ID: 919811620

View in Genome Browser
Species Human (GRCh38)
Location 1:201412375-201412397
Sequence CCTGGTGGGCAGAAGTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 0, 2: 4, 3: 76, 4: 635}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919811615_919811620 -10 Left 919811615 1:201412362-201412384 CCCACATATAATTCCTGGTGGGC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 919811620 1:201412375-201412397 CCTGGTGGGCAGAAGTGGGAAGG 0: 1
1: 0
2: 4
3: 76
4: 635
919811613_919811620 -9 Left 919811613 1:201412361-201412383 CCCCACATATAATTCCTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 919811620 1:201412375-201412397 CCTGGTGGGCAGAAGTGGGAAGG 0: 1
1: 0
2: 4
3: 76
4: 635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919811620 Original CRISPR CCTGGTGGGCAGAAGTGGGA AGG Intronic
900475489 1:2874531-2874553 CCTGGTGGGCAAAATTCAGAGGG + Intergenic
901322679 1:8349170-8349192 CCTGGTGGCCAGGATGGGGATGG + Intergenic
901439716 1:9270519-9270541 CCCGGTGGACAGAACTAGGAGGG - Exonic
901535939 1:9883097-9883119 CCTGGGTGGCAGCAGCGGGACGG + Intronic
901632416 1:10654373-10654395 CTTCGTGGGCAGAAGCGGGGAGG - Intronic
902361077 1:15942995-15943017 CCAGGTGGGGAGCAGGGGGAAGG - Intronic
902936689 1:19769706-19769728 GCTGGTGGGAAGAAGTTGGACGG + Intronic
903058490 1:20653385-20653407 TATGGGGGGCAGCAGTGGGAGGG - Intronic
903378545 1:22881447-22881469 CCTGGGAGGCTGAGGTGGGAGGG + Intronic
903927696 1:26842467-26842489 CCAGCTGGGCAGAAGTGGAGTGG + Intronic
904373017 1:30062600-30062622 CCTGGAGGGCAGAAGTTCGGAGG - Intergenic
904624036 1:31792237-31792259 CCTGGTGGGCAGGGGCTGGAAGG + Exonic
904702045 1:32363502-32363524 CAAGGTGGGCAGAAGTTGGAAGG + Intronic
904707748 1:32404296-32404318 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
905569500 1:38991990-38992012 CCTGGAGGGCGGGGGTGGGATGG + Intronic
905579967 1:39076838-39076860 ACTGGTGGTCAGATTTGGGAAGG + Intergenic
905826318 1:41028331-41028353 GGAGGTGGGCAGAAGTGGAAGGG + Intronic
905882424 1:41473368-41473390 GCTTTTGGGCAGATGTGGGAGGG + Intergenic
906445303 1:45891387-45891409 CTTAGGGGGCTGAAGTGGGAAGG + Intronic
906745020 1:48215434-48215456 CCAGGTGGGAAGAATTGGGGGGG + Intergenic
907446750 1:54513059-54513081 CCTGGAGTGCAGGAGTGGGGAGG + Intergenic
907517329 1:55000848-55000870 CCTGGGGGACAGCAGAGGGATGG + Intronic
907527590 1:55062972-55062994 CCTGGTGGGTGGATGTGGGTGGG + Intronic
907698987 1:56765102-56765124 ACTGCTGGGCAGAAGTAGGAAGG + Intronic
907748914 1:57243588-57243610 CCTGGAAGTCAGAAGTGGGTTGG - Intronic
908592013 1:65645783-65645805 ATTGCTGGGCAGGAGTGGGAGGG + Intergenic
909255455 1:73415035-73415057 CCTGGAGTCCAGAAGCGGGAGGG - Intergenic
910707416 1:90144608-90144630 ACTGGAGTGCAGAAGTGAGATGG - Intergenic
910963815 1:92787783-92787805 ACTGGTGGGTACCAGTGGGAAGG + Intronic
911037869 1:93569419-93569441 CATGGTGGGCAGCAGGAGGAAGG - Intronic
911102639 1:94106341-94106363 CCTGCTGGGAGGAAGTGTGAAGG - Intronic
911951225 1:104176304-104176326 CCTGGTGGGTAGTGGTGGAATGG - Intergenic
912137616 1:106680935-106680957 GTTGGTGGGCAGAAGTTTGAGGG - Intergenic
912218086 1:107639699-107639721 CTTGGCAGGCTGAAGTGGGAGGG + Intronic
912365951 1:109134033-109134055 ATGGGTGGGCGGAAGTGGGAGGG + Intronic
912375805 1:109209180-109209202 CCAGGTGGGAAGGAGTGAGATGG - Intergenic
912560519 1:110548274-110548296 CCTGAGGGGCAGAAGTGGGAAGG - Intergenic
912572165 1:110632741-110632763 CCTGGAGGGCAGAAGTAAGAAGG + Intergenic
912875565 1:113355199-113355221 CTTGGGAGGCAGAAGTGGGAGGG - Intergenic
913244578 1:116860357-116860379 TCTGGTGGGCAGGAGTTGGGGGG + Intergenic
913286017 1:117227480-117227502 CATAATGGACAGAAGTGGGAGGG + Intergenic
913349074 1:117837926-117837948 CCCGCTGGTTAGAAGTGGGAGGG + Intergenic
913372923 1:118120770-118120792 TCTGGTAGCTAGAAGTGGGAGGG - Intronic
914542820 1:148632287-148632309 TTTGGGAGGCAGAAGTGGGAGGG + Intronic
914685466 1:149974938-149974960 CCTGGGAGGCTGAGGTGGGACGG - Intronic
914815035 1:151057027-151057049 CCTGGCTGGCAGTAGTGAGAAGG - Intronic
915633852 1:157172975-157172997 CCTGGTGGGCAGCAGTGAGCAGG - Intergenic
916496296 1:165351021-165351043 CCTGGAGGGCTGAAATGGAAGGG + Intronic
916563705 1:165955117-165955139 CCTGGGCTCCAGAAGTGGGAGGG - Intergenic
916668173 1:166986400-166986422 CATGGGAGACAGAAGTGGGACGG + Intronic
916974583 1:170062013-170062035 CGTGGTGGGGAGAGGGGGGAGGG + Intronic
917527277 1:175799951-175799973 AGTGGTGGGCAGAGGTGGGATGG + Intergenic
917610638 1:176685669-176685691 CCTGGTGGGGAGGAGGGGGCCGG - Intronic
917945849 1:179969708-179969730 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
918100163 1:181365926-181365948 GCTGGTGAGCACAAGTGAGATGG + Intergenic
918316280 1:183325130-183325152 CCTGATCTGCTGAAGTGGGAAGG + Intronic
918338316 1:183544471-183544493 CCTGCTGGGAAGAGGAGGGAAGG - Exonic
919200979 1:194355191-194355213 CCTGGGGAGCAGATGTGTGATGG + Intergenic
919811620 1:201412375-201412397 CCTGGTGGGCAGAAGTGGGAAGG + Intronic
919914277 1:202130270-202130292 CCTGGTGGGCAGAAGTCTGGTGG - Exonic
920637250 1:207715802-207715824 ACTGGGAGGCTGAAGTGGGAGGG - Intronic
920658142 1:207891573-207891595 CTTGGGGGGCTGAGGTGGGAGGG + Intronic
920708939 1:208276613-208276635 AATGGTGGGGACAAGTGGGAGGG + Intergenic
921168520 1:212525239-212525261 CCAGGTGGGAGGAAGGGGGATGG + Intergenic
921184184 1:212655937-212655959 CCTGGTGAGGAGAGGTGGGATGG + Intergenic
921290150 1:213649586-213649608 CCTGGTGGGCGGGGGAGGGAGGG - Intergenic
922041703 1:221903889-221903911 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
922179239 1:223220771-223220793 TCGGGTGGGCAGGAGTGGGGTGG - Intergenic
922474777 1:225899335-225899357 CCTGGAGGGCAGCAGGGGGCAGG - Intronic
922510862 1:226166261-226166283 CTTGGGGGGCTGAGGTGGGAGGG - Intronic
922787930 1:228292514-228292536 CCTGGCAGGCAGAGCTGGGAAGG - Exonic
923122915 1:231010132-231010154 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
923124426 1:231022891-231022913 ACTGGTGGGCAGAAATGGGCTGG - Intronic
923128355 1:231053063-231053085 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
923213655 1:231829852-231829874 TCTGGCGGGCAGGAGTGGGGGGG + Intronic
923430228 1:233912727-233912749 CTGGGTGGGATGAAGTGGGAAGG + Intronic
923954353 1:238997929-238997951 CCTTGGGGGGAGAGGTGGGAGGG - Intergenic
924633338 1:245762853-245762875 CCTTGTGTGCAGAAGAGTGACGG - Intronic
1063609987 10:7553908-7553930 CTTGGGGGGCAGAGGTGGGTTGG - Intergenic
1065268766 10:24004928-24004950 CCTGGAGGACCAAAGTGGGAAGG + Intronic
