ID: 919808934

View in Genome Browser
Species Human (GRCh38)
Location 1:201397165-201397187
Sequence CGTGCTAGGGTGTGACAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919808934_919808939 -3 Left 919808934 1:201397165-201397187 CCGTGCTGTCACACCCTAGCACG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 919808939 1:201397185-201397207 ACGGTCCTCCCCAGCCCAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 183
919808934_919808938 -6 Left 919808934 1:201397165-201397187 CCGTGCTGTCACACCCTAGCACG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 919808938 1:201397182-201397204 AGCACGGTCCTCCCCAGCCCAGG 0: 1
1: 0
2: 1
3: 30
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919808934 Original CRISPR CGTGCTAGGGTGTGACAGCA CGG (reversed) Intronic
900876949 1:5349606-5349628 CTTGCTGGGGACTGACAGCAAGG - Intergenic
901328917 1:8389494-8389516 CGTGCTAGGGTGCGCCTGCTGGG - Intronic
903567473 1:24279009-24279031 ATTGCTAGGCTGTGCCAGCAAGG + Intergenic
908656246 1:66392045-66392067 CATGCTAGAGTGTAGCAGCAAGG - Intergenic
911532808 1:99065786-99065808 AGGGCTTGGGTGTGACTGCAGGG - Intergenic
919808934 1:201397165-201397187 CGTGCTAGGGTGTGACAGCACGG - Intronic
924270798 1:242330475-242330497 TGTGCTAGGGAGTCACAGGAAGG - Intronic
1064617744 10:17179838-17179860 CATTCTAGGGTTTGATAGCAAGG - Intronic
1066714148 10:38268383-38268405 TGTGCTAGGGAGTCACAGGAAGG + Intergenic
1069806417 10:71127909-71127931 GGTGCTAGGGAGCCACAGCAGGG - Intergenic
1070466018 10:76724464-76724486 AATGCTAGGGTGTGTCTGCACGG - Intergenic
1074747026 10:116544731-116544753 GGTGCTAGGATGTGACAACAAGG + Intergenic
1074896546 10:117782214-117782236 CTTGCTAAGGAGGGACAGCAAGG + Intergenic
1077147019 11:1050895-1050917 CGTGCACGGGCGGGACAGCAAGG - Intergenic
1084274272 11:68043698-68043720 CGGGCTGGGAGGTGACAGCAGGG - Intronic
1084550198 11:69836499-69836521 TGTGCTAGCGGCTGACAGCAGGG - Intergenic
1090794666 11:130124402-130124424 TGTGCTTTGGTGTGACAGGAAGG + Intronic
1093771976 12:23028818-23028840 CCTGCTAGAATGTGACATCAAGG + Intergenic
1098449033 12:70598140-70598162 TGTTCTAGGGTTTGACAGCCCGG + Intronic
1099933398 12:89099008-89099030 CGTGCAAAGGGCTGACAGCATGG + Intergenic
1102602171 12:114039652-114039674 TGTGCTGGTGTCTGACAGCAGGG - Intergenic
1110356387 13:74572486-74572508 CTTGCTAGTGTGGGTCAGCAAGG + Intergenic
1122653523 14:103240854-103240876 AGTGCTTGGGGCTGACAGCAAGG - Intergenic
1122919086 14:104872604-104872626 CGTGAGAGCGTGTGACAGCTGGG + Intronic
1123779112 15:23607852-23607874 CGTGCTAAGTTGGGACACCAAGG + Intronic
1126940262 15:53759099-53759121 CCTGCTGGGGTGTGACAGCTTGG - Intronic
1135855226 16:26003748-26003770 CGTGTTGGGGTGTTTCAGCATGG + Intronic
1139611325 16:68061082-68061104 CTTGTCAGGGTCTGACAGCAGGG - Exonic
1139884439 16:70198464-70198486 CGTGGTATGCTGTGACTGCAGGG - Intergenic
1140368079 16:74397027-74397049 CGTGGTATGCTGTGACTGCAGGG + Intergenic
1142573483 17:891120-891142 CGTGCCACTGTGTGACAGCCTGG - Intronic
1143727176 17:8857091-8857113 TGTGCTAGAGTGTGACAGGGAGG - Intronic
1146241334 17:31230085-31230107 CAAACTAGGGTGTGACAGTAAGG + Intronic
1152037840 17:77884166-77884188 CGAGCTTGGCTGTGACGGCAGGG - Intergenic
1153542503 18:6170776-6170798 CATGCTGGGGTGTGAAACCAGGG + Intronic
1162014644 19:7838473-7838495 CTTGATAGGATGTGACAGAAAGG - Intronic
1168567714 19:57438953-57438975 CGTGATAGAGTATGGCAGCAGGG + Intronic
1168583815 19:57576929-57576951 TATGGTAGGGTGTGAGAGCAAGG - Intronic
925090188 2:1148881-1148903 CCTGCCAGGCTGTGACACCAGGG - Intronic
