ID: 919811890

View in Genome Browser
Species Human (GRCh38)
Location 1:201414049-201414071
Sequence ACCTAGTGATGCCACCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 799
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 776}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919811890 Original CRISPR ACCTAGTGATGCCACCACCC AGG Intronic
900239895 1:1611151-1611173 ACCTAGGAATGCCTGCACCCAGG + Intergenic
900254224 1:1688936-1688958 ACCTCGTGATGCGCCCACCTCGG - Intronic
900262940 1:1741878-1741900 ACCTCGTGATGCGCCCACCTCGG - Intronic
900919468 1:5661539-5661561 ACCATAAGATGCCACCACCCTGG + Intergenic
901368298 1:8773590-8773612 ACCTTGTGATTCGCCCACCCTGG - Intronic
901538366 1:9898290-9898312 ACCTCGTGATGCGCCCACCTTGG - Intronic
901931482 1:12598633-12598655 ACCTAGTGATGCCCACAGCAAGG - Intronic
902114711 1:14111969-14111991 ACCTAGTGATCCACCCACCTCGG + Intergenic
903110993 1:21133456-21133478 ACCTCGTGATCCGCCCACCCCGG + Intronic
903853242 1:26320782-26320804 TACTAGAGATGCCACCACCCTGG + Intergenic
904131100 1:28275910-28275932 CTCCAGTGATGCCACCACACAGG - Intronic
904242167 1:29154426-29154448 ACCTTGTGATGCGCCCACCTTGG + Intronic
905032813 1:34899299-34899321 ACCTCGTGATCCGACCACCTCGG + Intronic
905567732 1:38979144-38979166 ACCTAGTGATCCGCCCACCTCGG + Intergenic
906303427 1:44700382-44700404 ACCTCGTGATGCGCCCACCTTGG - Intronic
906496045 1:46304616-46304638 ACCTAGTGATCCGCCCACCCCGG + Intronic
906628531 1:47345688-47345710 ACCTCGTGATCCCCCCACCTCGG + Intronic
906775667 1:48527361-48527383 ACCTCGTGATCCACCCACCCCGG - Intergenic
906807081 1:48789520-48789542 ACCTTGTGATCCTACCACCTTGG + Intronic
906984012 1:50663634-50663656 ACCTCGTGATCCACCCACCCTGG + Intronic
907000542 1:50849023-50849045 ACCTTGTGATCCACCCACCCTGG - Intronic
908103717 1:60818024-60818046 ACCTCGTGATTCCCCCACCTCGG + Intergenic
908151733 1:61309655-61309677 ACCTCGTGATCCACCCACCCTGG - Intronic
908768406 1:67574234-67574256 ACCTCGTGATCCCCCCACCTTGG + Intergenic
909016037 1:70380698-70380720 ACATAGTGATGCGCCCACCTCGG + Intronic
909218383 1:72921478-72921500 ACCTTGTGATCCACCCACCCCGG + Intergenic
909515754 1:76505353-76505375 ACCTAGTGATCCACCCACCTTGG + Intronic
909556793 1:76963094-76963116 TCCTAGTCATCCCACCTCCCTGG - Intronic
911268629 1:95774216-95774238 ACCTTCTGATGCCATCACCTTGG - Intergenic
911350131 1:96743944-96743966 ACCTTGTGATCCAACCACCTTGG - Intronic
912092564 1:106098912-106098934 ACCTCGTGATCCGACCACCTCGG - Intergenic
912231700 1:107800614-107800636 AACAAATGATCCCACCACCCAGG + Intronic
914217008 1:145640461-145640483 ACCTTGTGATCCACCCACCCTGG - Intronic
914469576 1:147963142-147963164 ACCTTGTGATCCACCCACCCTGG - Intronic
914727168 1:150337542-150337564 ACCTAGTGATTCGCCCACCTCGG - Intronic
