ID: 919807018

View in Genome Browser
Species Human (GRCh38)
Location 1:201386262-201386284
Sequence ACTGCCGGCCAGTCCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 179}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919807018_919807031 16 Left 919807018 1:201386262-201386284 CCTGGGTGGGACTGGCCGGCAGT 0: 1
1: 0
2: 1
3: 21
4: 179
Right 919807031 1:201386301-201386323 AGTAGAAGGGTGGGAGGGACGGG 0: 1
1: 0
2: 4
3: 96
4: 686
919807018_919807024 3 Left 919807018 1:201386262-201386284 CCTGGGTGGGACTGGCCGGCAGT 0: 1
1: 0
2: 1
3: 21
4: 179
Right 919807024 1:201386288-201386310 AGCCAGGTGGCAGAGTAGAAGGG 0: 1
1: 0
2: 2
3: 29
4: 273
919807018_919807028 10 Left 919807018 1:201386262-201386284 CCTGGGTGGGACTGGCCGGCAGT 0: 1
1: 0
2: 1
3: 21
4: 179
Right 919807028 1:201386295-201386317 TGGCAGAGTAGAAGGGTGGGAGG 0: 1
1: 0
2: 5
3: 65
4: 763
919807018_919807020 -10 Left 919807018 1:201386262-201386284 CCTGGGTGGGACTGGCCGGCAGT 0: 1
1: 0
2: 1
3: 21
4: 179
Right 919807020 1:201386275-201386297 GGCCGGCAGTGCCAGCCAGGTGG 0: 1
1: 0
2: 6
3: 39
4: 430
919807018_919807030 15 Left 919807018 1:201386262-201386284 CCTGGGTGGGACTGGCCGGCAGT 0: 1
1: 0
2: 1
3: 21
4: 179
Right 919807030 1:201386300-201386322 GAGTAGAAGGGTGGGAGGGACGG 0: 1
1: 0
2: 23
3: 550
4: 4688
919807018_919807029 11 Left 919807018 1:201386262-201386284 CCTGGGTGGGACTGGCCGGCAGT 0: 1
1: 0
2: 1
3: 21
4: 179
Right 919807029 1:201386296-201386318 GGCAGAGTAGAAGGGTGGGAGGG 0: 1
1: 0
2: 7
3: 102
4: 1110
919807018_919807023 2 Left 919807018 1:201386262-201386284 CCTGGGTGGGACTGGCCGGCAGT 0: 1
1: 0
2: 1
3: 21
4: 179
Right 919807023 1:201386287-201386309 CAGCCAGGTGGCAGAGTAGAAGG 0: 1
1: 0
2: 4
3: 52
4: 428
919807018_919807027 7 Left 919807018 1:201386262-201386284 CCTGGGTGGGACTGGCCGGCAGT 0: 1
1: 0
2: 1
3: 21
4: 179
Right 919807027 1:201386292-201386314 AGGTGGCAGAGTAGAAGGGTGGG 0: 1
1: 0
2: 2
3: 41
4: 393
919807018_919807026 6 Left 919807018 1:201386262-201386284 CCTGGGTGGGACTGGCCGGCAGT 0: 1
1: 0
2: 1
3: 21
4: 179
Right 919807026 1:201386291-201386313 CAGGTGGCAGAGTAGAAGGGTGG 0: 1
1: 0
2: 2
3: 36
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919807018 Original CRISPR ACTGCCGGCCAGTCCCACCC AGG (reversed) Intronic
900113771 1:1020173-1020195 ATGGCCGGCCGGTCCCACCCGGG + Exonic
900291266 1:1924543-1924565 ACTGCCCGCCAGCCCCTGCCTGG + Intronic
900401249 1:2473841-2473863 ACTGCCGGCCCTTCCCAGTCTGG + Intronic
900673355 1:3869432-3869454 ACTGCTGGGCTGTCCCACCCTGG - Intronic
900791087 1:4681397-4681419 GCTGCCAGCCACACCCACCCTGG + Intronic
901407351 1:9058076-9058098 CACGCTGGCCAGTCCCACCCAGG + Intronic
902445203 1:16458846-16458868 ACTTCCAGCCAGACCCAGCCAGG + Exonic