1066078017 10:31900673-31900695 ACTGGTTGCCAGAAGTGTGAGGG + Intronic
1066357371 10:34698055-34698077 CTTGGTGGGAAGAGGTGGGCAGG - Intronic
1067485510 10:46646261-46646283 GCTGGTGGCAAGGAGTGGGAAGG - Intergenic
1067524219 10:47028564-47028586 CCTGGAGGTCAGAGGTGGGCAGG - Intergenic
1067609248 10:47695391-47695413 GCTGGTGGCAAGGAGTGGGAAGG + Intergenic
1067936985 10:50621872-50621894 CCTGCTGGGTAGCAGTGGGGTGG - Intronic
1068042396 10:51841756-51841778 CCTGGGAGGCAGAGGTGGCAGGG - Intronic
1068293687 10:55038647-55038669 TCTGATGGGCAGTTGTGGGACGG + Intronic
1068880876 10:62047704-62047726 GCTGGTGGGCAGGAGTGGGATGG - Intronic
1069115971 10:64507008-64507030 TCTGGTGGGCAGGGGTGGGGGGG - Intergenic
1069691816 10:70358693-70358715 GCTGGTGGGCAGAGAGGGGAGGG - Intronic
1069736740 10:70661597-70661619 GCTGGTGGGGAGATGTGGGCAGG - Intergenic
1070089248 10:73268767-73268789 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1070361308 10:75692092-75692114 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
1070831738 10:79422104-79422126 CCTGGTGGGAAGAAGAGGCTAGG + Intronic
1070900279 10:80022543-80022565 CCAGGTGGGCAGTCTTGGGAGGG - Intergenic
1070902032 10:80038413-80038435 CCAGGTGGGCAGTCTTGGGAGGG - Intergenic
1071085709 10:81866737-81866759 CCTGGAACACAGAAGTGGGAAGG - Intergenic
1071183032 10:83008930-83008952 CCTGGTTTTCAGAAGTGGGTGGG + Intergenic
1071624837 10:87157037-87157059 GCTGGTGGCAAGGAGTGGGAAGG + Intronic
1071808987 10:89157475-89157497 CTTGGGAGGCTGAAGTGGGAAGG - Intergenic
1072729095 10:97832791-97832813 GATGGTGGACAGGAGTGGGATGG - Intergenic
1074485544 10:113874350-113874372 GGTGGTGGGGAGGAGTGGGAAGG - Intronic
1075336539 10:121612991-121613013 CCTGGTGGTCAGTGGTGGGTTGG + Intergenic
1075530347 10:123223735-123223757 CCTTGTGGCCAGGAGTGGCAGGG - Intergenic
1075674855 10:124289379-124289401 CATGGTTGGGAGAAGCGGGATGG - Intergenic
1075994594 10:126867034-126867056 TCTGGTGGCCACAGGTGGGAAGG + Intergenic
1076283663 10:129273110-129273132 CCTAGAGGGGAGAATTGGGAGGG + Intergenic
1076521009 10:131081331-131081353 CCTGGTGGGCAGAGGAGATAGGG + Intergenic
1077127942 11:952110-952132 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
1077241567 11:1513084-1513106 CCTCGTGGGGAGAGGTGGAAGGG - Intergenic
1078307509 11:10205001-10205023 CCTGTTGGGGGGAGGTGGGAGGG + Intronic
1079238134 11:18704049-18704071 CCTAGTGTGAAGAAATGGGAGGG + Exonic
1080161109 11:29177499-29177521 CAAGGCGGGCAGACGTGGGATGG - Intergenic
1080793341 11:35540483-35540505 CCTGGTAGGGAGAAGAGAGAGGG + Intergenic
1081532828 11:43975072-43975094 GGTGGTGGGCAGAAGCTGGAAGG + Intergenic
1081617257 11:44598184-44598206 ACTGGGGGGCAGACGTGGGGTGG + Intronic
1081990189 11:47333404-47333426 CCTGGTTGGCAGGGGTGGGGTGG - Intronic
1081995303 11:47359852-47359874 CCTGGTGGCCAAGACTGGGATGG + Exonic
1083314402 11:61805349-61805371 CCTGGAGGTCAGCTGTGGGACGG + Intronic
1083427716 11:62597297-62597319 TCTGGTGAGCAGAAGTTGGTGGG - Exonic
1083679077 11:64343009-64343031 CTTGGTGGGAAGAAGATGGAAGG + Intronic
1084162770 11:67359090-67359112 CATGGTGGGCAGAAGTAGAAGGG - Intronic
1084165085 11:67371855-67371877 GGTGGTGTGCAGAAGTGTGACGG + Intronic
1084510168 11:69598349-69598371 CCCGGTGGGCAGGAGTAGCATGG + Intergenic
1084568639 11:69945838-69945860 CCACGGGGGCAGAGGTGGGAGGG + Intergenic
1084661062 11:70546663-70546685 CCTGGTGGGCCTTGGTGGGAGGG + Intronic
1084904606 11:72335955-72335977 CCTGGTTGGCAGAAGAGGTCAGG + Intronic
1085203113 11:74713629-74713651 CTTGGTGGGCAGGAATGGGGAGG - Intronic
1085934738 11:81127287-81127309 TCTGGTGGGCAGGAGTGGGGGGG - Intergenic
1086812463 11:91327810-91327832 TCTGATGAGCAGCAGTGGGAGGG + Intergenic
1086922692 11:92605351-92605373 CCAGGTGGGCTGCAGTGTGATGG + Intronic
1087187826 11:95220399-95220421 ACTGGTTGGCAGGAGGGGGAGGG + Intronic
1088127850 11:106449997-106450019 ACTGGTGGGGAGGAGTGGGAAGG - Intergenic
1089288397 11:117422281-117422303 CCTTGTGAGTAGAAGTTGGAGGG + Intergenic
1089517809 11:119044890-119044912 CCTAGTGGCCAGAGGAGGGAGGG - Exonic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1089799500 11:121013642-121013664 CCTGGTGGGAGGAACTGGGTGGG - Intergenic
1089935129 11:122356872-122356894 CCTGGTGGGGGGAGGGGGGAGGG - Intergenic
1089973154 11:122710704-122710726 CCTGCTGGGGAGAATTGGGGAGG + Intronic
1090179116 11:124678652-124678674 CTTGGGAGGCTGAAGTGGGAAGG - Intronic
1090645139 11:128761114-128761136 CGCGGAGGGAAGAAGTGGGAGGG - Intronic
1091176223 11:133560556-133560578 CATAGTGGGCAGACGTGTGAAGG - Intergenic
1091310224 11:134569109-134569131 TCTGTTGGGCAGAAGGGCGATGG + Intergenic
1091540588 12:1457783-1457805 CTTGGGTGGCTGAAGTGGGAGGG + Intronic
1091743391 12:2975847-2975869 AATGGTTGCCAGAAGTGGGAAGG - Intronic
1091837125 12:3593992-3594014 CCTGGTGCTGTGAAGTGGGAGGG + Intergenic
1092077453 12:5685448-5685470 CCAGTTGGGCAGAGGTGGCATGG - Intronic
1092626295 12:10333157-10333179 TCTGGCGGGCAGGAGTGGGGGGG + Intergenic
1092627085 12:10338372-10338394 TCTGGCGGGCAGGAGTGGGGGGG + Intergenic
1093141566 12:15516064-15516086 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1093918984 12:24838037-24838059 CCTGGGTGTCAGAAGTGGGGAGG - Intronic
1094478950 12:30864833-30864855 CCCTGTGGGTAGGAGTGGGAAGG - Intergenic
1094638439 12:32249242-32249264 CCTAGGGAGCAGATGTGGGATGG + Intronic
1095609920 12:44115308-44115330 TCGGGTGGGGAGAAGGGGGAGGG + Intronic
1096242526 12:49967083-49967105 GCAGGTTGGAAGAAGTGGGAAGG - Intergenic
1096472595 12:51888797-51888819 CCAGGTGGACAGCAATGGGAGGG + Exonic
1097225451 12:57474617-57474639 TCTGGTGGACAGAGGTGAGAAGG - Exonic
1097829885 12:64212981-64213003 CTTGGTGGGCTGGGGTGGGAAGG + Intronic
1097890993 12:64777833-64777855 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1099178855 12:79454945-79454967 ATTGGTGGGAAGAAGTGGGGAGG - Intergenic
1099198556 12:79648679-79648701 CCAGGGAGGCAGAGGTGGGAGGG + Intronic
1100214379 12:92432743-92432765 GTTGGTGGGCAGAAGTTGGAAGG - Intergenic
1100226678 12:92563988-92564010 ACTGGTGGTGAGCAGTGGGATGG + Intergenic
1101718545 12:107331891-107331913 CCAGGTGGGGAGAGGTGGGGCGG - Intronic
1102885694 12:116520079-116520101 CCTGGGAGGCAGACGTGGCAGGG - Intergenic
1103589764 12:121983117-121983139 CTTGGAGGGCTGAGGTGGGAAGG + Intronic
1103678296 12:122673902-122673924 CCTGGGAGGCTGAGGTGGGAGGG - Intergenic
1103867143 12:124062316-124062338 ACTTGGGGGCAGAAGAGGGAAGG - Intronic
1103910215 12:124348115-124348137 CCTGGTGGGCGGTGGGGGGATGG - Intronic
1104207446 12:126653479-126653501 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1104745975 12:131210812-131210834 GCAGGAGGGCAGACGTGGGAGGG + Intergenic