914743464 1:150484102-150484124 ACCTCGTGATCCGACCACCTTGG - Intergenic
915190705 1:154148024-154148046 ACCTAGTGATCCACCCACCTCGG - Intronic
916170299 1:161996922-161996944 ACCTTGTGATCCCCCCACCTCGG - Intronic
916819515 1:168384967-168384989 ACCTTGTGATCCCCCCACCTCGG + Intergenic
917322796 1:173801281-173801303 ACCTAGTGATCCACCCACCTCGG - Intronic
917521634 1:175752647-175752669 ACCCAGTTCTGCCACAACCCAGG - Intergenic
917867435 1:179210617-179210639 ACCTCGTGATGCGCCCACCTCGG - Intronic
919002103 1:191846002-191846024 ACCTCGTGATCCGACCACCTCGG + Intergenic
919435501 1:197554604-197554626 ACCTTGTGATCCCTCCACCTCGG - Intronic
919537481 1:198806164-198806186 ACCTCGTGATCCCCCCACCTTGG + Intergenic
919715180 1:200768883-200768905 ACCTCGTGATCCACCCACCCTGG + Intronic
919811890 1:201414049-201414071 ACCTAGTGATGCCACCACCCAGG + Intronic
920889365 1:209968825-209968847 TACCATTGATGCCACCACCCAGG + Intronic
920937598 1:210450058-210450080 ACCTTGTGATCCAACCACCTCGG - Intronic
921207615 1:212861901-212861923 ACCTCGTGATCCCCCCACCTCGG + Intronic
922248882 1:223828340-223828362 ACTTAGTCATCCCACCACCAGGG - Intronic
922883266 1:228998712-228998734 ACCTCGTGATCCAACCACCTCGG + Intergenic
923111111 1:230890880-230890902 ACCTAGTGATCCACCCACCTTGG - Intergenic
923398860 1:233595773-233595795 ACCTCGTGATCCCCCCACCACGG - Intergenic
924107946 1:240668139-240668161 ACCTAGTGATCCGCCCACCTCGG + Intergenic
924203865 1:241690237-241690259 ACCTTGTGATGCACCCACCTTGG - Intronic
1062889712 10:1049058-1049080 GCCTGGTGGTGCCACCTCCCTGG + Exonic
1063333972 10:5191723-5191745 ACCTTGTGATCCACCCACCCTGG - Intergenic
1063741705 10:8829533-8829555 ACCTCGTGATCCCCCCACCTCGG + Intergenic
1064100801 10:12462395-12462417 ACCTTGTGATCCGCCCACCCTGG + Intronic
1064836317 10:19535115-19535137 ACCTAGTGATTCGCCCACCTAGG + Intronic
1065014422 10:21448775-21448797 ACCTGGTGATGCACCCACCTTGG - Intergenic
1068682988 10:59840055-59840077 ACCTCGTGATCCCCCCACCTCGG + Intronic
1069130728 10:64698694-64698716 TCCCAGTGATCCCATCACCCAGG - Intergenic
1069603310 10:69723573-69723595 ACCTAGTGATCCGCCCACCTTGG + Intergenic
1069617528 10:69815557-69815579 ACCTACTTAGGCCACCAGCCTGG - Intronic
1070521268 10:77255678-77255700 ACCTCGTGATCCCCCCACCTCGG - Intronic
1070858097 10:79624884-79624906 TCCTAGTGATCCCATCACCCAGG + Intergenic
1071238905 10:83682030-83682052 ACCTCGTGATCCACCCACCCCGG + Intergenic
1072171853 10:92870939-92870961 ACCTCGTGATCCAACCACCTTGG + Intronic
1072644161 10:97239259-97239281 ACCTTGTGATCCCCCCACCTCGG - Intronic
1073243099 10:102071049-102071071 ACCTCGTGATCCGCCCACCCTGG + Intergenic
1074291988 10:112144575-112144597 ACCTCGTGATCCACCCACCCTGG - Intergenic