930456710 2:51615081-51615103 TCTGCTAGGGTATGACAGAAGGG - Intergenic
937313288 2:120915258-120915280 CCTGCTAGGCTGTGTCTGCAGGG + Intronic
940678265 2:156751844-156751866 CGTTCAAGGCTGTGACAGAATGG - Intergenic
947632440 2:231662792-231662814 CGTGCTAGGGAGTGTAAGCAAGG - Intergenic
948429336 2:237909229-237909251 AGGGCCAGGGTGTGACTGCACGG - Intronic
1169862519 20:10167580-10167602 CGTCCTAGGGTCTTAGAGCATGG - Intergenic
1170980298 20:21206291-21206313 CCTTCTGGGGTGTGACATCATGG + Intronic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1172864296 20:38083839-38083861 CATTCTGGGGTGTCACAGCACGG - Intronic
1174442740 20:50569026-50569048 CGGGCTAGCGTGTGGCTGCACGG + Intronic
1182875450 22:33687621-33687643 CCTGCTGGGGTGTGTCAGCCTGG - Intronic
1184389941 22:44197532-44197554 TGTGATATGGTGTGGCAGCATGG + Intronic
1185248093 22:49784072-49784094 CGTGCTGGGGCGTGAGAGCGCGG - Intronic
1185248120 22:49784236-49784258 CGTGCTGGGGCGTGAGAGCGCGG - Intronic
953213550 3:40897380-40897402 CTGGCTGGGGTGTGAAAGCAGGG + Intergenic
953581362 3:44160077-44160099 CCGGGTAGGGTTTGACAGCAAGG - Intergenic
957155909 3:76543819-76543841 AGTGCTTGGGAGTGACAACAGGG - Intronic
959205005 3:103296461-103296483 CGTGCTTTGGTTTGACAGAAAGG + Intergenic
965400616 3:168208420-168208442 AGTGATAGGGTGTTACAACAGGG + Intergenic
965545130 3:169908208-169908230 CTTGCTAGGGTGGGTCACCAAGG + Intergenic
966025186 3:175270693-175270715 CGTGCTTGTGTGTGATAGCCTGG + Intronic
968724786 4:2241768-2241790 CGTGCTTAGGTGTCACAGCTGGG - Exonic
969136140 4:5030455-5030477 CATGCCAGGATATGACAGCATGG - Intergenic
972233010 4:37097256-37097278 CCTGCTAAGATGTGACGGCAGGG + Intergenic
982953654 4:161734714-161734736 ATTGCTTTGGTGTGACAGCAGGG - Intronic
984645051 4:182210147-182210169 CGCCCGAGGGTGTGAGAGCAGGG - Intronic
990245815 5:53862402-53862424 TGTACAACGGTGTGACAGCAAGG - Intergenic
991425821 5:66490650-66490672 TGTGCTAGGCTGAGAGAGCAAGG + Intergenic
993716589 5:91280773-91280795 CGGGCGAGTGTGTGACTGCAGGG - Intergenic
999136471 5:149323295-149323317 AGAGCTAGGGTGGGACACCAAGG - Intronic
1001192981 5:169647677-169647699 GGGGAGAGGGTGTGACAGCAGGG - Intronic
1002819465 6:711237-711259 TGGGCTAGGGCGTGTCAGCAGGG - Intergenic
1006227865 6:32555647-32555669 TGTTCTAACGTGTGACAGCATGG - Intronic
1006837804 6:37009564-37009586 CGTGCTGGGATGTGACTCCAGGG - Intronic
1007210569 6:40190704-40190726 GGTGCTAGTTAGTGACAGCAGGG - Intergenic
1012078175 6:94721655-94721677 GGTGCTGGGGTGAGGCAGCATGG - Intergenic
1022959633 7:35414124-35414146 CTTGTTATTGTGTGACAGCATGG + Intergenic
1026778565 7:73247893-73247915 GGTACTAGGGTGGGACTGCATGG + Intergenic
1027019422 7:74801295-74801317 GGTACTAGGGTGGGACTGCATGG + Intronic
1027068604 7:75144646-75144668 GGTACTAGGGTGGGACTGCATGG - Intronic
1027838615 7:83278835-83278857 CATGCTGGGGAGTGACTGCAAGG + Intergenic
1029624917 7:101714634-101714656 CCTGAAAGGGAGTGACAGCATGG + Intergenic
1034387395 7:150751937-150751959 CTTGCTTGGGTGTAAAAGCAAGG - Intergenic
1034896824 7:154881625-154881647 CCTGCGGGGGTGTCACAGCAAGG - Intronic
1034994216 7:155567982-155568004 GGTGCTAGGAGGTGTCAGCAGGG + Intergenic
1048871924 8:138806350-138806372 TGTGCTAGGATGTGACACTACGG - Intronic
1049016088 8:139921173-139921195 CGTGGTATGGTGAGACTGCAGGG - Intronic
1050122696 9:2324183-2324205 AATGCTAGGGTGTTACACCAAGG + Intergenic
1058599907 9:106658219-106658241 GTTCCTAGGGTATGACAGCAGGG - Intergenic
1060670527 9:125465659-125465681 CGTGCTAGGGAGTGAGGACACGG + Intronic
1061701962 9:132422837-132422859 CGTGCTGCGATGTGACAGCTGGG + Intronic