ID: 919807954

View in Genome Browser
Species Human (GRCh38)
Location 1:201391890-201391912
Sequence CCTGATTTGCAGACAATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919807954_919807958 -3 Left 919807954 1:201391890-201391912 CCCTGCATTGTCTGCAAATCAGG 0: 1
1: 0
2: 2
3: 11
4: 152
Right 919807958 1:201391910-201391932 AGGTTAAAAGGTTCTAGAAAAGG 0: 1
1: 0
2: 3
3: 46
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919807954 Original CRISPR CCTGATTTGCAGACAATGCA GGG (reversed) Intronic
900167653 1:1249962-1249984 CCTGTTTGGCAGCCAAGGCAGGG + Intergenic
900498356 1:2987186-2987208 CCAGATTTGCAGAAAGTGCCCGG - Intergenic
900721258 1:4177243-4177265 CCTGATTTGATTACTATGCATGG + Intergenic
900900791 1:5514247-5514269 CCTGCTCTGCAGAGAATGGATGG - Intergenic
901502119 1:9658963-9658985 GCTCCTTTGCAGACACTGCATGG - Intronic
904124735 1:28230125-28230147 CCTGACCTGAAGACAATGCCAGG + Intronic
904450713 1:30609610-30609632 CCTGATTTGGAGCCAGTCCAGGG + Intergenic
912159761 1:106967472-106967494 CCTGCTTTCCAGACCATGCCTGG - Intergenic
913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG + Intergenic
917267434 1:173236293-173236315 CTGGATTTGAAGACATTGCAAGG - Intergenic
919807954 1:201391890-201391912 CCTGATTTGCAGACAATGCAGGG - Intronic
920429994 1:205912609-205912631 CCTGTTTGTGAGACAATGCAAGG - Intergenic
920597941 1:207291869-207291891 CCTGATTTTCAGAGGATGTATGG + Intergenic
920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG + Intergenic
923447890 1:234089494-234089516 ACTGATGTGAAGACACTGCAGGG - Intronic
923505977 1:234607593-234607615 TCTTAGTAGCAGACAATGCAGGG - Exonic
923751313 1:236748747-236748769 CCAGATTAACAGAAAATGCAGGG - Intronic
924907855 1:248475326-248475348 CCTGATTTACCGACAATGAATGG + Intergenic
924916254 1:248572756-248572778 CCTGATTTACCGACAATGAATGG - Intergenic
1063583677 10:7331883-7331905 CCTGAGTTGCTGAGAATACAGGG - Intronic
1065268369 10:24000782-24000804 CCCAATTTGTAGACAAGGCACGG - Intronic
1068818373 10:61344495-61344517 CCTGACCTGCAGAAACTGCAAGG - Intergenic
1069577564 10:69541663-69541685 CCTAAATTTCAGACAATGTATGG - Intergenic
1072741253 10:97911282-97911304 CCTGCTTTGTAGAAAATGAAGGG - Intronic
1073659518 10:105459264-105459286 CTTAATTTGCTGACAAAGCAGGG + Intergenic
1075698970 10:124456181-124456203 CCTGACTTTAAGACAATCCAAGG - Intergenic
1077237709 11:1489853-1489875 CCTGATTTCCTGGCACTGCAGGG + Intronic
1083245564 11:61424852-61424874 CCTGAATTACAGATACTGCATGG - Intronic
1085978192 11:81686622-81686644 CCTGATTTGTAAATAATTCAAGG - Intergenic
1087909160 11:103733093-103733115 CCTGAGTTTCAGACAAACCAGGG - Intergenic
1089025909 11:115269439-115269461 CCTGAATTGCAAACCATTCAAGG + Intronic
1089113809 11:116078110-116078132 CCTGAGTGGCAGACAAGGAAAGG - Intergenic
1089775490 11:120832644-120832666 CCTGATTTGCAGATAAGAGAGGG - Intronic
1090859517 11:130640505-130640527 CTTGATCTGCAGACATTCCAGGG + Intergenic
1091925992 12:4349807-4349829 CTTGATTTTCAGACCATGCATGG + Exonic
1094376003 12:29787817-29787839 CCTGAGTGCCAGAAAATGCAAGG - Intergenic