1075144188 10:119869338-119869360 ACCTAGTGATCCGCCCACCTTGG - Intronic
1075193134 10:120329818-120329840 TCTTAGTGCTGCCCCCACCCAGG + Intergenic
1076124041 10:127960788-127960810 ACCTAGTGATCCGCCCACCTCGG - Intronic
1076239346 10:128892298-128892320 TCCAAGTGATCCCATCACCCAGG - Intergenic
1076625078 10:131816592-131816614 ACCTGGTGATGCCCCCGGCCTGG - Intergenic
1076740742 10:132482928-132482950 ACCTCGTGATCCGCCCACCCCGG - Intergenic
1076824706 10:132961025-132961047 CCCTCGGGATGGCACCACCCTGG - Intergenic
1077032647 11:476510-476532 CCCCAGTGATGCCGCCACCCAGG - Intronic
1077088315 11:765767-765789 ACCTTGTGATCCACCCACCCCGG + Intergenic
1077277745 11:1723511-1723533 ACCTAGTGATCCATCCACCTTGG - Intergenic
1077587727 11:3466739-3466761 ACCTCGTGATCCGACCATCCTGG - Intergenic
1078209321 11:9257713-9257735 ACCTTGTGATCCGCCCACCCCGG + Intronic
1079130877 11:17746259-17746281 ACCTGCTGGTGTCACCACCCAGG + Intronic
1079673655 11:23199090-23199112 ACCAACTGAAGCCACAACCCAGG + Intergenic
1080092278 11:28362415-28362437 TCCTAATGATCCCATCACCCAGG + Intergenic
1080774809 11:35375700-35375722 ACCTGCTGATGCCACTGCCCGGG - Intronic
1081518072 11:43853102-43853124 ACCTTGTGATGCACCCACCTCGG - Intronic
1081793946 11:45807059-45807081 TGGTAGTGATGCCACAACCCAGG - Intronic
1081833639 11:46135905-46135927 ACCTCGTGATCCGACCACCTCGG + Intergenic
1082795247 11:57374202-57374224 ACCTCGTGATCCGCCCACCCTGG - Intergenic
1083435757 11:62641961-62641983 ACCTTGTGATCCGCCCACCCCGG - Intronic
1083460706 11:62809439-62809461 ACCTCGTGATGCACCCACCTCGG - Intronic
1083575674 11:63789290-63789312 ACCTCGTGATGCACCCACCTTGG - Intergenic
1084090653 11:66877454-66877476 ACCTCGTGATGCACCCGCCCTGG - Intronic
1084564019 11:69919441-69919463 ACCCAGAGGTGCCACCACCTTGG + Intergenic
1084605040 11:70167550-70167572 TCCTAGTGCTGCCACCCCCTTGG + Intronic
1084671533 11:70609455-70609477 ACCCAGTAATTCCACCACACAGG + Intronic
1085041794 11:73331141-73331163 ACCTAGTCCTGCCACTACCCTGG + Intronic
1085294884 11:75425720-75425742 GCCCAGTGCTGCCACCACCTGGG + Intronic
1085961279 11:81465606-81465628 ACCTAGTGATCCACCCACCTCGG - Intergenic
1086880443 11:92147285-92147307 ACCTCGTGATCCGCCCACCCCGG + Intergenic
1087305329 11:96482898-96482920 ACCTCGTGATCCAACCACCTCGG + Intronic
1087361566 11:97166807-97166829 ACCTCGTGATCCCCCCACCTCGG - Intergenic
1088357465 11:108958998-108959020 ACCAAGTGGTGCCTCCAGCCGGG - Intergenic
1088397661 11:109386373-109386395 ACCTAGTGGTGCCACTACATAGG - Intergenic
1089473208 11:118737494-118737516 ACCTAGTGATCCCCCCACCTTGG + Intergenic
1089640737 11:119845634-119845656 GCCTATTGATCCCACCATCCTGG + Intergenic
1090176806 11:124657114-124657136 GCCTAGAGCTGCCACCACCAAGG - Intronic
1090219652 11:125007907-125007929 ACCCACTGTTGCCAGCACCCAGG - Intronic
