ID: 919810063

View in Genome Browser
Species Human (GRCh38)
Location 1:201403429-201403451
Sequence GTTGCTGATGCTCCACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 216}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919810063_919810065 -4 Left 919810063 1:201403429-201403451 CCAGGATGTGGAGCATCAGCAAC 0: 1
1: 0
2: 3
3: 28
4: 216
Right 919810065 1:201403448-201403470 CAACTGTCATAGTTGTTGATGGG 0: 1
1: 0
2: 0
3: 8
4: 87
919810063_919810067 22 Left 919810063 1:201403429-201403451 CCAGGATGTGGAGCATCAGCAAC 0: 1
1: 0
2: 3
3: 28
4: 216
Right 919810067 1:201403474-201403496 GTAAGTGGTACAACTAGCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 125
919810063_919810070 27 Left 919810063 1:201403429-201403451 CCAGGATGTGGAGCATCAGCAAC 0: 1
1: 0
2: 3
3: 28
4: 216
Right 919810070 1:201403479-201403501 TGGTACAACTAGCAAAGGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 103
919810063_919810069 26 Left 919810063 1:201403429-201403451 CCAGGATGTGGAGCATCAGCAAC 0: 1
1: 0
2: 3
3: 28
4: 216
Right 919810069 1:201403478-201403500 GTGGTACAACTAGCAAAGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 91
919810063_919810066 7 Left 919810063 1:201403429-201403451 CCAGGATGTGGAGCATCAGCAAC 0: 1
1: 0
2: 3
3: 28
4: 216
Right 919810066 1:201403459-201403481 GTTGTTGATGGGAGTGTAAGTGG 0: 1
1: 0
2: 0
3: 26
4: 290
919810063_919810068 25 Left 919810063 1:201403429-201403451 CCAGGATGTGGAGCATCAGCAAC 0: 1
1: 0
2: 3
3: 28
4: 216
Right 919810068 1:201403477-201403499 AGTGGTACAACTAGCAAAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 174
919810063_919810064 -5 Left 919810063 1:201403429-201403451 CCAGGATGTGGAGCATCAGCAAC 0: 1
1: 0
2: 3
3: 28
4: 216
Right 919810064 1:201403447-201403469 GCAACTGTCATAGTTGTTGATGG 0: 1
1: 0
2: 1
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919810063 Original CRISPR GTTGCTGATGCTCCACATCC TGG (reversed) Intergenic
900355471 1:2260142-2260164 GTTCCTGCTGCTCCACGTCCTGG + Intronic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
902225712 1:14995277-14995299 GCATCTGCTGCTCCACATCCCGG + Intronic
902283420 1:15390657-15390679 GTTGCTGAGGTGCCACATCTTGG + Intronic
902951519 1:19886841-19886863 GATGCTGATGCTCCTAGTCCGGG + Intronic
903304831 1:22405944-22405966 GTTCCTTTTTCTCCACATCCTGG + Intergenic
904729580 1:32579109-32579131 TTTGCTGAAGCTGAACATCCAGG - Intronic
908400448 1:63768067-63768089 GATCCAGTTGCTCCACATCCTGG + Intergenic
908702376 1:66916044-66916066 GTTGCCCATTCTCCACCTCCTGG - Intronic
912744489 1:112234027-112234049 GTCTCTGATTCTCTACATCCAGG + Intergenic
913327739 1:117641720-117641742 GCTGCTGTTGCTCCACTTGCAGG + Intergenic
914778180 1:150757914-150757936 GTTTGTGATGCTTCACAACCTGG - Exonic