1104792003 12:131488924-131488946 GTTGGTAGGCAGGAGTGGGAAGG - Intergenic
1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1106181803 13:27375894-27375916 CCTGGTGGACAGAGGTGGTAGGG - Intergenic
1106638518 13:31557958-31557980 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1107064129 13:36194488-36194510 ACTGGTGGGCAGGGGTGGGAAGG + Intronic
1107604940 13:42048315-42048337 CCTGCTGTCCAGAAGTGAGAGGG + Intronic
1109709723 13:66145247-66145269 ATTGCTGGGCAGGAGTGGGAGGG + Intergenic
1112304821 13:98264375-98264397 CCTGGCGGGACGAAGTGAGATGG - Intronic
1112478656 13:99754307-99754329 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
1112581941 13:100683902-100683924 ACTAGTGGGTAGAAGTTGGAAGG + Intergenic
1113215778 13:108039413-108039435 CCTGGTAGGCAGAAATGCAAAGG - Intergenic
1113805730 13:113109302-113109324 CCTGGGCGGCAGGAGTGGGAGGG - Intronic
1113980876 13:114274341-114274363 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
1114479453 14:23023261-23023283 CCTGGTGTGCAGATGCTGGAAGG + Intronic
1115482863 14:33879179-33879201 CTTGGAAGGCTGAAGTGGGAGGG + Intergenic
1116285058 14:42960121-42960143 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1116808331 14:49515287-49515309 CCTGTTGGGATGGAGTGGGATGG - Intergenic
1116919666 14:50560105-50560127 GCTGGTGGGAAGGAGTGGGGAGG - Exonic
1117288974 14:54314458-54314480 TCAGGTGAGCAGAAGCGGGAAGG - Intergenic
1117919669 14:60716187-60716209 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
1118123117 14:62868215-62868237 CCTGGTGGGAAGAATGTGGAAGG - Intronic
1118817486 14:69323507-69323529 CCTGGAGGTCAGCACTGGGAGGG + Intronic
1118890565 14:69904919-69904941 CATGATGGGCAGTGGTGGGATGG - Intronic
1120074745 14:80142812-80142834 CCTGCTGTGGAGAACTGGGAAGG - Intergenic
1121448458 14:93993066-93993088 TCTGGTGGGAAGAGGTGAGAGGG - Intergenic
1121711743 14:96043713-96043735 CCAGGGAGGGAGAAGTGGGAGGG - Intronic
1122416248 14:101550991-101551013 CCTGGCAGGCAGAAGTAGCAGGG - Intergenic
1122896508 14:104760187-104760209 CCTGGAGGACAGAAGAGGGCAGG + Intronic
1122963096 14:105107934-105107956 CCTGGGAGGCTGAGGTGGGAGGG + Intergenic
1123439876 15:20282499-20282521 GCTGATGGGCAGAGGTGGGGAGG + Intergenic
1123910694 15:24963922-24963944 CCTGGGAGGCTGAAGTGGAAGGG + Intronic
1124094680 15:26638148-26638170 CCTGGTGGGCTGATGAGGGATGG - Intronic
1124610455 15:31204484-31204506 CCAGGTTAGCAGCAGTGGGAGGG - Intergenic
1124924867 15:34061176-34061198 CTTGGAGGTCAGAGGTGGGAGGG + Intronic
1126107483 15:45156195-45156217 CTAGCTGGGCAGAAGTGGGGTGG - Intronic
1127458944 15:59180361-59180383 CATGGAGGGTAGAAGTGAGAAGG + Intronic
1127698622 15:61475437-61475459 CCTGGATGGAAGCAGTGGGAGGG + Intergenic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1128983138 15:72200642-72200664 CCTGGTGAGCAGACCTGAGATGG + Exonic
1129190037 15:73931760-73931782 CCTGGAGGGCAGAGGTGGGCAGG - Intronic
1129946502 15:79543258-79543280 CCTGCTGGGCAGAAATGGCCAGG - Intergenic
1130895361 15:88166263-88166285 TCTGGAAGGCAGAAGTGGAAGGG + Intronic
1131630711 15:94174167-94174189 CATGGTGTGGAGGAGTGGGAAGG - Intergenic
1132040754 15:98523053-98523075 CCTGGGGGGCTGAGGAGGGAGGG - Intergenic
1132814146 16:1817935-1817957 CCAGGTGGTGAGAAGTGGGGCGG - Intronic
1132854339 16:2038127-2038149 CCTGGTGGGCAGGGGCAGGATGG - Exonic
1132931175 16:2459963-2459985 CCTGGGAGGCAGGAGTGGGCGGG + Intergenic
1135107386 16:19662093-19662115 CTTGGCAGGCTGAAGTGGGAGGG + Intronic
1135652203 16:24216180-24216202 GCTGGTGGGCTGTAGTGGGGTGG + Exonic
1135674881 16:24406856-24406878 CCTTGTGGGCAGAAACTGGAGGG - Intergenic
1136314695 16:29446208-29446230 CCTGGGGGGCTGAGGTGGGAGGG + Intronic
1136442822 16:30287967-30287989 CCTGGGGGGCTGAGGTGGGAGGG + Intergenic
1136712207 16:32248405-32248427 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1136755707 16:32680999-32681021 CTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1136812406 16:33189373-33189395 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1136818882 16:33299453-33299475 CTTGGGAGGCAGAGGTGGGAGGG - Intronic
1136825445 16:33355986-33356008 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1136830511 16:33454757-33454779 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1137011175 16:35321833-35321855 CTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1137029833 16:35511961-35511983 CTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1137521493 16:49199147-49199169 CCTAATGGACAGGAGTGGGAAGG + Intergenic
1137670667 16:50276370-50276392 CATGGGGTGCAGAAGTGAGAGGG - Intronic
1138383235 16:56617975-56617997 CCTGGTGGGGTGAAATAGGAGGG + Intergenic
1138430952 16:56969005-56969027 CCTGGTGTGCTGAAGATGGAGGG - Intronic
1138438712 16:57021465-57021487 CTTGGGAGGCTGAAGTGGGAAGG - Intronic
1138535726 16:57659373-57659395 CCTGGTGGGCCAGTGTGGGAAGG - Exonic
1139664633 16:68447497-68447519 CCAGGTGGGGAGAGGTGGGGAGG + Intronic
1140508052 16:75486825-75486847 CTTGGTGGGGTGAGGTGGGAAGG + Intronic
1140627982 16:76817832-76817854 CAGGGCGGGCAGAAGTGGGGAGG - Intergenic
1141049529 16:80747850-80747872 CCAGGTGGGCAGAGGTAGGAAGG - Intronic
1142340140 16:89516473-89516495 CCTGGTAGGCAGAGGTTGCAGGG + Intronic
1202990983 16_KI270728v1_random:12343-12365 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1203057850 16_KI270728v1_random:941355-941377 CTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1142591583 17:1008528-1008550 CCTTGTGGGGAGGAGTGGGAAGG - Intronic
1142763681 17:2054889-2054911 CCAGGTGGGTACAGGTGGGAGGG + Intronic
1142964688 17:3573279-3573301 CCTGGAGGGAAGAAGGGGGAGGG - Intronic
1143098070 17:4489071-4489093 CCAGGCGGGCAGCAGTGGGGAGG + Intergenic
1143563737 17:7709381-7709403 CCTGGGGGGTGGAGGTGGGATGG + Exonic
1143620130 17:8075849-8075871 CCTGTGGGGCAGAAGTGGAGAGG + Intronic
1143857375 17:9862154-9862176 CCTGGGGGACAGAAGTCGGGTGG - Intronic
1143901446 17:10177562-10177584 GCTGGAGGGCAGCAGTGAGAAGG - Intronic
1143993357 17:10986051-10986073 CCAGGGAGGCAGATGTGGGATGG - Intergenic
1144574998 17:16423782-16423804 CCTGGAGAGGGGAAGTGGGAAGG - Intronic
1145111036 17:20161868-20161890 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1145225032 17:21121348-21121370 CCTGGGAGGCTGAAGTGGGAGGG + Intergenic
1145792213 17:27634441-27634463 CCTGGGAGGCGGAGGTGGGAGGG + Intronic
1146073001 17:29701515-29701537 CCTGGGAGGCTGAGGTGGGAGGG - Intronic
1146169035 17:30618692-30618714 CCTGGGGGGCTGAATTTGGAGGG - Intergenic