1090757030 11:129801626-129801648 ACCTAGTGATCCACCCACCTCGG - Intergenic
1090807869 11:130213580-130213602 ACTTAGAGATGGCACCACCTTGG - Intergenic
1091709605 12:2729401-2729423 ACCTCGTGATACCCCCACCTCGG - Intergenic
1092050594 12:5466996-5467018 ACCTTGTGATCCAACCGCCCTGG - Intronic
1092413978 12:8275509-8275531 ACCTCGTGATCCGACCATCCTGG - Intergenic
1093133062 12:15415616-15415638 ACCTTGTGATCCGCCCACCCTGG + Intronic
1093239302 12:16649483-16649505 ACCTAGTGATCCGCCCACCTCGG - Intergenic
1093551862 12:20422111-20422133 ACCTAGTGATCCGCCCACCTCGG - Intronic
1093597113 12:20975506-20975528 ACCTTGTGATGCACCCACCTCGG + Intergenic
1093777788 12:23097662-23097684 ACCTTGTGATCCAACCACCTTGG + Intergenic
1095156151 12:38857677-38857699 ACCTCGTGATCCACCCACCCTGG - Intronic
1095964074 12:47855094-47855116 ACCTCGTGATCCAACCACCTTGG - Intronic
1096016088 12:48276405-48276427 ACCTAGTGATCCACCCACCTTGG + Intergenic
1096168617 12:49447468-49447490 ACCTCGTGATCCCCCCACCTCGG + Intronic
1096269508 12:50153509-50153531 ACCTTGTGATGCGCCCACCTCGG + Intronic
1096276606 12:50214573-50214595 ACCTTGTGATCCCCCCACCTTGG - Intronic
1096739467 12:53681738-53681760 ACCTCGTGATCCCCCCACCTCGG - Intergenic
1096742618 12:53705052-53705074 ACCTCGTGATGCACCCACCTTGG - Intergenic
1097064664 12:56312109-56312131 ACCTAGTGATCCGCCCACCTTGG + Intronic
1097128488 12:56792067-56792089 ACCTAGTGATCCGCCCACCTCGG - Intergenic
1100195413 12:92239412-92239434 ACCTTGTGATTCACCCACCCTGG + Intergenic
1100311163 12:93395950-93395972 ACCTAGTGATCCGCCCACCTCGG + Intronic
1100380125 12:94054138-94054160 ACCTCGTGATCCAACCACCTCGG - Intergenic
1100660635 12:96694788-96694810 ACCTGGTGATCCGCCCACCCCGG - Intronic
1100961047 12:99963044-99963066 ACCTCGTGATGCACCCACCTCGG + Intronic
1100983208 12:100180182-100180204 ACCTAGTGATCCACCCACCTCGG + Intergenic
1101174497 12:102135309-102135331 ACCTAGTGATCCACCCACCTTGG - Intronic
1101793636 12:107953252-107953274 ACCTAGTGATCCGCCCACCTCGG + Intergenic
1101847565 12:108374913-108374935 ACCTAAGCATCCCACCACCCTGG + Intergenic
1101982238 12:109417558-109417580 ACCTCGTGATGCACCCACCTTGG + Intronic
1102097381 12:110251145-110251167 ACCTCGTGATCCAACCACCTCGG - Intergenic
1102118288 12:110420213-110420235 ACCTAGTGATCCACCCACCTTGG - Intergenic
1102270007 12:111525913-111525935 ACCTAGTGATACCCCCACCTTGG + Intronic
1102563695 12:113780601-113780623 ACCTCGTGATGCGCCCACCTGGG - Intergenic
1102971953 12:117175601-117175623 TCCCAGTGTTGCCACCAGCCAGG + Intronic
1103149762 12:118626885-118626907 ATCTAGTCATGCCACCTCCATGG - Intergenic
1103215724 12:119199996-119200018 ACCTCGTGATCCACCCACCCTGG + Intronic
1103574367 12:121866062-121866084 ACCTCGTGATCCAACCACCTCGG - Intergenic