1097743958 12:63278629-63278651 CCTCATTTGGAGACAGTGAAAGG + Intergenic
1098076200 12:66734391-66734413 CCTGAATTTCAGACAATCAAAGG - Intronic
1098469191 12:70824555-70824577 CCTGGATTACAGACAATGCTTGG + Intronic
1099825863 12:87777048-87777070 GCTGATTTGCAAATAATGCAAGG - Intergenic
1106409118 13:29498854-29498876 CCTGATGCCCAGACACTGCACGG + Intronic
1107415486 13:40196100-40196122 ACAGATTTGGAGAAAATGCAGGG + Intergenic
1115074527 14:29371031-29371053 CCAGTTTTGCACACATTGCATGG - Intergenic
1117291946 14:54343069-54343091 CCTGACTTAGAGACAATGTAAGG - Intergenic
1118563711 14:67116169-67116191 CCTGAGTAGCAGACACTACAGGG - Intronic
1118750824 14:68806916-68806938 CCTGGTTTGCAGATAATCCAGGG + Intergenic
1119416508 14:74473900-74473922 CCTGTTTTGCAGTCAAAGAAAGG + Intergenic
1123156615 14:106233388-106233410 CCTCCTTTGTAGACCATGCAGGG + Intergenic
1123504544 15:20927302-20927324 CCAGATTTACATACAAAGCAAGG + Intergenic
1123561791 15:21501003-21501025 CCAGATTTACATACAAAGCAAGG + Intergenic
1123598035 15:21938284-21938306 CCAGATTTACATACAAAGCAAGG + Intergenic
1123739135 15:23218191-23218213 CTCTAATTGCAGACAATGCAAGG - Intergenic
1124290353 15:28447147-28447169 CTCTAATTGCAGACAATGCAAGG - Intergenic
1124292884 15:28470401-28470423 CTCTAATTGCAGACAATGCAAGG + Intergenic
1130062150 15:80577813-80577835 ACAGATTAGCAGACATTGCAGGG + Intronic
1131819486 15:96257867-96257889 CCTGAGTTACAAACAATCCATGG + Intergenic
1202970136 15_KI270727v1_random:228129-228151 CCAGATTTACATACAAAGCAAGG + Intergenic
1132810275 16:1793835-1793857 CCTGGGGTGCAGACAGTGCAGGG + Intronic
1133678503 16:8098404-8098426 CCAGAATTGCAGCAAATGCACGG + Intergenic
1133678512 16:8098491-8098513 CCTGAATTGCAGCGAATGTAGGG + Intergenic
1134827291 16:17294823-17294845 CCTGGTGTCCAGACAGTGCATGG + Intronic
1136670983 16:31857159-31857181 CCTGATATGAAAACAATACAAGG + Intergenic
1138493105 16:57388407-57388429 CCTAATTTGGAGGCAGTGCAGGG - Intergenic
1141076414 16:81009888-81009910 CATGATTTTTATACAATGCAGGG - Intronic
1144428269 17:15166186-15166208 CCAGATTTGCTGCCATTGCAGGG - Intergenic
1146502057 17:33372783-33372805 CCTGAGGTGCAGACAATGCGTGG - Intronic
1147352659 17:39863808-39863830 CCAGATTTGCAGCCATTTCAGGG + Intronic
1149269068 17:54956795-54956817 CCTGCTTTGGAGACTATGCCCGG - Intronic
1151005260 17:70428574-70428596 ACTGATTTCCAGACAATATATGG + Intergenic
1151980090 17:77503474-77503496 CCTGAGCTCCAGAGAATGCAGGG - Intergenic
1155772617 18:29721550-29721572 CTTCATATGCAGACAATTCATGG - Intergenic
1156192820 18:34739424-34739446 CCTGCTTTGCAGACTATTAATGG + Intronic
1157872426 18:51242736-51242758 CCTGAGTTGGTGACATTGCATGG + Intergenic
1161601823 19:5188852-5188874 CATGATTTGCAGGCAATGTAGGG + Intronic
1165549364 19:36570777-36570799 CTTGATTTACAGAAAATGTATGG + Intronic
1165775030 19:38399276-38399298 CCTGATTTGGGGGCAATGAAGGG - Intergenic
1168404177 19:56102360-56102382 CCTGACATGCAGACACAGCAAGG + Intronic
925084582 2:1097957-1097979 CCTGGATTTCAGACAATGCCTGG + Intronic