1146170527 17:30628757-30628779 CCTGGGGGGCTGAATTTGGAGGG + Intergenic
1146354859 17:32125446-32125468 CCTGGTTTGGAGAAGTGGGCAGG - Intergenic
1146465217 17:33080837-33080859 CTGGGTGGGATGAAGTGGGATGG + Intronic
1146484963 17:33235323-33235345 CCTGTGGGGCTGACGTGGGAGGG + Intronic
1146952814 17:36918590-36918612 CGAGGAGGGCAGAAGTGTGAAGG + Intergenic
1146974091 17:37096310-37096332 CCTGGTAGGAAGAAGGGGCAGGG - Intronic
1147267739 17:39244923-39244945 CCTGGTGGCCAGATGTGATATGG + Intergenic
1147362902 17:39942869-39942891 CCTGGCGGGCAGAACTGGGTGGG - Intronic
1147656235 17:42092768-42092790 CCTGGAGGGCAGGATGGGGATGG - Intergenic
1147922695 17:43927634-43927656 CCTGTTGGGGTGAAGTGGGGTGG + Intergenic
1148287839 17:46411576-46411598 CAGGTTGGCCAGAAGTGGGATGG + Intergenic
1148310008 17:46629156-46629178 CAGGTTGGCCAGAAGTGGGATGG + Intronic
1148576657 17:48716661-48716683 CCTGGGAGGCTGAGGTGGGAGGG + Intergenic
1148865181 17:50624526-50624548 CCAGGTGAGCAGATGTGGAAAGG + Exonic
1148961276 17:51395223-51395245 CCTGCAGGGCTGAGGTGGGAGGG + Intergenic
1148998663 17:51734663-51734685 CCTGGAGGCCAGGAATGGGAGGG + Intronic
1149323932 17:55510486-55510508 CATGGGAGGCTGAAGTGGGAAGG + Intergenic
1149592450 17:57841482-57841504 GCTGGGGTGCAGAAGTGGGAGGG - Intronic
1150212188 17:63447279-63447301 CCTGGAGGGCAGGTGGGGGAGGG - Intergenic
1150414963 17:64979797-64979819 ACTGAAGGGCAGAATTGGGAGGG - Intergenic
1151455204 17:74221790-74221812 CCTGGTGGGGTGCAGTGGAAGGG + Intronic
1151635710 17:75346418-75346440 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1151816558 17:76474142-76474164 CCTGGAGGGCAGAAGAAGGCTGG + Exonic
1152123111 17:78430986-78431008 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
1152314529 17:79572491-79572513 CCTGGTGGGCAGAGCTGGGGTGG - Intergenic
1152638377 17:81439447-81439469 CCTGGGGAGCAGCAGTTGGACGG + Intronic
1152640100 17:81445726-81445748 CCTGCCGGGCAGGGGTGGGAGGG - Intronic
1152925010 17:83083177-83083199 CCTCCTGGGCAGAGGTGGGTTGG + Intronic
1153160533 18:2199909-2199931 GCTGGTGGGAAGAGGTAGGAGGG + Intergenic
1153174611 18:2356987-2357009 CCAGGTGGGATGCAGTGGGATGG - Intergenic
1153778778 18:8476482-8476504 CCTCGAGGGCAGGAGAGGGACGG + Intergenic
1153815617 18:8787476-8787498 CCTGATCTGCAGTAGTGGGACGG + Intronic
1154952472 18:21223760-21223782 CCTGGTAGGATGGAGTGGGACGG - Intergenic
1156019922 18:32588384-32588406 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1156237966 18:35222319-35222341 TCTGGTGGGCAGGGGTGGGGGGG - Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157000971 18:43524366-43524388 CCAGGTGGGATGGAGTGGGATGG + Intergenic
1157994558 18:52539579-52539601 CCTGATGAGCTGAAGTGGAACGG + Intronic
1158367766 18:56757859-56757881 CTTGGGGGGCTGAGGTGGGAGGG + Intronic
1158391161 18:57046389-57046411 CCTGGTGAGGGGAGGTGGGAAGG + Intergenic
1159117367 18:64130754-64130776 CCTGGTAGACAGAAGTGGAAAGG + Intergenic
1159775713 18:72601258-72601280 CTTGGAGGTCAGAAGTAGGATGG + Intronic
1160014451 18:75129526-75129548 GCGGGTGGGCGGGAGTGGGAGGG - Intergenic
1160034317 18:75286807-75286829 GGTGGTGGGCGGTAGTGGGATGG - Exonic
1160562427 18:79766971-79766993 CCTGGTGGGCAGAGCAAGGATGG - Intergenic
1160585400 18:79911042-79911064 TCAGGTGGGGACAAGTGGGAAGG + Intronic
1161270094 19:3385029-3385051 CCTGCTGAGCAGAGGCGGGAGGG - Intronic
1161573168 19:5041290-5041312 CCTGGTGGGTGGTGGTGGGAGGG + Intronic
1161573847 19:5044759-5044781 CCTGGGGCGCAGGAGAGGGATGG - Intronic
1161619604 19:5291164-5291186 CCTGGTGGCCAGGAGTGGATGGG + Intronic
1162396932 19:10422704-10422726 CCTGGTGGGTAGAAGGGTGCAGG - Intronic
1162535583 19:11261700-11261722 GCTGGTGGGCAGACGGGGGAGGG - Intronic
1163099031 19:15082383-15082405 CCTGGTGAGCAGGTGAGGGATGG + Intergenic
1163168540 19:15514593-15514615 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163297709 19:16422880-16422902 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163297911 19:16424320-16424342 CCTGGTGGGGTGGGGTGGGAGGG - Intronic
1163378776 19:16950544-16950566 TCTGGCAGGCCGAAGTGGGAGGG + Intronic
1163640399 19:18458738-18458760 CCTGGGAGGCTGACGTGGGAGGG - Intronic
1164808665 19:31138943-31138965 CATGTGGGGCAGAGGTGGGATGG - Intergenic
1165504552 19:36217136-36217158 CCTGGGGGGCAGAGGTTGCAGGG - Intronic
1165731272 19:38147135-38147157 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1166129732 19:40738966-40738988 CCAGGTGGGACGAAGCGGGATGG + Intronic
1166277665 19:41766161-41766183 CCTTGTGGGAAGAAGAGAGAAGG - Exonic
1166354420 19:42218435-42218457 CCTGGAGGGCAGAGATTGGAAGG - Intronic
1166651838 19:44580842-44580864 CATGGTAGGCAAACGTGGGAGGG + Intergenic
1166667868 19:44692130-44692152 CCTGGTGGGCAGAACTTGGGTGG - Intergenic
1166705288 19:44905054-44905076 GCGGCTGGACAGAAGTGGGATGG - Intergenic
1166897457 19:46032840-46032862 CCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167280875 19:48567725-48567747 TCTGGGAGGCTGAAGTGGGAGGG + Intronic
1167986799 19:53325247-53325269 CATGGATGGCAGAAGGGGGATGG - Intergenic
1168109419 19:54183677-54183699 CCAGCTGGGCAGAAGGGGGTGGG + Exonic
925234721 2:2267632-2267654 CTTGGTGGGCTGAAGTGGGAAGG + Intronic
925325589 2:3019451-3019473 CCTGATGGGCCGCAGTGGGAAGG + Intergenic
925487180 2:4348416-4348438 TCAGGTGTGCAGAAATGGGAAGG + Intergenic
925781029 2:7382086-7382108 CCTGGTGGACACAAGAGGAATGG + Intergenic
925926837 2:8676957-8676979 GCTGGTGGGCAGAGGGGGGGTGG + Intergenic
927871283 2:26625669-26625691 CCGGGTGGGAAGCAGTGGGGGGG - Intronic
929235838 2:39604883-39604905 CCTGCTGGGCAGAGTTGTGATGG - Intergenic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
929575961 2:43051902-43051924 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
929830801 2:45344742-45344764 CCATGTGGGGAGCAGTGGGAAGG - Intergenic
929950705 2:46407530-46407552 CCAGGTGGGCATCAGTGGGAGGG + Intergenic
930043124 2:47144666-47144688 TCTAGTGGTCAGCAGTGGGAAGG - Intronic
930081147 2:47449826-47449848 TCTGCTGGGCAGAAATGTGATGG - Intronic
930484104 2:51990653-51990675 CCTGGCTGGGAGTAGTGGGAGGG + Intergenic
930611991 2:53554162-53554184 GCTCCTGGGCAGAAGGGGGAGGG + Intronic
930819885 2:55634995-55635017 CTTGGAAGGCTGAAGTGGGAAGG - Exonic
930958927 2:57235006-57235028 TCTGGTGGGCAAGAGTGGGGGGG - Intergenic
931216909 2:60253774-60253796 GTTGGAGGGCAGAAGAGGGAAGG - Intergenic
931271255 2:60705209-60705231 CTTGGTAGGCTGAGGTGGGAGGG - Intergenic
931516822 2:63054999-63055021 CCTGGAGGCCAGAACTGGGCAGG - Intronic