905917740 1:41697551-41697573 CCTGCCAGCCAGTCCCACCTTGG - Intronic
906613876 1:47222031-47222053 ACTGCAGGGCAGTTCTACCCTGG + Intronic
906709880 1:47921357-47921379 TCTGCCCGCCAGCCCCACCTTGG - Intronic
908774143 1:67624132-67624154 ACTGCTGGCCAGACTTACCCTGG - Intergenic
915289996 1:154877187-154877209 CCTGCCCACCACTCCCACCCAGG + Intergenic
915526594 1:156479951-156479973 CCTGCCTGCCAGTCCCACCAAGG + Intronic
917741398 1:177964882-177964904 ACAGCTGGCCAGGCCCATCCTGG + Intronic
918040834 1:180913022-180913044 TGCGCCGGCCAGACCCACCCGGG + Intergenic
919807018 1:201386262-201386284 ACTGCCGGCCAGTCCCACCCAGG - Intronic
919926461 1:202194208-202194230 ACTGCCCGCCTGTCCCCGCCTGG + Intronic
922215463 1:223516377-223516399 ACTTCCTTCCAATCCCACCCTGG + Intergenic
923956296 1:239025522-239025544 ACAGCCGGCCAGACCCACTGAGG + Intergenic
1066153579 10:32650917-32650939 CCTGCCTGCCAGCCCCTCCCAGG - Intronic
1067297084 10:44980742-44980764 ACTGCCCTCCAGCCCCACCCTGG - Intronic
1067832190 10:49616672-49616694 GCTGGGGGCCAGTCCCACTCAGG - Intronic
1068069984 10:52183471-52183493 ACAGTCTGGCAGTCCCACCCAGG - Intronic
1068395493 10:56456546-56456568 ACTGCTGGCCACTGCCACTCAGG + Intergenic
1070801638 10:79247452-79247474 ACTGCCTGCTTGGCCCACCCAGG - Intronic
1070967668 10:80539436-80539458 ACTGCTGGCCAGTCCCCACCAGG + Intronic
1076354225 10:129840419-129840441 AGTGCCGTCCAGCCCCACCATGG - Intronic
1076805876 10:132858494-132858516 GCTGCCAGCCACTCCCACCCTGG - Intronic
1077630596 11:3808677-3808699 GCTGCCGGGCAGCCCCACTCGGG + Intronic
1078423124 11:11228612-11228634 ACTCCCTGCCATACCCACCCCGG + Intergenic
1079344759 11:19642215-19642237 AGTCCCAGCCAGCCCCACCCAGG + Intronic
1079365705 11:19807534-19807556 GCTGCAGGCCAATCCCAGCCTGG + Intronic
1081046330 11:38278563-38278585 ACTGGCGGGCAGCTCCACCCGGG - Intergenic
1084973430 11:72783552-72783574 ACTGCCTGAGTGTCCCACCCAGG - Intronic
1089694403 11:120208177-120208199 ACTTTCTGCCAGTCCCACTCGGG - Intergenic
1091122022 11:133064754-133064776 ACTGCCGGCCCGCCCCGCGCCGG - Intronic
1104560643 12:129840703-129840725 ACTGTGTTCCAGTCCCACCCTGG + Intronic
1105780954 13:23704926-23704948 AGAGCTGGCCAGGCCCACCCAGG - Intergenic
1106413101 13:29524627-29524649 GCCGCCAGCCAGTCCTACCCCGG + Intronic
1114640025 14:24213381-24213403 CTGGCTGGCCAGTCCCACCCTGG + Intronic
1117183569 14:53217490-53217512 GCTGCCTGCCAGTCCCGCGCAGG + Intergenic
1119543116 14:75453320-75453342 ACAGCCAGCCAGGCCCACCAGGG - Intronic
1121599851 14:95195318-95195340 ACTGCTAGACAGTCACACCCAGG + Intronic
1123106588 14:105844650-105844672 ACTGCCAGCCAGCCCCAGTCTGG - Intergenic
1125716737 15:41823739-41823761 ACTGCCTGACCGTCCTACCCTGG + Exonic
1128841867 15:70856942-70856964 AAGGGAGGCCAGTCCCACCCAGG + Intronic