926775035 2:16413629-16413651 CCTCATTAGCAGACAATGTTTGG + Intergenic
927471010 2:23376703-23376725 CATGATTTCTAGACAATGGAAGG - Intergenic
928601796 2:32910580-32910602 CAAGCCTTGCAGACAATGCAGGG - Intergenic
928922104 2:36536991-36537013 CCTGTTTTGTAAACAATACAGGG - Intronic
933030842 2:77326773-77326795 CCTTATTTCCAGCCAATGAATGG + Intronic
933655356 2:84882010-84882032 GCAGATTTGCATACAATGCGGGG + Intronic
935699861 2:105802099-105802121 TCAGATTTGCAGACGATGCATGG + Intronic
936629564 2:114187123-114187145 GCTGATTTTCAAACAATTCAAGG + Intergenic
938703437 2:133899423-133899445 CCTGAGGGGCAGACATTGCAGGG - Intergenic
939523614 2:143263761-143263783 ACTGATTTCCAGGCAATGGAAGG - Intronic
940429140 2:153567479-153567501 CCTGCTTTGCAGGCACAGCATGG + Intergenic
940443264 2:153744964-153744986 CCTGGTTTGCAGGCAGAGCATGG + Intergenic
945030335 2:205657219-205657241 CATGAGTTGCTAACAATGCAAGG + Intergenic
946140135 2:217683138-217683160 CCTGACTTGAAAACAATTCATGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171750485 20:29044289-29044311 CCTGGGTTGGAGACAAAGCAGGG + Intergenic
1172414012 20:34749682-34749704 CCTCATGTGCAGGCCATGCAGGG - Exonic
1173396760 20:42687534-42687556 CCTGATTAGCAGGCAAGGAAAGG - Intronic
1174612786 20:51812864-51812886 CGTGCTTTGAAGACAAAGCAAGG + Intergenic
1174997506 20:55586858-55586880 CTTGATTTACAGACACTACAGGG + Intergenic
1176314726 21:5231626-5231648 CCTGGGTTGGAGACAAAGCAGGG - Intergenic
1180392518 22:12297585-12297607 CCTGGGTTGGAGACAAAGCAGGG - Intergenic
1180407229 22:12567183-12567205 CCTGGTTTGGAGACAAAGCAGGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183658379 22:39204208-39204230 CCTGTTTTACAGACAAGGGAGGG + Intergenic
952108881 3:30099591-30099613 GCTGATCTCCAGACAATCCACGG - Intergenic
952140765 3:30476477-30476499 CCTCATTTGCAGATAAGGAATGG - Intergenic
952264614 3:31773636-31773658 TCTGGTTTGCAGAAAATACAGGG - Intronic
952625703 3:35400296-35400318 CCTGATTTGCAGCATATGGAAGG + Intergenic
953494379 3:43373542-43373564 CCAGATGTGCAGAGAAAGCAGGG - Intronic
956938187 3:74127761-74127783 CCTATTTTCCAGACAATGCCAGG - Intergenic
956981911 3:74648816-74648838 ACTGTTTTGAAGACAATGCTGGG + Intergenic
957809668 3:85203686-85203708 TCTGCTTTGCAGATACTGCATGG - Intronic
959667733 3:108940545-108940567 CATGATTGGCAGCCATTGCAAGG + Intronic
962117419 3:132525768-132525790 CCTCATTTTCAGACAAGGCATGG - Exonic
963274281 3:143314764-143314786 CCAGCTTTGCAGACAGTGCCAGG - Intronic
969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG + Intronic
969345282 4:6565967-6565989 CCTGCATTGCAAACAATTCAGGG - Intergenic
974432967 4:61822072-61822094 TCTGATTAGCAGACATTACAGGG + Intronic
975794460 4:77992330-77992352 CCTCTTTTGCAGATAAGGCAAGG - Intergenic
975808194 4:78135453-78135475 ACTGATCTGCAGAGAAAGCATGG + Intronic
978041277 4:104065959-104065981 CAGGAATTGCAGACAATGAAGGG - Intergenic
979665228 4:123303942-123303964 CCTATTTTGCAGACGATTCAAGG + Intronic
980088805 4:128419999-128420021 ACAGATTTGCACACACTGCAGGG - Intergenic