931906570 2:66849444-66849466 ACTGGGGGGGAGTAGTGGGAAGG - Intergenic
932222635 2:70011480-70011502 CCAGGTGAGCAGATGAGGGAAGG + Intergenic
932229045 2:70067208-70067230 ACTGGTTGTCAGACGTGGGAAGG + Intergenic
933508875 2:83214563-83214585 CCTGGGGGGCAGAGGTTGCAGGG - Intergenic
933903036 2:86862576-86862598 CCTGGTGGGGAGATTTGTGAGGG + Intergenic
934941905 2:98508904-98508926 CCTGGTGCGCGGGAGTGAGAGGG + Intronic
935469047 2:103434773-103434795 CGTGGTGAGCAGAAGTGAAAGGG - Intergenic
935777510 2:106486694-106486716 CCTGGTGGGGAGATTTGTGAGGG - Intergenic
937241586 2:120465609-120465631 CCTTGTGGGTAGATGTGGGAGGG + Intergenic
937344322 2:121114979-121115001 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
937378673 2:121355774-121355796 CAAGGTGGCCAGAAGTGGCAAGG + Intronic
937638062 2:124179233-124179255 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
938035527 2:128031815-128031837 CGTGGAGGTCAGAAGTAGGATGG - Intergenic
938264917 2:129921769-129921791 CCGGGTGGGACAAAGTGGGATGG + Intergenic
939161091 2:138589703-138589725 CCAGCTGGGCTGGAGTGGGATGG + Intergenic
939586478 2:144012161-144012183 ACTGGCGGACAGAGGTGGGAAGG - Intronic
940398729 2:153222526-153222548 CCTGCTGGGCAGAAAGGGGTGGG - Intergenic
940861723 2:158777229-158777251 CCAAGTGGGATGAAGTGGGACGG - Intergenic
941101992 2:161307061-161307083 CCTAGGAGGCTGAAGTGGGAGGG + Intergenic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
941623420 2:167804468-167804490 TGGGGTGGGCAGAAGGGGGAGGG - Intergenic
942026280 2:171913678-171913700 CCTGCTGGAGAGAAGTGAGAGGG + Intronic
942519746 2:176791055-176791077 CCTGGTGGGTAGAAGGGTAAGGG - Intergenic
942922144 2:181387981-181388003 ACTGGAGGGGGGAAGTGGGAAGG + Intergenic
943656877 2:190519327-190519349 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
943857519 2:192816404-192816426 CATGGTGGGCAGTAGGGAGAGGG + Intergenic
944164055 2:196698831-196698853 CCGGGTGGGGAGAGGGGGGAGGG - Intronic
945842282 2:214901989-214902011 CCAGGAAGGAAGAAGTGGGAAGG + Intergenic
945968312 2:216211516-216211538 TCAAGTGGGCAGAAGTGAGATGG + Intergenic
947355996 2:229296186-229296208 CTTGGGAGGCTGAAGTGGGAAGG - Intergenic
947672990 2:231952205-231952227 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
947845900 2:233243563-233243585 CCTGGTGGGGAGAATAGGGCTGG + Intronic
947918561 2:233850371-233850393 CCTGGTGGGCAGAGGTGGTCGGG + Intronic
948178941 2:235965117-235965139 AGTGTTGGGCAGAAGTGGCAGGG + Intronic
948491400 2:238315388-238315410 CATGGTGGGCAGATCAGGGAAGG + Intergenic
948575419 2:238946760-238946782 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948785315 2:240349483-240349505 CCTGGAGGGCAGGTGTGGGCAGG - Intergenic
948945207 2:241215869-241215891 TCTGTTGGTCAGATGTGGGAGGG - Intronic
1169270037 20:4192200-4192222 GCGGCTGGGCAGGAGTGGGATGG + Intergenic
1169510957 20:6263001-6263023 CCTGCTGGGAAGAAGTGGCAAGG + Intergenic
1169605651 20:7315844-7315866 CCTGGGAGACAAAAGTGGGAGGG + Intergenic
1169631279 20:7635219-7635241 CCTGGGAGGCAGAAGTGGCAGGG - Intergenic
1169941675 20:10944719-10944741 GCTGTGGGGCAGAAGTGGGGTGG - Intergenic
1170567605 20:17615782-17615804 CCTTCTGGGCAGCAGTGGGTGGG - Intronic
1170629411 20:18055404-18055426 CCAGGTGGGGTTAAGTGGGAGGG - Intronic
1171019748 20:21574579-21574601 GCTTGTGGACAGGAGTGGGATGG - Intergenic
1171335734 20:24383917-24383939 CCTGGTGGGCTGGAGAGCGAGGG - Intergenic
1172377184 20:34453487-34453509 CTTGGGTGGCTGAAGTGGGAGGG + Intronic
1172632169 20:36385884-36385906 CCTCCTGGGCTGAAGTGGGGAGG - Intronic
1172762685 20:37333304-37333326 CCTGGGAGGCCGAGGTGGGAGGG - Intergenic
1172785781 20:37467691-37467713 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1172866800 20:38106341-38106363 TTTGGGGGGCAGAGGTGGGAGGG - Intronic
1173408078 20:42784511-42784533 CTTAGTGGAGAGAAGTGGGATGG + Intronic
1174279255 20:49426978-49427000 CCTGGGGATCAGAAGAGGGATGG - Intronic
1174412216 20:50343591-50343613 CCTGGTGGGCAGATGGGAGCAGG + Intergenic
1174440509 20:50548531-50548553 CCTGGGAGGCTGAGGTGGGAAGG - Intronic
1174669295 20:52291584-52291606 ACTGGTGGGCACAAATGGGCAGG + Intergenic
1175007576 20:55701706-55701728 CCTGGTGTTCAGAAGTGTGTAGG - Intergenic
1175289742 20:57867879-57867901 CAAGGTGGGCAGAGGTGGGCAGG - Intergenic
1175294433 20:57898565-57898587 CCTGGGAGGCAGTAGTGGCAGGG - Intergenic
1176098817 20:63355916-63355938 CTTGGTGGGCAGGAGTGGCCAGG - Intronic
1176336073 21:5601294-5601316 TCTGGCGGGCAGGAGTGGGGGGG + Intergenic
1176391684 21:6219654-6219676 TCTGGCGGGCAGGAGTGGGGGGG - Intergenic
1176469735 21:7096520-7096542 TCTGGCGGGCAGGAGTGGGGGGG + Intergenic
1176493296 21:7478298-7478320 TCTGGCGGGCAGGAGTGGGGGGG + Intergenic
1176507346 21:7660085-7660107 TCTGGCGGGCAGGAGTGGGGGGG - Intergenic
1177101130 21:16898047-16898069 TCTGGCGGGCAGGAGTGGGGGGG - Intergenic
1177143974 21:17387902-17387924 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
1177683647 21:24408894-24408916 CCTGGGGAGCTGAAGTGGAAGGG + Intergenic
1177841019 21:26233255-26233277 TCTGGTGGGCAGGAGTGGGGGGG + Intergenic
1178184866 21:30207885-30207907 ACTGGTGGGGAGGAGGGGGATGG + Intergenic
1178247592 21:30968831-30968853 CCTGGGAGGCTGAGGTGGGAGGG + Intergenic
1178270684 21:31186671-31186693 CCTGGGGGGCTGAGGTGAGAGGG + Intronic
1178478330 21:32956963-32956985 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1178885223 21:36479620-36479642 TCTGGTTGGCAGAAGAGGGAAGG - Exonic
1178988154 21:37326378-37326400 CCTGGGAGGCTGAGGTGGGAGGG + Intergenic
1179253966 21:39699188-39699210 CTTGGAGGGCTGAGGTGGGAGGG + Intergenic
1179681679 21:43026103-43026125 GTGGGTGGGCTGAAGTGGGAGGG + Intronic
1179768272 21:43591804-43591826 CCTGATGGGATGGAGTGGGATGG - Intronic
1180067172 21:45418299-45418321 GCTGGCGGGCAGGCGTGGGAAGG - Intronic
1180130899 21:45826555-45826577 CCTGGTGGGGAGGACAGGGAAGG - Intronic
1180391802 22:12290675-12290697 CATGGTGGGAAGAACCGGGAGGG + Intergenic
1180637067 22:17269794-17269816 CTGGGTGGGTAGAAGTGGCAGGG - Intergenic
1180963956 22:19776061-19776083 CCACGTGGGCACAGGTGGGAGGG + Intronic
1180972949 22:19825058-19825080 CCTGGTGGGCTGGGGTGGGCAGG - Intronic
1181149998 22:20876363-20876385 CTTGGGAGGCAGAGGTGGGAGGG - Intronic
1181225726 22:21389536-21389558 CCCAGTGCGCAGAAGTGAGAGGG - Intergenic
1181252908 22:21545277-21545299 CCCAGTGCGCAGAAGTGAGAGGG + Intergenic
1181616952 22:24061431-24061453 CCTGGTGGGCAGAAGCTGCCAGG - Intronic
1181645069 22:24226531-24226553 CCTGGTAGGGGGAAGTTGGAGGG - Intronic
1182109349 22:27711797-27711819 TTTGGAGGGCTGAAGTGGGAGGG - Intergenic