1132255640 15:100373753-100373775 ACGGGCGGCCAGACGCACCCCGG + Intergenic
1132729824 16:1355883-1355905 ACTGCCTGGCAGACCCAGCCCGG - Intronic
1133057438 16:3152814-3152836 ACAGCCTGCCCGTCCTACCCTGG - Intergenic
1135398610 16:22149925-22149947 ATTGCTGGCAAGTCCCACCACGG + Exonic
1136394837 16:29987209-29987231 CCTGCAGGCCACCCCCACCCTGG - Exonic
1136590804 16:31216607-31216629 ACCTCCGGCCAGCCCCTCCCGGG - Intronic
1136989270 16:35142276-35142298 TTTGCCTCCCAGTCCCACCCAGG - Intergenic
1140598729 16:76448777-76448799 ACTGCCTTCCACTTCCACCCTGG + Exonic
1141676070 16:85518090-85518112 ACAGCCGGCCAGCGCCAGCCAGG + Intergenic
1141873601 16:86806450-86806472 ACTGCCGTCAGCTCCCACCCTGG - Intergenic
1142116451 16:88358524-88358546 CCAGCCTGCCACTCCCACCCAGG + Intergenic
1144775997 17:17784900-17784922 GCAGCCCCCCAGTCCCACCCAGG + Intronic
1146465683 17:33084380-33084402 CCTGCCAGCCAGTCCCTCCCTGG + Intronic
1151554247 17:74838579-74838601 ACTGCTGGCCAGTTCCCTCCAGG - Exonic
1152067821 17:78121238-78121260 GCTACCTGCCAGTTCCACCCCGG - Intronic
1152117561 17:78397970-78397992 ACAGCCAGCCCGTGCCACCCTGG - Intronic
1152734589 17:81991237-81991259 ACTGGGGGCCACTCCCACCTGGG - Intronic
1160953732 19:1679959-1679981 TCTGCCTGCCGGCCCCACCCTGG - Intergenic
1161076999 19:2290630-2290652 GCTGCCGGCCTGCGCCACCCCGG - Exonic
1161241546 19:3225980-3226002 ATTGCCGGACACCCCCACCCGGG - Intronic
1161767737 19:6216417-6216439 GCTGCCGGCAAGACCAACCCGGG - Exonic
1162936209 19:13983011-13983033 CCTGCCGGATAGTCTCACCCTGG + Intronic
1163298637 19:16429376-16429398 ACTGCCTGCCAGGCCAACGCTGG + Intronic
1163370970 19:16901123-16901145 ACTGCCAGCCAGCCTGACCCTGG + Intronic
1163430329 19:17263435-17263457 ACAGCCTCCCAGTCTCACCCTGG - Intronic
1164693386 19:30226713-30226735 AGAGCCGGCCAGTCCCAGGCTGG + Intergenic
1167071892 19:47226665-47226687 TCTGGCGGGCGGTCCCACCCAGG - Exonic
1167455310 19:49594642-49594664 ACAGCGAGCCAGTCCCACCCTGG - Intronic
926314930 2:11702474-11702496 TCTGCAGGCCAGCCACACCCTGG + Intronic
929540818 2:42819327-42819349 ACTGCCGGCCTGTACCCCCAGGG - Intergenic
930163807 2:48184010-48184032 ATTGCAGGCCATTCCCACCCTGG + Intergenic
930334283 2:50025931-50025953 ACTTCAGGCCAGTCCCAACTGGG + Intronic
932106124 2:68944265-68944287 CCTGCCTGCCAGTCCCTCCCAGG - Intergenic
932426333 2:71637694-71637716 ACTTCTGGCCAGTGCCACCTGGG - Intronic
932614341 2:73222562-73222584 TCTGCCGGCCTGTTCCAACCCGG - Intronic
933918580 2:87021780-87021802 ACTGCTGGCCAGTCCCAAAATGG - Exonic
934004415 2:87748135-87748157 ACTGCTGGCCAGTCCCAAAATGG + Exonic
935767373 2:106382154-106382176 ACTGCTGGCCAGTCCCAAAATGG + Intergenic
936151283 2:110023626-110023648 ACTGCCTGCCCATTCCACCCTGG + Intergenic