1104123057 12:125817750-125817772 ACCTCGTGATCCTCCCACCCTGG + Intergenic
1104357598 12:128101544-128101566 ACCCAGTGTAGCCACCACCAAGG + Intergenic
1104439745 12:128785186-128785208 ACCTCCTGATACCATCACCCTGG - Intergenic
1105373995 13:19826521-19826543 ACCTCGTGATCCCCCCACCTCGG - Intronic
1105391006 13:19978108-19978130 ACCTAGTGATCCTCCCACCTTGG + Intronic
1105457404 13:20554292-20554314 ACCTTGTGATCCACCCACCCCGG - Intergenic
1105621293 13:22069418-22069440 ACCTCATGATCCAACCACCCTGG - Intergenic
1105879721 13:24593452-24593474 ACCTCGTGATCCACCCACCCTGG - Intergenic
1105944748 13:25179693-25179715 ACCTCCTGATACCACCACCTGGG + Intergenic
1106819136 13:33443650-33443672 ACCTAGTGATCCACCCACCTTGG - Intergenic
1107530747 13:41280166-41280188 ACCTTGTGATCCGCCCACCCTGG + Intergenic
1108033215 13:46258574-46258596 ACCTCGTGATTCGCCCACCCCGG - Intronic
1108643148 13:52401530-52401552 ACCTGGTGATCCGCCCACCCCGG + Intronic
1109156662 13:58919474-58919496 ACCTTGTGATCCACCCACCCTGG + Intergenic
1110035382 13:70675934-70675956 ACCTAGTGATCCGCCCACCTCGG - Intergenic
1110041269 13:70762243-70762265 ACCTACTAATGCCATCACACTGG - Intergenic
1110045967 13:70831033-70831055 ACCTTGTGATGCACCCACCTTGG + Intergenic
1111024933 13:82508901-82508923 ACCTAGTGATCCGCCCACCTCGG - Intergenic
1111068748 13:83134209-83134231 ACCTTGTGATCCACCCACCCTGG - Intergenic
1111269997 13:85869175-85869197 ACCTTGTGATACCCCCACCTCGG + Intergenic
1111689770 13:91549035-91549057 ACCTAGTGATCCGACCACCTTGG - Intronic
1111891111 13:94083349-94083371 ACCTTGTGATGCGCCCACCTTGG + Intronic
1112518247 13:100074812-100074834 ACCTCGTGATCCAACCACCTCGG + Intergenic
1112717620 13:102204776-102204798 ACCAAGTGATGCTCCCACCTCGG + Intronic
1113982374 13:114287356-114287378 ACCTTGTGATCCGCCCACCCTGG - Intronic
1114041601 14:18683823-18683845 ACCTAGTGATCCACCCACCTTGG + Intergenic
1114165947 14:20218403-20218425 ACCTAGTGATGCGCCCACTTCGG + Intergenic
1115032611 14:28814989-28815011 ACCTAGTGATCCGCCCACCTCGG + Intergenic
1115181350 14:30629807-30629829 ACCTAGTGATCCGCCCACCTCGG + Intronic
1115252657 14:31365591-31365613 ACCTCGTGATGCACCCACCTCGG + Intronic
1115614691 14:35083506-35083528 ACCTAGTGATCCGCCCACCTTGG - Intronic
1116435232 14:44888384-44888406 ACCTTGTGATCCCCCCACCTCGG + Intergenic
1116947564 14:50849647-50849669 ACCTCGTGATCCCCCCACCTCGG - Intergenic
1117153179 14:52909819-52909841 ACCTCGTGATCCACCCACCCTGG - Intronic
1117398737 14:55338673-55338695 ACCTTGTGATGCACCCACCTTGG - Intronic
1117412351 14:55461825-55461847 ACCTTGTGATCCGCCCACCCCGG + Intergenic
1118174284 14:63422491-63422513 ACCTCGTGATCCCCCCACCTTGG - Intronic
1118432206 14:65730438-65730460 ACCTAGTGATCCGCCCACCTCGG - Intronic