914787151 1:150844524-150844546 GTTGCTGATGCTCCTGGTCTCGG - Intronic
915786217 1:158615235-158615257 GTTGCGGATGCAACACAACCTGG - Exonic
916274919 1:162983380-162983402 GTGGCTCATGCTACACAGCCAGG + Intergenic
918077041 1:181178392-181178414 GCTGCTCCTCCTCCACATCCTGG - Intergenic
918450729 1:184655190-184655212 GTTTCTGATGCTTGTCATCCTGG - Intergenic
918468101 1:184842377-184842399 GATGCTGATGCTACAGGTCCAGG + Intronic
919810063 1:201403429-201403451 GTTGCTGATGCTCCACATCCTGG - Intergenic
920751887 1:208686116-208686138 GTCGCTGATGCTCCACTAGCAGG + Intergenic
921187011 1:212678843-212678865 GTTGCTGTAGCTCCAAGTCCTGG + Intergenic
921605651 1:217151336-217151358 GTTTCTGAAGCACCATATCCTGG + Intergenic
922180230 1:223227637-223227659 GGTGCTGCTGCTCGTCATCCTGG - Exonic
922331616 1:224581908-224581930 GTAGCTGCAGCTGCACATCCTGG + Intronic
922442670 1:225669454-225669476 GTTGCATTTGCTTCACATCCTGG + Intergenic
922466579 1:225848956-225848978 GGTGCTGCTGCTCACCATCCTGG - Exonic
922565652 1:226600025-226600047 GATGCTGATGTGCCCCATCCTGG - Intronic
924827815 1:247560136-247560158 GGTGCTGATAATCCACAGCCCGG + Intronic
1062846860 10:714205-714227 GTCCCTGATACTCCACATCCTGG + Intergenic
1062927786 10:1329845-1329867 TTTGCTGATGCTCCTCATGAAGG + Intronic
1063123881 10:3123717-3123739 GGTGCTGAGGGGCCACATCCTGG + Intronic
1063196740 10:3750240-3750262 AGTGCTGAGCCTCCACATCCTGG - Intergenic
1064337762 10:14458999-14459021 GTGCCTGTTCCTCCACATCCAGG - Intronic
1064366072 10:14709056-14709078 GTTCCCACTGCTCCACATCCTGG - Intronic
1064552946 10:16521035-16521057 GCTGCTGGTGATCCTCATCCCGG - Exonic
1064566694 10:16646958-16646980 GTTGCAGTACCTCCACATCCTGG - Intronic
1065296812 10:24283756-24283778 GTTCCTGTTGCTCTGCATCCTGG + Intronic
1065618090 10:27549631-27549653 GTTGCTAATGCTAAACAACCAGG - Intergenic
1065861568 10:29876734-29876756 GTTGCTGCTGCTGCACATGGTGG + Intergenic
1066478609 10:35773193-35773215 GTTCCTGTTGCTCCACAACCTGG + Intergenic
1069432217 10:68347790-68347812 GTTGCAGTTGCTCCATGTCCAGG - Intronic
1071644596 10:87350055-87350077 GTTCCTGTTTCTTCACATCCTGG - Intergenic
1074172258 10:110953196-110953218 GTTCCTGTTTCTCCACAGCCTGG + Intronic
1076079949 10:127570313-127570335 GAGGCTGATCCTCCACATCATGG - Intergenic
1078389178 11:10921326-10921348 CTTGCTCATGATCCATATCCAGG + Intergenic
1079225265 11:18599551-18599573 ATAGCTGATGCTCCAGATCAGGG - Intergenic
1080473368 11:32567775-32567797 AGTTCTGTTGCTCCACATCCTGG + Intergenic
1081370460 11:42294396-42294418 GTTTCTGTTGCTCCACATTCTGG + Intergenic
1083374510 11:62208737-62208759 GCTGCTGATGGTCCTCATGCTGG + Exonic
1083381229 11:62270222-62270244 GTTGCTGATGGTCCTCATGCTGG + Exonic
1083413767 11:62512221-62512243 GTTGCAGCTGATCCACCTCCTGG - Intronic