1182228710 22:28820160-28820182 CTTGGGAGGCTGAAGTGGGATGG + Intergenic
1182521752 22:30888618-30888640 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
1182551134 22:31101240-31101262 CCAGGTGGGCAGCACTGTGATGG + Intronic
1182833307 22:33321308-33321330 CCTGGTGGGCAGGGATGGTAGGG + Intronic
1182999072 22:34839819-34839841 TCTGGTGGGCAGGAGTGGGGGGG - Intergenic
1183206991 22:36426453-36426475 CCTGGTGGACAGGAGTGGGAGGG - Intergenic
1183678870 22:39315191-39315213 CCTTGTGGTCAGAAGTGGCTGGG - Intronic
1183937870 22:41274179-41274201 CATGTTGGGCAGAAGTGGCCAGG - Intronic
1184514392 22:44953015-44953037 CCAGGGGGACAGAAGTGGGCTGG + Intronic
1184567610 22:45301558-45301580 CAGGGTGGGCAGGGGTGGGATGG - Intergenic
1184627511 22:45748069-45748091 CTTGGGGGGCTGAGGTGGGACGG + Intronic
1184642119 22:45878329-45878351 CCTGGCGCTCAGAAGGGGGAAGG - Intergenic
1184652950 22:45927387-45927409 CCTGATGGGCAAGAGTGAGATGG - Intronic
1184684015 22:46087934-46087956 CCTGGAGGTCAGCTGTGGGAAGG - Intronic
1184784598 22:46665533-46665555 CCTGGTGGGGGGAGGCGGGAGGG + Intronic
1184974478 22:48051383-48051405 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1185014837 22:48336747-48336769 CCTGCTGGGGAAAAGTGAGAAGG - Intergenic
1185169308 22:49283167-49283189 CCTGGTGGGCAGAGGAGGCCAGG + Intergenic
949564505 3:5232364-5232386 CCTGGTGGGCAGTGTGGGGATGG + Intergenic
950544071 3:13628676-13628698 TCTGTTGGGCAGATGTGAGAGGG + Intronic
950864906 3:16181384-16181406 GCTGGTGGGGAGAGCTGGGAGGG + Intronic
951141942 3:19172821-19172843 ACTGGTGGGGGGAAGGGGGAAGG - Intronic
951735524 3:25859081-25859103 TCTGGCGGGCAGGAGTGGGGGGG + Intronic
951786343 3:26423529-26423551 ACTGGTGGGCAGCAATGGCAGGG - Intergenic
952376254 3:32770112-32770134 CCTGGAAGGCTGAGGTGGGAAGG - Intronic
952456200 3:33474280-33474302 CTTGGGGGGCTGAGGTGGGAGGG + Intergenic
953063745 3:39450386-39450408 CTTGGAAGGCTGAAGTGGGAGGG - Intergenic
953430498 3:42835882-42835904 TCGGGTGGGCAGAAGGAGGAAGG - Intronic
954214652 3:49117552-49117574 CCAGGTGGTCAGCAGTGGGGTGG - Exonic
954622787 3:52005376-52005398 CCTGGTGGGCAGAGGCTGGTGGG + Intergenic
954793773 3:53151017-53151039 CTTAGTGGGCAGTGGTGGGAAGG - Intergenic
955184462 3:56701767-56701789 CCTGGGAGGCTGAGGTGGGAGGG - Intergenic
955822769 3:62913755-62913777 CCTGGGTGGACGAAGTGGGATGG + Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
958182872 3:90083198-90083220 TCTGGCGGGCAGGAGTGGGTGGG - Intergenic
959370602 3:105520760-105520782 CCTGGTAGGGAGATGTGGAATGG + Intronic
960140804 3:114150312-114150334 CATGATGGAAAGAAGTGGGAAGG - Intronic
960592505 3:119379288-119379310 CCTGTGGGGAAAAAGTGGGAGGG + Intronic
960599906 3:119446434-119446456 CCTGGTGGGACAAAATGGGATGG + Intronic
960948503 3:122983123-122983145 CCTGCTGGTCAGAAGAGGCAAGG + Intronic
961237646 3:125381303-125381325 CTTGGTGGGCTGAGGTAGGAGGG + Intergenic
961593956 3:128001824-128001846 ACAGGTGGGCAGAGGTGGGCAGG + Intergenic
961609699 3:128126823-128126845 GGTGGTGCGCAGAAGTGGGATGG - Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962753479 3:138451319-138451341 CAAGGTGGGCAGAGGTGGGAGGG + Intronic
963149647 3:142032209-142032231 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
963918919 3:150887267-150887289 CCTGGTGGGATGGAGTGAGATGG + Intronic
965679097 3:171231889-171231911 GCTGGATGGTAGAAGTGGGATGG - Intronic
966020787 3:175206550-175206572 CTTGGTGGGGAAGAGTGGGAGGG + Intronic
966162426 3:176982794-176982816 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
966261654 3:177985483-177985505 CCTGGTGGTTGGAAGTGGGGAGG - Intergenic
966834360 3:184037999-184038021 CCTGGTGGGGAGGAGAAGGAGGG - Exonic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
967012764 3:185452329-185452351 CTTGGGGGGCTGAAGTGGGAGGG - Intronic
967981501 3:195068686-195068708 CTTGGGAGGCTGAAGTGGGAGGG - Exonic
968030057 3:195475956-195475978 CCTGGGAGGCTGAAGCGGGAGGG - Intergenic
968266165 3:197364992-197365014 CGTAGTGGGAAGTAGTGGGAGGG + Intergenic
968514963 4:1011984-1012006 CCAGGTGGGCACACGGGGGAGGG + Intronic
968541440 4:1170430-1170452 CCTGCTGGGCAGGACTGGGGCGG + Exonic
968772191 4:2514539-2514561 ACTGGTGGGCAGAAACGGGCTGG - Exonic
969265952 4:6064126-6064148 CCTGGTGGGGAGCAAGGGGAAGG + Intronic
969484037 4:7461825-7461847 ACAGGTGGGCAGATGTGGGGTGG - Intronic
969946469 4:10788313-10788335 CTTTGTGGGCAGAAGTGACAAGG + Intergenic
969997864 4:11332982-11333004 CCTAGAGGTAAGAAGTGGGATGG - Intergenic
970087245 4:12364076-12364098 TCTGGCGGGCAGGAGTGGGGGGG - Intergenic
970918875 4:21369487-21369509 TCTGGGGGGCCAAAGTGGGAGGG + Intronic
972109292 4:35536253-35536275 CCTGGGGTGGGGAAGTGGGAGGG - Intergenic
974712694 4:65621308-65621330 CACTGTGGCCAGAAGTGGGATGG + Intronic
976559082 4:86480319-86480341 TCTGGCGGGCAGGAGTGGGGGGG - Intronic
976667485 4:87612434-87612456 CTAAGTGGGCAGAAGTAGGAGGG + Exonic
976949037 4:90806733-90806755 CCTGTTGAGCAAAAGTGGGTTGG - Intronic
977403360 4:96563458-96563480 ACAGCTGGGGAGAAGTGGGATGG + Intergenic
978427892 4:108601322-108601344 AGTGGTTGGCAGAGGTGGGAGGG - Intergenic
978567700 4:110101780-110101802 CCTGGGAGGCTGAGGTGGGAGGG - Intronic
979000113 4:115206833-115206855 CTTGGGAGGCTGAAGTGGGAAGG - Intergenic
981529816 4:145741448-145741470 CCTGGTGGGCAGCAATAGTAGGG + Intronic
981856299 4:149296904-149296926 CCTGGGAGGCAGAGGTGGTAGGG + Intergenic
981968476 4:150635496-150635518 CCTGGTAGGAAGAAGAGAGATGG - Intronic
982767969 4:159369373-159369395 CCTGGAGGCCGGCAGTGGGAGGG + Intergenic
985008180 4:185555471-185555493 CCTGGCGGGGAAGAGTGGGAAGG - Intergenic
985431002 4:189880374-189880396 TCTGGTGGGCAGAACAGGAAAGG - Intergenic
986710143 5:10482656-10482678 CCTGGTGGGAAGGGGAGGGATGG + Intergenic
986841987 5:11708152-11708174 CTTGGGAGGCTGAAGTGGGAGGG - Intronic
987088824 5:14492839-14492861 CCTGGCAGGCAGCAGAGGGAGGG + Intronic
988778250 5:34496448-34496470 CCTAGTGGGCAGAAATAGGAAGG + Intergenic
988940372 5:36139433-36139455 GCTCCTGGGCAGAAGTGGGCAGG + Intronic
988948175 5:36228724-36228746 CCTGGGAGGCTGAGGTGGGAGGG - Intronic
990662527 5:58033179-58033201 CAGGGTGGGCAGAAATGGGCAGG + Intergenic
990703868 5:58505136-58505158 CCTGGTGAGGGGAAGAGGGAGGG + Intergenic
990767024 5:59195343-59195365 CCTGGTGCACTGAAGTGGCAAGG + Intronic
990977565 5:61572925-61572947 CCTGGAGCGCAGGAGTGGCAGGG + Intergenic
992240348 5:74762801-74762823 CCAGGTGGGATTAAGTGGGATGG + Intronic
992739934 5:79763276-79763298 CTTGGTGAGCAGAAGTTAGAGGG - Intronic
