ID: 919808598

View in Genome Browser
Species Human (GRCh38)
Location 1:201395520-201395542
Sequence AAGGCGGCCGGATCACTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1389
Summary {0: 1, 1: 5, 2: 84, 3: 376, 4: 923}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919808591_919808598 -4 Left 919808591 1:201395501-201395523 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 919808598 1:201395520-201395542 AAGGCGGCCGGATCACTTGAGGG 0: 1
1: 5
2: 84
3: 376
4: 923
919808593_919808598 -5 Left 919808593 1:201395502-201395524 CCAGCACTTTGGGAGGCCAAGGC 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
Right 919808598 1:201395520-201395542 AAGGCGGCCGGATCACTTGAGGG 0: 1
1: 5
2: 84
3: 376
4: 923
919808587_919808598 26 Left 919808587 1:201395471-201395493 CCACTGGGTGCGGTGGCTCATGC 0: 18
1: 78
2: 323
3: 813
4: 1155
Right 919808598 1:201395520-201395542 AAGGCGGCCGGATCACTTGAGGG 0: 1
1: 5
2: 84
3: 376
4: 923

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919808598 Original CRISPR AAGGCGGCCGGATCACTTGA GGG Intronic