1084518237 11:69647850-69647872 GTATCTGAGGCTCCACATCCAGG - Intronic
1087272864 11:96129411-96129433 GATGCTGATGCTGCTCATCCAGG + Intronic
1089340467 11:117754023-117754045 CTTGCTGCCTCTCCACATCCTGG - Intronic
1089840322 11:121411891-121411913 GTTGATAATGCTCCACATGGAGG + Intergenic
1091953810 12:4619169-4619191 GTTTCAGTTTCTCCACATCCTGG - Intronic
1094238379 12:28193688-28193710 GTTCCAGTTGCTCCACATTCTGG + Intronic
1094460676 12:30694654-30694676 GATGCTGAAGCTCCAGGTCCTGG + Intronic
1094500875 12:31019927-31019949 GTTGCTGTGTCTCCTCATCCTGG - Intergenic
1097336726 12:58391958-58391980 GATGCTGATACTTCTCATCCAGG - Intergenic
1097826558 12:64180095-64180117 GTTGCTGATGCTGCAGGACCAGG - Intergenic
1098212691 12:68183195-68183217 ATTCCTGTTGCTCAACATCCTGG - Intergenic
1099226405 12:79974938-79974960 GATGCTGATGCTGTAAATCCAGG - Intergenic
1099762093 12:86936935-86936957 GTTCCTGTTGCTCCACAACCTGG - Intergenic
1102122629 12:110454426-110454448 GTTGCTCAACCTCCACCTCCAGG + Intronic
1104461133 12:128957013-128957035 GTGCCTGATGCCCCACAGCCTGG - Intronic
1106085666 13:26539762-26539784 GTTGGAGATGCTTCACATCGTGG + Intergenic
1106212244 13:27660642-27660664 GTGGCTAAGGCTCCTCATCCAGG - Intronic
1106466102 13:30015917-30015939 CTTGCTCCTGTTCCACATCCCGG + Intergenic
1107006471 13:35617720-35617742 GTTTCTGTTGCTCCAACTCCTGG + Intronic
1107150709 13:37107548-37107570 GTTACTGATCCTCCCCATTCTGG - Intergenic
1108044668 13:46372286-46372308 GCGGCTGTTGCTGCACATCCTGG + Exonic
1113823644 13:113233052-113233074 GTTGCTAATTCTCTACATCTAGG - Intronic
1116143281 14:41029335-41029357 GTTCTTGTTGCTCCACATCTTGG + Intergenic
1118882245 14:69839215-69839237 GTTAGTTATGCTCCACCTCCTGG + Intergenic
1119033095 14:71207710-71207732 GAAGCTGATGCTACAAATCCAGG - Intergenic
1119859402 14:77925424-77925446 GTGGCAGAAGCTCCACTTCCAGG - Intronic
1120332417 14:83110926-83110948 GTTCCTGTTGCTCCATATCCTGG - Intergenic
1120726010 14:87942249-87942271 GATGCTGATGCTGCTCGTCCAGG + Intronic
1120957596 14:90096722-90096744 CTTGCTGATTCTCCACTTTCTGG - Intronic
1122673725 14:103392463-103392485 GATGTTGATGCTCCAGGTCCGGG + Intronic
1122711611 14:103662766-103662788 GCTGCGGACGCTCCACAACCTGG + Exonic
1124817988 15:33015929-33015951 GATGCTGATGCTCCTGGTCCAGG - Intronic
1125289849 15:38133957-38133979 GATGCTGATGCTGCTGATCCAGG + Intergenic
1125688992 15:41581379-41581401 GTTGCTGGTACTCCAAATTCTGG + Exonic
1126896059 15:53258315-53258337 GTTTCTGAGGCTCCACGTGCAGG + Intergenic
1126937303 15:53725315-53725337 ATTCCTGTTGCTCCACATCCCGG - Intronic
1128340000 15:66815407-66815429 GTTCCTGTTGCTCCACATCCTGG - Intergenic
1129021436 15:72523000-72523022 GTTCCTACCGCTCCACATCCTGG - Intronic
1130434805 15:83887049-83887071 GATGCTGATGCTGCAGGTCCAGG - Intronic