1118701583 14:68438861-68438883 AGCTACTGATGCCACTCCCCTGG - Intronic
1120167255 14:81214410-81214432 ACCTTGTGATCCCCCCACCTCGG - Intronic
1121060515 14:90904180-90904202 ACCTAGTGATCCGCCCACCTTGG + Intronic
1121463007 14:94096460-94096482 ACCTCGTGATCCGCCCACCCTGG - Intronic
1121701907 14:95961104-95961126 ACCTCGTGATCCACCCACCCGGG - Intergenic
1122233061 14:100316836-100316858 ACCTCGTGATCCGCCCACCCCGG + Intergenic
1202937555 14_KI270725v1_random:105191-105213 ACCTCGTGATCCACCCACCCCGG - Intergenic
1124002318 15:25769720-25769742 GCATGGTGATGCCACCATCCAGG + Intronic
1124060599 15:26290320-26290342 ACCTTGTGATGCACCCACCTCGG - Intergenic
1124255602 15:28139825-28139847 ACCTTGTGATCCGACCACCTTGG - Intronic
1124416508 15:29476824-29476846 AGACAGCGATGCCACCACCCTGG + Intronic
1124597803 15:31104825-31104847 ACCTTGTGATCCGCCCACCCTGG + Intronic
1124930203 15:34112337-34112359 ACCTCTTGATGCCCCCACCTTGG + Intergenic
1125027355 15:35044310-35044332 ACCTTGTGATCCGCCCACCCTGG + Intergenic
1125085499 15:35724866-35724888 ACCTCCTGATGCCACCACACTGG - Intergenic
1125085826 15:35728079-35728101 ACCTTGTCAAGCCACCTCCCAGG - Intergenic
1125302875 15:38275727-38275749 ACCTCGTGATCCACCCACCCCGG + Intronic
1125395505 15:39243278-39243300 ACCTCCTGATGCCATCACCTTGG + Intergenic
1125566080 15:40679555-40679577 ACCTAGTGATCCGCCCACCTTGG + Intergenic
1125665542 15:41427382-41427404 ACCTCGTGATCCACCCACCCTGG + Intronic
1126006949 15:44266947-44266969 ACCTAGTGATCCGCCCACCTTGG + Intergenic
1126654858 15:50966150-50966172 ACCTAGTGATCCACCCACCTTGG + Intronic
1126776077 15:52101739-52101761 ACCTCGTGATGCGCCCGCCCCGG + Intergenic
1127498007 15:59530620-59530642 ACCTCGTGATCCCCCCACCTCGG + Intergenic
1127830360 15:62744777-62744799 ACCTAGTGATCCACCCACCTCGG + Intronic
1127941543 15:63702870-63702892 ACCTCGTGATCCCCCCACCTTGG - Intronic
1128005045 15:64230737-64230759 ACCTAGTGATCCACCCACCTTGG - Intronic
1128105474 15:65041522-65041544 ACCTCGTGATCCGACCACCTCGG + Intergenic
1128420847 15:67490435-67490457 ACCTCGTGATGCACCCACCTGGG + Intronic
1128885721 15:71285620-71285642 ACCTAGTGATCCACCCACCTTGG - Intronic
1128997468 15:72307318-72307340 ACCTAGGCCTCCCACCACCCAGG + Intronic
1129027731 15:72594399-72594421 ACCTCGTGATCCAACCACCTTGG + Exonic
1129347048 15:74928616-74928638 ACCTCGTGATCCGCCCACCCTGG + Intronic
1130632699 15:85584799-85584821 ACCTAGTGATGCCACTACTCTGG - Intronic
1130989629 15:88868572-88868594 ATCTACTGATGCCACCACCGAGG + Intronic
1131088555 15:89599872-89599894 ACCTCGTGATCCACCCACCCTGG - Intronic
1132187470 15:99814164-99814186 ACCTCGTGATCCACCCACCCTGG + Intergenic
1132409487 15:101565760-101565782 CCTGAGTGTTGCCACCACCCTGG - Intergenic