936193392 2:110347743-110347765 ACTGCCTGCCCATTCCACCCTGG - Intergenic
937319218 2:120950993-120951015 CCCGCCGGCCAGTTCCACGCTGG - Intronic
938728782 2:134130103-134130125 ACTGCCGGCCCGTCCGCACCAGG + Intronic
941116629 2:161479937-161479959 AAAGCCTGGCAGTCCCACCCAGG + Intronic
946059710 2:216931409-216931431 ACATCCAGCCAGTCCCACCAAGG - Intergenic
948040285 2:234896171-234896193 ACTGCTGGCCTCTCCCACCATGG - Intergenic
948530200 2:238599320-238599342 ACTCCCGGGCAGACCCACGCGGG - Intergenic
1174794481 20:53510755-53510777 CCTGCCCTCCAGTCCCACCCTGG + Intergenic
1175279880 20:57796028-57796050 ATTGCAGGCCTGTGCCACCCAGG + Intergenic
1175524088 20:59621615-59621637 ACTGCCAGCCAGTGCCTGCCTGG - Intronic
1176024721 20:62979970-62979992 CCTGCCGTGCAGACCCACCCAGG + Intergenic
1176055064 20:63141005-63141027 ACTGGGGGCAAGTCCCAGCCTGG - Intergenic
1176179933 20:63745044-63745066 ACCCCAGGCCAGCCCCACCCCGG - Exonic
1177027112 21:15933580-15933602 ACTGCAAGCCAGATCCACCCAGG - Intergenic
1179721665 21:43319723-43319745 ACTGCCGGGCTGTCCCTCCTGGG - Intergenic
1179904267 21:44414082-44414104 CCTGCACGCCAGCCCCACCCAGG - Intronic
1180135498 21:45859534-45859556 ACTGGCTGCCAGCCTCACCCTGG + Intronic
1180137040 21:45868613-45868635 AATGCCCGCCAGACCCGCCCAGG - Intronic
1180193872 21:46182274-46182296 ACTGCCAGCCAGGACCAGCCTGG + Intronic
1180210849 21:46294973-46294995 ATGGCGGGCAAGTCCCACCCAGG - Intronic
1180839174 22:18950846-18950868 ACTCCCTGCCAGTGCCCCCCAGG - Intergenic
1181052005 22:20242317-20242339 ACTGCCGGGCACGCCCACTCTGG - Exonic
1183369932 22:37426805-37426827 ACCGCCGTCAAGCCCCACCCTGG + Intronic
1184069419 22:42138672-42138694 GCTGCCTGCTAGTCCCACACCGG - Intergenic
1184660721 22:45964409-45964431 CCTGCAGGCCAGCCCCCCCCAGG + Intronic
1184802128 22:46767844-46767866 TCTCTCGGCCAGACCCACCCTGG - Intronic
1184823855 22:46933648-46933670 GCTGCCGGCCAGTGCCACCCTGG - Intronic
1184881039 22:47304340-47304362 ACCGCCCTCCAGTCCCTCCCAGG - Intergenic
950012339 3:9732157-9732179 CCTGCCGGCCACTCCCGCCCTGG - Intronic
950207952 3:11094389-11094411 GCTGCCTGCCAGTCCTGCCCTGG - Intergenic
950473938 3:13204053-13204075 AAGGCCGGACAGCCCCACCCTGG - Intergenic
951758365 3:26117782-26117804 CCTGCCTGCCAGTCCTTCCCAGG + Intergenic
952889085 3:38029317-38029339 CGTGCCCGGCAGTCCCACCCAGG + Intronic
954704508 3:52472031-52472053 ACTGCCAGCCAGTCCCCCGCAGG - Intronic
954716889 3:52531436-52531458 ACTGCCGAGCAGACCCTCCCAGG - Intronic
957126231 3:76164853-76164875 CCTGCGGGGCAGTCCCAGCCAGG - Intronic
957888033 3:86316083-86316105 TCTGCCCTCCAGTCCCACCATGG - Intergenic
959141567 3:102492447-102492469 GCTGCCTGCCAGTTCCACGCTGG + Intergenic
960582108 3:119289603-119289625 ACTGTCTGCCAGTCCTGCCCAGG - Intergenic