992855751 5:80859818-80859840 CCTGGGAGGCTGAGGTGGGAAGG - Intronic
992942627 5:81777366-81777388 CCTGATGCACAGAAGTGAGAAGG + Intergenic
994086224 5:95762230-95762252 CCAGGTGGGGAGAAGTTGAAAGG + Intronic
994212016 5:97097556-97097578 CCTGGGGGACAGGAGTAGGAGGG + Intronic
995858237 5:116615757-116615779 TCTGGCGGGCAGCAGTGGGGTGG + Intergenic
995883443 5:116867613-116867635 TCTGGTGGGCAGGAGTTGGGGGG + Intergenic
996344885 5:122477515-122477537 ACTGCTGGGCAGGAGGGGGAGGG + Intergenic
996833918 5:127770190-127770212 CCTGGGAGGCTGAGGTGGGAGGG - Intergenic
997206576 5:132053746-132053768 CCTGGGGGGCAGAGGTGGAGTGG + Intergenic
997419802 5:133756808-133756830 CCTGGGGGGTTGTAGTGGGAGGG + Intergenic
997941439 5:138161421-138161443 CCTGGGAGGCTGAGGTGGGAAGG - Intronic
998930054 5:147171516-147171538 CGTGGTGGGGTGAGGTGGGAGGG + Intergenic
999571521 5:152925106-152925128 CCTGATGATCTGAAGTGGGATGG + Intergenic
999922356 5:156335652-156335674 CTTGGAGGGCAGGAGGGGGATGG - Intronic
1000072963 5:157758188-157758210 CCTGGGAGGCAGAAGTTGCAGGG - Exonic
1001041295 5:168337420-168337442 TCTGGTGGTCACAACTGGGAGGG + Intronic
1001489216 5:172143984-172144006 CTTGGTTGGCAGTAGAGGGAGGG - Intronic
1001619564 5:173071945-173071967 CTTGGGAGGCAGAAGTGGGAGGG + Intronic
1002324037 5:178393978-178394000 CCTGGTGGGCAGGGTTGGGGTGG - Intronic
1002864686 6:1110543-1110565 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1003485796 6:6578049-6578071 TTTGGGAGGCAGAAGTGGGAGGG + Intergenic
1004196037 6:13506321-13506343 CTTGGGAGGCTGAAGTGGGAGGG - Intergenic
1004345770 6:14847925-14847947 CCTGGAGGGGTGAAGTGGGAGGG - Intergenic
1004468050 6:15904029-15904051 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1006101369 6:31688171-31688193 TCTGGTGGGCAGAGGTAGAAGGG + Intronic
1006150399 6:31983945-31983967 GCTGGTGGGCAGAGGTGGGGAGG - Intronic
1006156700 6:32016683-32016705 GCTGGTGGGCAGAGGTGGGGAGG - Intronic
1007254955 6:40522127-40522149 CCTGCTGGGAAGAGGTGGCAGGG + Intronic
1007375233 6:41451887-41451909 ACTGGCAGGGAGAAGTGGGAAGG - Intergenic
1007699351 6:43757610-43757632 CCTGGCTGGCTGGAGTGGGATGG + Intergenic
1011360214 6:86515951-86515973 CCTGGTGGGTAGAGGTGAGCAGG - Intergenic
1011748738 6:90434121-90434143 CCTGGTGGGCTGAATGGGTAGGG + Intergenic
1012373786 6:98537170-98537192 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1013485896 6:110595658-110595680 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1014530968 6:122558899-122558921 ACTTGTGGGAAAAAGTGGGAGGG - Intronic
1016012670 6:139154600-139154622 CCTGTTGGGCAGACAAGGGAAGG + Intronic
1016429604 6:143968864-143968886 ACTGGGGGGCAGGAGTTGGAGGG + Intronic
1017013341 6:150080008-150080030 CTTGGAGGGCAGATGGGGGAAGG - Intergenic
1017151031 6:151280746-151280768 CTCGGGGGGCTGAAGTGGGAGGG - Intronic
1019011967 6:168849879-168849901 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019011974 6:168849903-168849925 CCTTGTGGGCAGAGGTGGCATGG + Intergenic
1019011980 6:168849927-168849949 CCTTGTGGGAAGAGGTGGCATGG + Intergenic
1019011987 6:168849951-168849973 CCTTGTGGGCAGAGGTGGCATGG + Intergenic
1019011994 6:168849975-168849997 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012001 6:168849999-168850021 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012008 6:168850023-168850045 CCTTGTGGGAAGAGGTGGCATGG + Intergenic
1019012014 6:168850047-168850069 CCTTGTGGGAAGAGGTGGCACGG + Intergenic
1019012021 6:168850071-168850093 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012026 6:168850095-168850117 CCTTGTGCGCAGAGGTGGCACGG + Intergenic
1019012032 6:168850119-168850141 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012037 6:168850143-168850165 CCTTGTGCGCAGAGGTGGCATGG + Intergenic
1019012044 6:168850167-168850189 CCTTGTGGGAAGAGGTGGCATGG + Intergenic
1019012051 6:168850191-168850213 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012058 6:168850215-168850237 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012064 6:168850239-168850261 CCTTGTGGGAAGAGGTGGCACGG + Intergenic
1019012071 6:168850263-168850285 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012077 6:168850287-168850309 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012084 6:168850311-168850333 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012090 6:168850335-168850357 CCTTGTGGGAAGAGGTGGCACGG + Intergenic
1019012096 6:168850359-168850381 CCTTGTGGGAAGAGGTGGCATGG + Intergenic
1019012102 6:168850383-168850405 CCTTGTGGGAAGAGGTGGCACGG + Intergenic
1019012109 6:168850407-168850429 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012115 6:168850431-168850453 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012122 6:168850455-168850477 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012128 6:168850479-168850501 CCTTGTGGGCAGAGGTGGCATGG + Intergenic
1019012135 6:168850503-168850525 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012140 6:168850527-168850549 CTTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012147 6:168850551-168850573 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012154 6:168850575-168850597 CCTTGTGGGCAGAGGTGGCATGG + Intergenic
1019446058 7:1071942-1071964 CCTGGTCGGCACACGTGGGGAGG + Intronic
1019527472 7:1487233-1487255 CTTGGTGGCCAGAAGAGGGCAGG - Intronic
1019571633 7:1715538-1715560 TCTGGGAGGCAGAAGTGGGCAGG - Intronic
1020170606 7:5841975-5841997 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1020262186 7:6536668-6536690 CCTGGTGGGGAGGGGCGGGACGG + Intronic
1021983116 7:26073927-26073949 CTTGGGAGGCAGAGGTGGGAAGG - Intergenic
1022021468 7:26403448-26403470 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1022410729 7:30136433-30136455 CCTTGTGGGCGGAGGTGGGGTGG + Intronic
1023402982 7:39803893-39803915 GGGGGTGGGCAGAAGTGGGCAGG + Intergenic
1024509643 7:50193397-50193419 CCGGGTGGGATGGAGTGGGATGG + Intergenic
1024646354 7:51374244-51374266 GGGGGTGGGCAGAAGTGGGCAGG - Intergenic
1026126319 7:67582743-67582765 CCTGGGAGGCTGAGGTGGGAGGG + Intergenic
1026330956 7:69352189-69352211 CCTGGGAGGCAGAGGTGGCAGGG - Intergenic
1026510896 7:71026744-71026766 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1026772563 7:73211678-73211700 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1027013427 7:74765078-74765100 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1027074611 7:75180955-75180977 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1028747006 7:94338371-94338393 CATGGTGGACAGGAGTGGAAAGG + Intergenic