1132414364 15:101610098-101610120 GCACAGTGATGCCACCTCCCAGG + Intergenic
1132590027 16:722509-722531 ACCTAGTTCTGCCCCCATCCCGG + Exonic
1132704199 16:1235727-1235749 ACCTCGTGATCCTCCCACCCTGG + Intergenic
1132707319 16:1250698-1250720 ACCTCGTGATCCTCCCACCCTGG - Intergenic
1132801179 16:1754538-1754560 ACCTTGTGATCCGCCCACCCTGG - Intronic
1132874282 16:2129092-2129114 ACCTTGTGATCCCCCCACCTTGG + Intronic
1133041043 16:3059795-3059817 AGCCACTGATTCCACCACCCAGG - Exonic
1133181153 16:4055598-4055620 ACCTCGTGATCCCCCCACCCCGG - Intronic
1133217297 16:4300460-4300482 ACCTCGTGATGCGCCCACCTCGG - Intergenic
1133246002 16:4449227-4449249 ACCTAGTGATCCACCCACCTTGG + Intronic
1133683010 16:8138307-8138329 ACCTCGTGATGCACCCACCTCGG - Intergenic
1134019782 16:10913545-10913567 ACCTCGTGATCCCCCCACCTCGG + Intronic
1134475212 16:14567686-14567708 ACCTGGTGATGCCAGAACCGAGG - Intronic
1134553227 16:15147916-15147938 ACCTTGTGATCCCCCCACCTTGG + Intergenic
1135800909 16:25494325-25494347 ACCAAGTGATGCCCCCTCCATGG - Intergenic
1136316495 16:29457644-29457666 CCCTTGTGTTGCCCCCACCCTGG + Exonic
1136431072 16:30196986-30197008 CCCTTGTGTTGCCCCCACCCTGG + Exonic
1136543090 16:30939649-30939671 ACCTAGTGATCCACCCACCTCGG + Intronic
1137675578 16:50302169-50302191 ACCTGCGGGTGCCACCACCCTGG - Intronic
1138844400 16:60547831-60547853 ACCTTGTGATCCGACCACCTCGG - Intergenic
1138934379 16:61700510-61700532 ACCTTGTGATCCCCCCACCTCGG + Intronic
1139264621 16:65627318-65627340 ACCTCGTGATGCACCCACCTCGG + Intergenic
1139449845 16:67020750-67020772 ACCTCGTGATCCCCCCACCTCGG + Intergenic
1139533624 16:67557683-67557705 ACCTAGTGATCCGCCCACCTCGG + Intergenic
1139570451 16:67808341-67808363 ACCTAGTGATCCCCCCGCCTCGG - Intronic
1139781864 16:69358377-69358399 ACCTAGTGATCCACCCACCTCGG + Intronic
1139952340 16:70678482-70678504 GCCGAGAGATGCCACCACCAGGG - Intronic
1140114713 16:72031442-72031464 ACCTCGTGATCCACCCACCCTGG - Intergenic
1140167973 16:72573994-72574016 ACCTTGTGATCCCCCCACCTGGG - Intergenic
1140470409 16:75210828-75210850 ACCTCGTGATCCGCCCACCCCGG + Intergenic
1140470868 16:75213625-75213647 CTCTTGTGAGGCCACCACCCTGG + Intergenic
1140790294 16:78384900-78384922 ACCTTGTGATCCACCCACCCCGG - Intronic
1140844558 16:78874026-78874048 ACCTTGTGATCCGCCCACCCCGG - Intronic
1141061632 16:80878187-80878209 ACCTCGTGATCCCCCCACCTCGG + Intergenic
1141126783 16:81406540-81406562 ACCTCGTGATCCCCCCACCTCGG + Intergenic
1141524276 16:84601685-84601707 ACCTCGTGATCCCCCCATCCTGG + Intronic
1141578316 16:84980196-84980218 ACCTCGTGATCCGCCCACCCCGG + Intronic
1141771866 16:86094391-86094413 ACCTCCTGATGCCAGAACCCTGG - Intergenic
1142028809 16:87828363-87828385 ACTCAGAGATGCCCCCACCCCGG - Intergenic