960991754 3:123315988-123316010 ACTGGCAGCCAGCTCCACCCTGG - Intronic
961457180 3:127030060-127030082 TCTGCCAGCCAGGCCCACCTTGG - Exonic
961566655 3:127768857-127768879 ACTGACTGCTGGTCCCACCCTGG + Intronic
964641715 3:158915685-158915707 ACTGTTGGCCAACCCCACCCTGG - Intergenic
968581225 4:1396249-1396271 TCTGCAGGCCAGACCCCCCCAGG - Intergenic
969315777 4:6380733-6380755 ACCGCCCGCCACTCCCACCTCGG + Intronic
969428807 4:7140994-7141016 GCTGCCGGCCCACCCCACCCAGG - Intergenic
970566155 4:17334363-17334385 ACTACTGCCCAGTCCCACACTGG + Intergenic
971526119 4:27620939-27620961 CCTGCCTGCCAGCCCCTCCCAGG + Intergenic
975671326 4:76784025-76784047 ACTGCAGACCAGTTCCAGCCTGG - Intergenic
980009446 4:127579684-127579706 CCTGCCCGCCAGCCCCTCCCAGG + Intergenic
983939152 4:173523245-173523267 CCTGCCTGTGAGTCCCACCCAGG - Intergenic
985203322 4:187506021-187506043 GCTGCCTGCCAGTCCCGCGCCGG - Intergenic
985403798 4:189616616-189616638 GCTGCCTGCCAGTCCCGCGCCGG + Intergenic
985625406 5:982845-982867 TCTGCCTGCCAGCCCCTCCCTGG - Intergenic
985694207 5:1330888-1330910 TCTGCTGGCCACTCCAACCCAGG + Intronic
985698849 5:1358578-1358600 ACTGCCTGCTCGGCCCACCCTGG + Intergenic
988073576 5:26324851-26324873 GCTGCCTGCCAGTCCCACACTGG - Intergenic
989188111 5:38644137-38644159 CCTGCCAGGCAGTCCCTCCCCGG - Intergenic
989423409 5:41267656-41267678 ACTTCCAGCCACCCCCACCCTGG + Intergenic
991938564 5:71827887-71827909 ACAGTCTGCCAGTCCCACCCAGG - Intergenic
992459228 5:76944577-76944599 GCTGCTGGCAAGTCCCACCAAGG + Intergenic
996862751 5:128084043-128084065 CGTGCCGGGCAGTTCCACCCTGG - Exonic
997093677 5:130886329-130886351 AGTGCTGGCCAGTCCCAGCAGGG - Intergenic
997196804 5:131985752-131985774 ACTGCAGCCCAATCCCACCTAGG - Intronic
997286104 5:132679797-132679819 ACTGCTGTGCAGTCGCACCCAGG - Exonic
997830176 5:137142849-137142871 ACTGCCGCCCACGCCAACCCTGG + Intronic
1003629536 6:7774055-7774077 ACTGCAGTCCACTCCCACCTTGG - Intronic
1004456998 6:15800534-15800556 ACTGATGCCCACTCCCACCCTGG - Intergenic
1007239252 6:40413397-40413419 ACTGCCTCCCTGGCCCACCCAGG - Intronic
1008315145 6:50030522-50030544 CCTGCCCGCCAGTCCCTCCCAGG + Intergenic
1016354586 6:143204301-143204323 ACTTCCAGCCATTCCCACCAAGG - Intronic
1018108368 6:160511004-160511026 ACTGCTGGCCAGTCCCAAAATGG - Intergenic
1018123965 6:160664211-160664233 ACTGCTGGCCAGTCCCAAAATGG - Exonic
1018128203 6:160702286-160702308 ACTGCTGGCCAGTCCCAAAATGG + Exonic
1018135415 6:160773969-160773991 ACTGCTGGCCAGTCCCAAAATGG + Intergenic
1019316726 7:390393-390415 CCTCCCGGCCAGGCCCTCCCTGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019374790 7:683650-683672 GGTGCCGGCCAGGCCCACTCTGG - Intronic