1028832364 7:95341932-95341954 CCTGGTGGTGGGCAGTGGGAGGG - Intergenic
1029121464 7:98270829-98270851 CTTGGGGGGCAGCAGTGGGGAGG - Intronic
1029885922 7:103871595-103871617 CATGGAGGGCAGGAGTGGAAAGG + Intronic
1029910448 7:104140666-104140688 CCTGGTGGGCAGAACAGGCAGGG - Intronic
1030604130 7:111621077-111621099 CCTGGGAGGCTGAGGTGGGAGGG + Intergenic
1030727911 7:112947857-112947879 CCTGGGAGGCAAGAGTGGGAGGG + Intergenic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1031005119 7:116460974-116460996 TCTGGTGGGCAGGGGTGGGGGGG - Intronic
1031095113 7:117407965-117407987 CCAGGTGGGAAGGAGAGGGATGG + Intronic
1031136836 7:117893627-117893649 CTTGGGGGGTAAAAGTGGGAGGG - Intergenic
1031836435 7:126685803-126685825 GCTCCTGGGCAGAAGGGGGAAGG + Intronic
1031992690 7:128208334-128208356 CCCAGTGGGCAGAAGAGGGCAGG - Intergenic
1032415154 7:131729983-131730005 CCTGGTGGGAACCAGTAGGAGGG + Intergenic
1032499612 7:132390700-132390722 GTTGGTGGGCAGAAGGGGGCTGG - Intronic
1033666562 7:143446280-143446302 GCTGGTGGGAAGAGGAGGGAGGG - Intergenic
1033708559 7:143914162-143914184 CTTGGTAGGCTGAAGTGAGAGGG - Intergenic
1035373054 7:158391588-158391610 GCTGGTGGGAAAATGTGGGAAGG - Intronic
1035403139 7:158581209-158581231 CCTGGTGGGTAGTCCTGGGATGG - Intronic
1036165982 8:6434091-6434113 CATAGTTGGCACAAGTGGGAAGG - Intronic
1036767054 8:11555959-11555981 CCTGGTGGGCGGGGGGGGGAAGG - Intronic
1036799802 8:11781954-11781976 CTTGGGAGGCTGAAGTGGGAGGG + Intronic
1037768801 8:21787372-21787394 GCTGGTGGGAAGAGGCGGGAGGG - Intronic
1038473242 8:27843282-27843304 CCTGGAAGGCAGAAATGAGATGG + Intergenic
1038837447 8:31142365-31142387 TCTGGTGTGTAGAAGTGGAAAGG + Intronic
1039590205 8:38739922-38739944 CCTGTTGGGCAGCAGTGGCCAGG + Intronic
1041153738 8:54962567-54962589 CCTGGGTGGCAGAGGTGAGATGG - Intergenic
1042661109 8:71155513-71155535 ACTGGTGGGCAGAATTTAGATGG + Intergenic
1043235825 8:77864719-77864741 GGTGGTGGGCGGGAGTGGGAAGG + Intergenic
1043442620 8:80289636-80289658 CCTGGGAGGCTGAAGTGAGAGGG + Intergenic
1046593088 8:116229008-116229030 CTTGGGAGGCAGAGGTGGGAAGG - Intergenic
1047596191 8:126380043-126380065 CCTGGAGAACAGAAGTTGGATGG + Intergenic
1048599250 8:135901597-135901619 ACTTGTGGGGAAAAGTGGGAGGG - Intergenic
1048906176 8:139091584-139091606 ACTGGTGGGCAGCACAGGGAAGG + Intergenic
1048990950 8:139759823-139759845 CCTGGAGGCCAGATGTGGGGAGG + Intronic
1049067637 8:140330001-140330023 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1049106757 8:140618718-140618740 CCTGGGAGGCTGAGGTGGGAGGG + Intronic
1049138771 8:140931823-140931845 CCTGGGAGGCTGAGGTGGGAGGG + Intronic
1049436921 8:142590698-142590720 CATGGGGGGCAGAAGTGAGCAGG - Intergenic
1049555009 8:143277358-143277380 CCTGCTGGGCAGCAGTGGCCCGG + Intergenic
1051632808 9:19155983-19156005 TCTGGTTGGAATAAGTGGGAGGG + Intergenic
1051876739 9:21802086-21802108 CCTGGAGGACAGAGCTGGGATGG - Intergenic
1052163620 9:25293900-25293922 TCTGGTGGGCAGGAGTGGCGGGG - Intergenic
1052955706 9:34251787-34251809 TCCGGAGGGCTGAAGTGGGAAGG - Exonic
1052970561 9:34374792-34374814 CTTGGGGGGCTGAGGTGGGAGGG + Intronic
1053265655 9:36711281-36711303 TCTGGTTGGCAGATGAGGGAAGG + Intergenic
1053720222 9:40938567-40938589 TCTGGTGGGCAGAACAGGAAAGG - Intergenic
1054717202 9:68568187-68568209 GATGTGGGGCAGAAGTGGGAGGG - Intergenic
1055317018 9:75043745-75043767 CCTGGAAGGCAGAGGTGGCAGGG + Intergenic
1055638351 9:78298718-78298740 CCTGGGGGGCAGGAGGGTGAGGG + Intronic
1057035496 9:91809186-91809208 CCTGGTGGGGAGAGATGGAAGGG - Intronic
1057286542 9:93760310-93760332 CCAGGGTGGCAGCAGTGGGATGG - Intergenic
1057761772 9:97880523-97880545 CTTGGCAGGCAGAAGTGGGAAGG - Intergenic
1059717824 9:116930164-116930186 CCAGGTGGGCACCATTGGGATGG + Intronic
1060411290 9:123402122-123402144 CCTGGTGGGAACATGAGGGATGG - Intronic
1060535149 9:124380102-124380124 GCTGGTGGGCACCAGTGGTAAGG + Intronic
1060609465 9:124949570-124949592 CCTGGGAGGCCGAGGTGGGAGGG - Intronic
1060826169 9:126689263-126689285 GCTGGTGGGGCGAAGTGGGCAGG - Intronic
1061308703 9:129748390-129748412 CCTGGAGGTCAGAGGTAGGAGGG + Intronic
1061525093 9:131154002-131154024 GCTGGTGGGCACAATTGGGAGGG + Intronic
1062235782 9:135506933-135506955 TCAGGTGGGCAGAAGTGACAAGG + Intergenic
1062535258 9:137018508-137018530 AAAGGTGGGCAGAAGTGGGGAGG + Intronic
1203425569 Un_GL000195v1:33608-33630 TCTGGCGGGCAGGAGTGGGGGGG - Intergenic
1185729984 X:2453562-2453584 CCTGGGAGGCTGAGGTGGGAGGG + Intronic
1185732247 X:2470598-2470620 CCTGGGAGGCTGAGGTGGGAGGG + Intronic
1187342811 X:18436436-18436458 CCTTGGGGGAAGAGGTGGGAAGG + Intronic
1188675436 X:32934310-32934332 CCTGGGAGGCTGAGGTGGGAGGG + Intronic
1189230828 X:39451183-39451205 GCTGTTGTGGAGAAGTGGGAGGG - Intergenic
1189321216 X:40088803-40088825 CCTGGTTGGAAGAGGTGAGAGGG - Intronic
1189361580 X:40357510-40357532 CCCGGGAGGCAGAAGTGGCAGGG + Intergenic
1189527106 X:41834547-41834569 CTTGGTGGGAGGAAGTGGGAAGG - Intronic
1190165788 X:48071835-48071857 CCAGGTGGGGAGAAGTGGGCGGG - Intergenic
1190190049 X:48269448-48269470 CCTGGTAGGCAGAGGTTGCAGGG - Intronic
1190322616 X:49187564-49187586 TTTGGTGGCCAGTAGTGGGAGGG + Intergenic
1191600830 X:63003903-63003925 CTTGGGAGGCTGAAGTGGGAAGG - Intergenic
1194350928 X:92824677-92824699 TCTGGCGGGCAGGAGTGGGGGGG - Intergenic
1194411884 X:93567754-93567776 TTTGGGGGGAAGAAGTGGGAGGG - Intergenic
1194589511 X:95781641-95781663 CTGGGTGGGAAAAAGTGGGATGG - Intergenic
1195529541 X:105937476-105937498 TCTGATGGACAGAAGTGGAAAGG + Exonic
1196145915 X:112316730-112316752 TCTGGTTGGGAGAAGTGGGAGGG - Intergenic
1196675812 X:118419176-118419198 CCTCCTGGCCAGAAGGGGGAGGG - Intronic
1197351583 X:125389019-125389041 TCTGGTGGGCAGGAGTGGGGGGG + Intergenic
1197371991 X:125637405-125637427 CCCAGTGGGCAGAATTTGGATGG - Intergenic
1197562982 X:128047347-128047369 CTTGGTGGGCAGAAGAGGCAGGG + Intergenic
1199012818 X:142777477-142777499 TCTGGAAGGCTGAAGTGGGAGGG + Intergenic
1199742493 X:150748719-150748741 CTTGGCAGGCTGAAGTGGGAGGG + Intronic
1199897279 X:152137334-152137356 CCCGGCAGGCAGAAGTGGGGAGG + Intronic
1200806641 Y:7440362-7440384 CTTGGGAGGCTGAAGTGGGAGGG + Intergenic
1201274461 Y:12285203-12285225 CCTGGTGAGCAGCTGTGGAAGGG + Intergenic
1202162212 Y:21946644-21946666 CCTGGTTAGCAGAAATAGGAGGG - Intergenic
1202229144 Y:22639729-22639751 CCTGGTTAGCAGAAATAGGAGGG + Intergenic
1202314010 Y:23556437-23556459 CCTGGTTAGCAGAAATAGGAGGG - Intergenic
1202556792 Y:26114158-26114180 CCTGGTTAGCAGAAATAGGAGGG + Intergenic