1130687839 15:86054464-86054486 GTTCCTGAGGCACCACATCAAGG + Intergenic
1131187793 15:90290515-90290537 GTTTCTGATGCACCAGGTCCAGG + Intronic
1131767188 15:95691015-95691037 GAAGCTGATGCTGCACATCTAGG - Intergenic
1131948571 15:97654814-97654836 CTTGCTCATGCTCTCCATCCGGG + Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1134860593 16:17556909-17556931 ATTTCTGATGCTTCACATTCCGG - Intergenic
1135346299 16:21691445-21691467 GTTTCTATTTCTCCACATCCAGG + Intronic
1137726282 16:50658892-50658914 GCTCCTGTTGCTCCACATGCTGG - Intergenic
1137966384 16:52937808-52937830 GTTCCTGTTGCTTCACATCCTGG - Intergenic
1138139416 16:54555166-54555188 GTTCCAGTTGCTCCACATCCTGG - Intergenic
1141012597 16:80416906-80416928 GTTGCTGATGCTGCTGGTCCAGG + Intergenic
1142400204 16:89854600-89854622 GATGCTGATGCAGGACATCCGGG + Exonic
1144769396 17:17751193-17751215 CTTGATGAGGCTCCACTTCCTGG - Intronic
1146059457 17:29596783-29596805 TGTGGTGATGCCCCACATCCAGG - Intronic
1146601642 17:34222177-34222199 TTTCCTCATGCTCCACTTCCTGG + Intergenic
1149744754 17:59085551-59085573 GTTCCAGTTTCTCCACATCCTGG - Intronic
1150598671 17:66630433-66630455 GTTGGGGATGCTCTGCATCCAGG - Intronic
1150605466 17:66686852-66686874 GTTGCTGATGCTGCCAGTCCAGG + Intronic
1151948564 17:77333092-77333114 GTTCTAGTTGCTCCACATCCTGG + Intronic
1152940021 17:83164100-83164122 GCTCCTGTTGCTACACATCCTGG + Intergenic
1153339581 18:3960628-3960650 GTTTCTGATTCTAGACATCCGGG + Intronic
1154167276 18:12025502-12025524 GTTCCTGTTGCTCCACATCCTGG + Intronic
1157141447 18:45111169-45111191 GTTGCTGATGCTCCACAAAATGG - Intergenic
1158030320 18:52955678-52955700 GTTCCTCTTGCTCCACAACCTGG + Intronic
1158613093 18:58961230-58961252 GATGCTGATGCTGCTCATCTTGG + Intronic
1158930301 18:62318286-62318308 GTTGCACTTGCTCCACATCCTGG - Intergenic
1160179180 18:76619549-76619571 GTTCCTGTTGCCCAACATCCTGG + Intergenic
1160416233 18:78713318-78713340 GTGGCTGTTTCTCCTCATCCCGG + Intergenic
1160710351 19:548560-548582 GGTGCTGGGGCTCCACACCCTGG + Exonic
1160810001 19:1009176-1009198 GCTGCTGCTGCTCCACCTCGGGG - Exonic
1161399380 19:4060652-4060674 GTTCCTGATGCTCCCCGTGCTGG - Intronic
1161533977 19:4807463-4807485 GTTTCTGAGGCTGCACAGCCAGG - Intergenic
1162307057 19:9881465-9881487 GTTGCTTATGCTGCCCAGCCTGG - Intronic
1162394051 19:10405801-10405823 GTTGCTGCTGCCCCAAAGCCTGG - Intronic
1163887022 19:19975017-19975039 GTACCTGATGCCCCATATCCTGG - Intergenic
1163967578 19:20761739-20761761 GTACCTGATGCCCCATATCCTGG + Intronic
1164150580 19:22546939-22546961 GATGCTGATGCTCCCCAGCCAGG - Intergenic
1166267537 19:41694576-41694598 GTTGCTCATGTTCCCAATCCAGG + Intronic
1167503527 19:49860156-49860178 GTTGCTGTTGCTCCTGCTCCAGG - Exonic
926632972 2:15154316-15154338 GTTGCTGAGGCTCTTCATCGGGG + Intergenic
