AAGCATATCCAGGCTCCAGCTGG - Intergenic
983049379 4:163027660-163027682 GAGCAGAACCACTGCCCAGCTGG + Intergenic
984767916 4:183413703-183413725 GCGCAGAACCAGGCTGCTGCTGG - Intergenic
984909289 4:184657244-184657266 CAGAAGAACCACCCTCCATCTGG + Exonic
985100365 4:186452370-186452392 GGGCAGAGTCAGCCTCCAGGTGG + Intronic
986094602 5:4542232-4542254 CAGCAGAAATAGACTCCAGCCGG - Intergenic
990609836 5:57445922-57445944 GAGAAGAAGCAGCCTCAACCGGG + Intergenic
997370800 5:133358447-133358469 GAGCAAAGGCAGCCCCCAGCAGG + Intronic
999251826 5:150187121-150187143 GAGCACAGCCAGCCTCCGCCAGG + Intergenic
1000165034 5:158640065-158640087 GAGCCCCACCAGCTTCCAGCTGG + Intergenic
1003466075 6:6381281-6381303 CAGCAGAACAAGCCTCATGCTGG + Intergenic
1006192934 6:32220629-32220651 GAGCAGTCCCAGCCTGCAGGGGG + Exonic
1007255498 6:40525281-40525303 TAGTAGAGCCAGCCTGCAGCAGG - Intronic
1007392133 6:41555572-41555594 CACCAGAACCAGGCTCCAGATGG + Intronic
1013617402 6:111857996-111858018 GATCCCAGCCAGCCTCCAGCAGG + Intronic
1014577832 6:123095220-123095242 GAGCAGAAATAGTCTCCTGCTGG - Intergenic
1022523033 7:31020018-31020040 GACTAGCACCAGCTTCCAGCTGG - Intergenic
1022866840 7:34430536-34430558 GAGTAGCACCTCCCTCCAGCAGG - Intergenic
1023151046 7:37201763-37201785 GAGCAGAAATAGCCACCAGATGG - Intronic
1024185627 7:46945633-46945655 GGGCAGGGCCAGCCTCCAGCAGG - Intergenic
1028173739 7:87628963-87628985 GAGGGGAACCAGCCTCCCGCCGG + Intronic
1033465613 7:141586733-141586755 GAGCAGAAGCAGCATCAAGGGGG + Intronic
1034491098 7:151393513-151393535 GTCCAGCACCAGCCTCCACCTGG + Intronic
1034646210 7:152650047-152650069 GAGGAAAACAAGCCTCCACCTGG + Intronic
1037768275 8:21784888-21784910 GAGCAGGACCCGCGTACAGCCGG + Intronic
1037890313 8:22620623-22620645 GAGCAGCAGCACCCTCCAGCAGG - Exonic
1043342191 8:79253481-79253503 GTGCAGAAACAGCCTCCAGCTGG - Intergenic
1044058706 8:87605661-87605683 GAGCATAAACAGCCTAAAGCAGG + Intronic
1047029634 8:120862345-120862367 GTGCAGTCCCAGACTCCAGCGGG - Intergenic
1047749068 8:127866424-127866446 GAGCAGGACAAGCCACCAGCAGG - Intergenic
1047940969 8:129827045-129827067 CAGCAGCACCAGCCTCCCGAGGG + Intergenic
1048294268 8:133202984-133203006 GAACAGAAGCTGCTTCCAGCAGG + Intronic
1048335428 8:133498829-133498851 GAACAGACCCAGGCTCCTGCTGG + Intronic
1048535629 8:135291626-135291648 GAGGAGAAAAAGCCTCCAACTGG - Intergenic
1049116176 8:140689839-140689861 AAGCAGAACCAGCTCCCAGCTGG - Intronic
1049183339 8:141234826-141234848 CAGCACAGCCAGGCTCCAGCAGG + Intronic
1049322302 8:142003024-142003046 CAGCTCAGCCAGCCTCCAGCAGG - Intergenic
1049560240 8:143306707-143306729 GAGCAGGCCCAGACTCCAGAAGG - Intronic
1051113902 9:13672777-13672799 GAGCAGATCCTGCCTTCAGAAGG - Intergenic
1051878619 9:21817187-21817209 GAGCAGCACCAGCCTCCTTAAGG - Intronic
1053287106 9:36856811-36856833 GAGCAGTACCAGACTGAAGCCGG + Intronic
1057179402 9:93021674-93021696 GGGCAGAACCAGCCTGGAGTTGG - Intronic
1057515163 9:95714416-95714438 GAGCACTACCAGCTTGCAGCTGG - Intergenic
1057576583 9:96247314-96247336 GAGCAGATCCTGACTGCAGCAGG + Intronic
1059545152 9:115168395-115168417 GAGCATAAGCTGCCTCTAGCGGG + Intronic
1060058073 9:120433050-120433072 TAGCAAAACCAGTCTACAGCAGG + Intronic
1061325540 9:129861671-129861693 CAGCAGTAGCAGCCCCCAGCCGG + Intronic
1062368241 9:136222362-136222384 GAGCAGAACCAGACAGGAGCAGG - Intronic
1062376237 9:136263096-136263118 GAGCAGAGCCAGACTTCAGGTGG - Intergenic
1062611463 9:137376453-137376475 GAGCAGAACTCGCCTGCAGGAGG + Intronic
1186776048 X:12865650-12865672 GAGCAGAGCCTGCCTCCCTCTGG - Intergenic
1187442553 X:19333122-19333144 CACCAGAAAGAGCCTCCAGCTGG + Intergenic
1189118255 X:38366094-38366116 GAGCAGAACCAGGCTTTTGCTGG + Intronic
1189388118 X:40554196-40554218 GTGCAGAACGAGCCTCCAGCGGG + Intergenic
1197709189 X:129653964-129653986 GAGCAGAGGCAGCCTCCCCCAGG - Intronic
1198609026 X:138376475-138376497 GAGTAGAACCAGCTTCCCACTGG + Intergenic
1200215953 X:154368380-154368402 GGGCAGACCCAGCCTGCAGATGG + Intronic