1019929607 7:4214977-4214999 CCTGCCCCCCAGTGCCACCCAGG + Intronic
1023232553 7:38050060-38050082 GCTGCCTGCCAGTCCCATGCAGG - Intergenic
1026011668 7:66640981-66641003 ACTGCCGTCCAGCCCCACGGAGG - Exonic
1028109973 7:86928490-86928512 ACCGCCCGCCACTCCCACCTGGG - Intronic
1028985678 7:97006577-97006599 CCTGCCGGCCTCTCCCAGCCGGG + Intronic
1030710180 7:112740174-112740196 ACAGTCTGGCAGTCCCACCCAGG - Intergenic
1032536820 7:132671431-132671453 CCTCCTGGTCAGTCCCACCCAGG - Intronic
1034226563 7:149489508-149489530 ACTGCAGGCCCTCCCCACCCAGG - Intronic
1034430627 7:151039531-151039553 GCAGCCGGCCAGCCCTACCCCGG + Intronic
1034879847 7:154755234-154755256 GCTGCCTGCCTGTCCGACCCTGG + Intronic
1034900919 7:154907291-154907313 GCTGCCCGCCAGTCCCACGCAGG - Intergenic
1034951067 7:155297573-155297595 GCAGCCGGCCAGTCCCGCTCGGG + Intergenic
1037734772 8:21557004-21557026 GCTGCTTCCCAGTCCCACCCAGG + Intergenic
1038479222 8:27890345-27890367 AGTGCCAGCCTGCCCCACCCTGG - Intronic
1040014546 8:42689903-42689925 GCTGCCTGCCAGTCCCGCACCGG - Intergenic
1047100121 8:121667415-121667437 GCTGCCTGCCAGTCCCGCGCTGG + Intergenic
1048579979 8:135722775-135722797 ACTGCCAGCCTGTCCCTCCATGG - Intergenic
1049619912 8:143593434-143593456 CCTCCTGCCCAGTCCCACCCAGG - Intronic
1051452907 9:17216904-17216926 GCTGCCAGGCAGTTCCACCCAGG + Intronic
1054417423 9:64890158-64890180 ACTGCAGCTCAGTCCCATCCAGG - Intergenic
1056037502 9:82622691-82622713 TCTGCCTGCCAGGCCCACCAGGG - Intergenic
1057560816 9:96126774-96126796 TGTGCCGGCCTGGCCCACCCAGG + Intergenic
1057628563 9:96700858-96700880 GCTGCCTGCCAGTCCCGCGCCGG + Intergenic
1057902671 9:98961695-98961717 ACTACCGCCCAGGGCCACCCGGG + Intronic
1058721461 9:107768397-107768419 CCTGCCGGTCGGTCCCACCGTGG - Intergenic
1060732847 9:126049083-126049105 CCTGGCGACCAGTCCCTCCCTGG - Intergenic
1061181732 9:129028389-129028411 ACTGCCGTCCCGTCCCGCCCCGG - Intergenic
1061233362 9:129327912-129327934 ACTGCAGGCCAGGCCGCCCCAGG - Intergenic
1061820605 9:133225506-133225528 ACTGCGGGACAGGCCCGCCCTGG + Intergenic
1062237045 9:135515312-135515334 ACTGCCTGCCACTCCCCTCCCGG + Intergenic
1185717442 X:2354121-2354143 CCTGGTGGCCATTCCCACCCTGG + Intronic
1190687370 X:52887274-52887296 CCTACCGGCCAGGCCCACCTGGG + Intergenic
1190688919 X:52897560-52897582 ACTCCCGGCCAGCCCAACCCAGG - Exonic
1190697064 X:52958232-52958254 ACTCCCGGCCAGCCCAACCCAGG + Intronic
1190698612 X:52968518-52968540 CCTACCGGCCAGGCCCACCTGGG - Intronic
1193888797 X:87017376-87017398 CCTGCCCACCAGTCCCTCCCAGG + Intergenic
1197102271 X:122670589-122670611 CCTGCCAGCCAATCCAACCCAGG + Intergenic
1199981209 X:152921430-152921452 ACAGCAAGCTAGTCCCACCCCGG - Intronic
1200612135 Y:5337714-5337736 CCTGCCGCCCAGCCCCAGCCAGG - Intronic