927553841 2:24019219-24019241 GTTGCTGATGCTGCTGGTCCAGG - Intronic
928526213 2:32143827-32143849 GTTGCTCAACCTCCACCTCCCGG - Intronic
931236258 2:60415006-60415028 GTTCCAGTTGCTCCACATCTTGG + Intergenic
932107711 2:68961976-68961998 CTTGCTGATGCACCAGAACCTGG + Intergenic
936058643 2:109280222-109280244 GCTGCTGCTTCTCCACAGCCAGG - Intronic
936251470 2:110871349-110871371 CTTGCTGATACTCCACTTCCAGG + Intronic
937360572 2:121226757-121226779 GTTCCTGTTGCTCTACATTCTGG - Intronic
939546195 2:143557006-143557028 GTTCCTGTTGCTCCACATCTTGG - Intronic
940468152 2:154059112-154059134 GTTGCTTAGGTTCCAAATCCTGG - Intronic
945897028 2:215495023-215495045 ATTCCTGTTGTTCCACATCCTGG - Intergenic
948160497 2:235819442-235819464 GATGCTGATGCTGCTAATCCAGG + Intronic
1170122630 20:12927072-12927094 GGTTCTGATGCTGTACATCCTGG - Intergenic
1170385379 20:15810494-15810516 GTTCCTGTTTCTCCACATCAAGG + Intronic
1170892732 20:20389810-20389832 TTTCCTAATGCTCCACATCTAGG - Intronic
1171254565 20:23679701-23679723 GTGGCTGAGGCTCCTAATCCAGG + Intergenic
1171261051 20:23734973-23734995 GTGGCTGAGGCTCCTAATCCAGG + Intergenic
1171270170 20:23810815-23810837 GTGGCTGAGGCTCCTAATCCAGG + Intergenic
1173832193 20:46097723-46097745 GTTGCTGATGCTGCTAGTCCAGG - Intergenic
1174281110 20:49439983-49440005 GTGGCTGCTCCTCCACCTCCAGG - Intronic
1174709268 20:52687427-52687449 GATGCTGATGCTCCTGGTCCAGG + Intergenic
1175218298 20:57402939-57402961 GTTTCTGATGGTCCACAGTCGGG + Intronic
1178080708 21:29061530-29061552 ATTTCTGTTGCTCCACCTCCGGG + Exonic
1180010336 21:45045595-45045617 GTTCCTGTTGCTCCACACCCTGG - Intergenic
1181339531 22:22166706-22166728 GTTTCTGAGGCACCACAGCCTGG - Intergenic
1183675231 22:39295331-39295353 GTTGCTGAGGCGCCAGCTCCTGG - Intergenic
1183976408 22:41514987-41515009 GGTGGGGATGCTCCACACCCAGG + Intronic
1184076521 22:42182685-42182707 GTTGCTGATGCTGCTGTTCCAGG - Intronic
1184360997 22:44018613-44018635 GGTGCTGAGGCTACACACCCAGG - Intronic
1184834858 22:47015069-47015091 GTTCCTGATGCCCCACCTGCGGG + Intronic
949703618 3:6788566-6788588 GTTGCTCTTACTCCACATCCTGG + Intronic
951641675 3:24843657-24843679 GATGCTGATGCTGCTCATCGGGG - Intergenic
952628134 3:35431599-35431621 GTTCCTGTTGCTCCACATCCTGG + Intergenic
953457336 3:43053622-43053644 GCTGCGGCTGGTCCACATCCTGG + Exonic
954642944 3:52112908-52112930 GATGCTGATGCTGCTGATCCAGG - Intronic
958084134 3:88784389-88784411 GTTCCTGTTGCTCCACAACCTGG - Intergenic
958797391 3:98720153-98720175 GTTGCTGATGCTGCCAGTCCAGG - Intergenic
959086245 3:101853405-101853427 GTGGCTGCTGCTCTACATGCTGG - Exonic
959848975 3:111066290-111066312 TTTGTTGTTGCTCCTCATCCAGG - Intergenic
960996923 3:123346302-123346324 CTGGCTGAATCTCCACATCCGGG - Intronic