982083213 4:151810028-151810050 CCAGATTAGCAGACAATGCAAGG - Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
987842060 5:23234529-23234551 TCTGATTTGCATAGAATTCAGGG - Intergenic
995905640 5:117119292-117119314 ACTGATTTGCACACTATCCAAGG - Intergenic
998635744 5:143953003-143953025 CCTCATGTGCACACAATCCAAGG - Intergenic
998848590 5:146334147-146334169 GCCACTTTGCAGACAATGCAAGG + Intronic
1001883793 5:175270267-175270289 CATGAATTGAAGACAAAGCATGG - Intergenic
1002206890 5:177569146-177569168 CCTGAGTTGCAGACAGTGCAGGG - Intergenic
1006020327 6:31114133-31114155 CCTGATCTGCAGCCAATGGCAGG - Intergenic
1011909358 6:92416516-92416538 CCTGATTTGCAGTAAATTCTGGG - Intergenic
1012599643 6:101079357-101079379 CCTGATCTGCATACAAACCATGG + Intergenic
1013452043 6:110291921-110291943 CTTGATTTCAAGACAATGTAAGG - Intronic
1014283919 6:119474139-119474161 CCTGAGATTAAGACAATGCAAGG + Intergenic
1015413708 6:132924042-132924064 CCTCATCTGTAGACACTGCAAGG - Intergenic
1015419912 6:132995593-132995615 CATGATGTGCAGACAATTCCAGG - Intergenic
1020958794 7:14776657-14776679 CCTGAATTTCAGAGAATGTATGG + Intronic
1029734082 7:102455915-102455937 GCTGCTTTACAGACAGTGCACGG + Exonic
1035154124 7:156898338-156898360 CCTGTCTTGAAGACAGTGCAAGG - Intergenic
1035626880 8:1077079-1077101 CCTGATTTGCTGTCAATGTTTGG + Intergenic
1036031861 8:4982457-4982479 CCTCATTTGGAGACAAAGAACGG + Intronic
1037379290 8:18267069-18267091 CCTGACTTACAGAAATTGCAAGG + Intergenic
1039631326 8:39114652-39114674 CCTGATTCCCAGTCAAAGCAAGG + Intronic
1039847125 8:41333467-41333489 GCTGTTTTGCAGTCACTGCATGG - Intergenic
1039878757 8:41610127-41610149 TCTGATATGCAGAGAATCCAAGG - Intronic
1040520718 8:48173800-48173822 CCTGATTTACATACAATTCATGG - Intergenic
1042123831 8:65516738-65516760 ACTGAGTTTCAGAAAATGCAAGG + Intergenic
1046050452 8:109015355-109015377 TCTCATTTGCAGACAATAGAAGG - Intergenic
1046716164 8:117569799-117569821 CATGATTAGTAGACCATGCAGGG - Intergenic
1047299511 8:123600958-123600980 CCTCATTTGCAGACTCTGCTGGG + Intergenic
1048945202 8:139440566-139440588 CCTAATTTGGAAACAAGGCAAGG + Intergenic
1050895511 9:10881268-10881290 ACTGAATTGCAGACAGTCCAAGG + Intergenic
1052140046 9:24970004-24970026 CCTGCTTTACACACAATGGACGG + Intergenic
1053237930 9:36472803-36472825 CCTGATTTATAGAGAATCCAGGG + Intronic
1055122461 9:72677540-72677562 CCTGTATTGGAGAGAATGCACGG - Intronic
1058076169 9:100654029-100654051 CCTGATTTACTGCAAATGCAAGG - Intergenic
1059415411 9:114159246-114159268 CCTGATTTTCAGAGATTACAAGG + Intronic
1060886267 9:127154600-127154622 CTTGTTTTCCAGAGAATGCAGGG + Intronic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1203453618 Un_GL000219v1:144168-144190 CCTGGGTTGGAGACAAAGCAGGG - Intergenic
1187277561 X:17829147-17829169 CTTGATTTGCAGTCATTTCAAGG + Intronic
1187925467 X:24245730-24245752 CCTACTTCCCAGACAATGCAAGG + Intergenic
1188021799 X:25166903-25166925 GAGGATTTCCAGACAATGCAAGG + Intergenic
1188822460 X:34792250-34792272 CATGATTTAAAGACAATGTATGG - Intergenic
1194600568 X:95915798-95915820 CCTCAGTTGCAGAGAATGGATGG + Intergenic