961973078 3:130990853-130990875 GTTGCTGAGGCTCCAAATTTTGG - Intronic
962775245 3:138652933-138652955 GATGCTGATGCTCCTCATCAGGG + Exonic
963690541 3:148495789-148495811 GATGCTGATGCTGCAGGTCCAGG + Intergenic
964785304 3:160389960-160389982 GTTCCTATTTCTCCACATCCTGG + Intronic
965408078 3:168295283-168295305 GTTGCTGATGCTGCTAGTCCAGG + Intergenic
967738550 3:192980313-192980335 GATGCTGATGCTGCTGATCCAGG + Intergenic
967845676 3:194040842-194040864 TTGGCTGCTTCTCCACATCCAGG - Intergenic
971796575 4:31236259-31236281 GTTGCTGATGCTCGTAATGCTGG - Intergenic
973138585 4:46737082-46737104 GTTTCTTTTGTTCCACATCCTGG + Intronic
973156869 4:46965998-46966020 GCTTCTGAAGCACCACATCCAGG + Intronic
973716099 4:53678019-53678041 GTAGCTGAACTTCCACATCCTGG - Intronic
973783571 4:54314293-54314315 GTTGCTCATGCCCCAAATCTTGG + Intergenic
974691594 4:65304434-65304456 TATGCTGAAGCTCCAAATCCCGG + Intergenic
977345895 4:95815296-95815318 GTTGCTGATATTCCACATTTTGG + Intergenic
979193773 4:117895566-117895588 GTTGCTAATGCTCCTCAGCTTGG - Intergenic
985912837 5:2896782-2896804 TTTGCTGAAGCTACACGTCCAGG + Intergenic
985932329 5:3068230-3068252 GATGCTGATGCTCTCCAGCCAGG - Intergenic
987915944 5:24214703-24214725 GTTCCTGGTGCTCAACAACCTGG + Intergenic
990196807 5:53326529-53326551 CTTGGTGATGCTCATCATCCGGG + Intergenic
993935782 5:94000292-94000314 GTTCCTATTGCTCCACATCCTGG + Intronic
996017031 5:118551029-118551051 GATGCTGATGCTACAGGTCCAGG + Intergenic
996392371 5:122975077-122975099 TTTCTTGATTCTCCACATCCAGG + Intronic
997082874 5:130761561-130761583 GTTGCTGATGCTGCTGGTCCAGG - Intergenic
997400498 5:133598275-133598297 GATGCTGATACTTCAGATCCTGG - Intronic
997825819 5:137106140-137106162 GTTGCTACTGCTCCAGGTCCTGG - Intronic
998360729 5:141584192-141584214 GTTGCTGTTTCTCCTCATTCAGG + Exonic
999893188 5:156000898-156000920 GTTGCTGATGCTGCTGATCCAGG + Intronic
1001677608 5:173531490-173531512 GTTGCTTTCTCTCCACATCCTGG - Intergenic
1003287953 6:4751266-4751288 GTTGCTGATGCTGCGACTCCAGG - Intronic
1004518440 6:16340389-16340411 GTTGGTGATTCTTCACATCATGG + Intronic
1004917327 6:20344092-20344114 GTTTCTGTTTCCCCACATCCAGG - Intergenic
1006170959 6:32092254-32092276 GATGCTGATGCTGCAGGTCCAGG + Intronic
1006514487 6:34538397-34538419 CTTGCGGATGCCCCACAGCCGGG + Exonic
1010102601 6:72126792-72126814 GTTCCTTATTCACCACATCCAGG - Intronic
1010452093 6:76014740-76014762 GTTGCTGATGCTGCAGCTGCAGG - Intronic
1011596654 6:89023148-89023170 GCTGCTGATCCTCCAAATGCAGG - Intergenic
1011761996 6:90577182-90577204 TTTGCTGATGCTCTGCATCCAGG + Intronic
1014269128 6:119316107-119316129 GTTGCTGATGCTTCCCATGTTGG - Intronic
1016695625 6:146991629-146991651 ATTGATGATGCTCTACCTCCCGG - Intergenic
1018964860 6:168476916-168476938 GTTGCTGATGCTCAACTTGAAGG - Intronic
1019762791 7:2826001-2826023 GTTCCTGTTGCTCCACTTCCTGG - Intronic
1020348095 7:7186428-7186450 GATGATGATGCTGCAGATCCAGG - Intronic
1023053992 7:36277208-36277230 GTTCCTGCTGCTCTACTTCCTGG - Intronic
1024127455 7:46314864-46314886 TTTGCTGATCCACCACATGCAGG - Intergenic
1024598674 7:50961330-50961352 GATGCTGATGCTGCTCATCCAGG + Intergenic
1026102367 7:67393724-67393746 GGTGGAGATGGTCCACATCCCGG + Intergenic
1033157634 7:138970669-138970691 GATGCTGATGCTGCTGATCCGGG + Intronic
1035685513 8:1520983-1521005 GTTCCTGAGGCTCCGCGTCCTGG + Intronic
1039725233 8:40208378-40208400 ATTGCTGATTCTCCAAATACTGG - Intergenic
1039819989 8:41126643-41126665 GTTCCTGAGGCCCCAGATCCAGG + Intergenic
1039837030 8:41264905-41264927 GTGGCTGCTGCTCCACATTGCGG + Exonic
1044526738 8:93260976-93260998 ATTGCCTATGCTCCACTTCCTGG + Intergenic
1045836999 8:106534198-106534220 GATGCTGATGCTGCCAATCCTGG + Intronic
1048148141 8:131865502-131865524 CTTGGTGAGGCTCCACTTCCTGG - Intergenic
1048458333 8:134598549-134598571 GCTGCTGATGCTCGGCCTCCTGG - Intronic
1049609638 8:143548480-143548502 GTTGGTGAGGGTCCACTTCCTGG - Intergenic
1052590105 9:30480941-30480963 GTTTCTACTTCTCCACATCCTGG + Intergenic
1053319824 9:37086825-37086847 GATGCAGATGAACCACATCCAGG + Intergenic
1054887528 9:70214795-70214817 TTTTCTGATTCTCCACATCAAGG - Intronic
1055604005 9:77949202-77949224 GTGGCTGTTGCTCTACAGCCTGG - Intronic
1056088856 9:83184920-83184942 GATGCTGATGCTGCACGTTCCGG - Intergenic
1056242650 9:84664161-84664183 GTTCCAGTTGCTCCACATTCTGG + Intergenic
1056724673 9:89104284-89104306 GTTGCTCATGCTGCCCATCCAGG - Intronic
1056800187 9:89685724-89685746 CTTGCAGATGTCCCACATCCAGG - Intergenic
1057014971 9:91643220-91643242 GTTCCTCAGGCTCCCCATCCAGG + Intronic
1058350417 9:104014886-104014908 GATGCTGATGCTGCTGATCCAGG + Intergenic
1059466951 9:114475011-114475033 GTTCCTCTTCCTCCACATCCTGG - Intronic
1061328643 9:129878985-129879007 GGTGCTCATGCTCCACACCAAGG - Intronic
1185693671 X:2177836-2177858 GTTCCTGTTTCTCCACATCCAGG - Intergenic
1186710678 X:12192821-12192843 GATGCTGATGCTGCTGATCCAGG + Intronic
1189277741 X:39798992-39799014 GATGCTGATGCTGCTCTTCCAGG + Intergenic
1191201421 X:57786513-57786535 TTTCCTAATTCTCCACATCCTGG - Intergenic
1195466243 X:105182800-105182822 ATTGCTGATGCCACACATGCTGG - Intronic
1195762001 X:108256639-108256661 GATGCTGATGCTCCTGGTCCAGG - Intronic
1195961221 X:110388743-110388765 GATGCTGATGCTCCTGGTCCAGG + Intronic
1196023887 X:111019927-111019949 GTTCCTATTTCTCCACATCCTGG - Intronic
1198787103 X:140300715-140300737 GTTTCTTATGCTCCAAAACCAGG - Intergenic
1199912582 X:152303324-152303346 GTTCCTATTCCTCCACATCCTGG - Intronic
1202044774 Y:20727139-20727161 GCTGTTTATGCTCCACTTCCCGG + Intergenic