1142296250 16:89224384-89224406 ACCTTGTGATCCGCCCACCCCGG - Intronic
1142350850 16:89579055-89579077 ACCTCGTGATCCCCCCACCTCGG - Intronic
1203142472 16_KI270728v1_random:1777342-1777364 ACCTTGTGATGCACCCACCTCGG + Intergenic
1142844695 17:2663924-2663946 ACCTCGTGATGCGCCCACCTCGG + Intronic
1143675363 17:8428594-8428616 ACCTCGTGATCTGACCACCCTGG + Intronic
1143718448 17:8793080-8793102 ACCTAGTGATCCGCCCACCTCGG - Intergenic
1144015600 17:11192227-11192249 ACCTTGTGATGCGCCCACCTAGG - Intergenic
1144029983 17:11310873-11310895 ACCTTGTGATGCGCCCACCTAGG - Intronic
1144265122 17:13561623-13561645 ACCTCGTGATCCAACCACCTTGG + Intronic
1144334965 17:14260418-14260440 ACCTCGTGATGCGCCCACCTTGG + Intergenic
1144480884 17:15628174-15628196 ACCTCGTGATGCACCCACCTCGG - Exonic
1144499519 17:15773041-15773063 ACCTCGTGATGCACCCACCTCGG + Intergenic
1144997139 17:19277837-19277859 ACCTCGTGATCCGCCCACCCTGG - Intronic
1145162900 17:20588059-20588081 ACCTCGTGATGCACCCACCTCGG + Intergenic
1145992056 17:29085261-29085283 ACCAAGTGTGGCCACCTCCCTGG - Intronic
1146042634 17:29471508-29471530 ACCTCGTGATCCCCCCACCTCGG + Intronic
1146382932 17:32344673-32344695 ACCTAGTGATCCACCCACCTCGG - Intronic
1146595863 17:34168131-34168153 ATTGAGTCATGCCACCACCCAGG + Intronic
1146728682 17:35175702-35175724 ATTTAGGGATGCAACCACCCAGG - Intronic
1146970830 17:37070707-37070729 ACCTTGTGATCCAACCACCTTGG - Intergenic
1147032936 17:37655734-37655756 ACCTCGTGATCCAACCACCTCGG - Intergenic
1147666377 17:42151201-42151223 ACCTCGTGATCCGCCCACCCTGG - Intronic
1147804812 17:43123579-43123601 ACCTCGTGATCCTACCACCTTGG + Intronic
1147884711 17:43676832-43676854 TCCTATTGCTGCCACCTCCCTGG + Intergenic
1147909021 17:43843703-43843725 ACCTTGTGATCCGCCCACCCCGG + Intergenic
1147982740 17:44284633-44284655 ACCTCGTGATCCCCCCACCTCGG - Intergenic
1148336535 17:46845719-46845741 ACCTTGTGATCCAACCACCTCGG + Intronic
1148574392 17:48699227-48699249 ACCTCGTGATCCACCCACCCTGG - Intergenic
1149030807 17:52080217-52080239 ACCTCGTGATGCGCCCACCTTGG - Intronic
1149117630 17:53116938-53116960 ACCTAGTGATCCACCCACCTTGG + Intergenic
1149159421 17:53672774-53672796 ACCTCGTGATCCGACCACCTCGG + Intergenic
1149322087 17:55491924-55491946 ACCTCGTGATTCCCCCACCTCGG - Intergenic
1149361237 17:55898116-55898138 TCCTAATGATACCTCCACCCAGG + Intergenic
1150756303 17:67917354-67917376 ACCTCGTGATCCCCCCACCTTGG + Intronic
1150910467 17:69382138-69382160 ACCTCGTGATCCGACCACCTCGG - Intergenic
1151504356 17:74516777-74516799 ACCTGGTGATGGCTCCATCCTGG - Intergenic
1151738074 17:75958433-75958455 ACCTCGTGATCCCCCCACCTCGG - Intronic
1151807681 17:76416669-76416691 TCCCAGTGATGCCAGCATCCCGG - Intronic
1151818161 17:76481719-76481741 ACCTCGTGATCCCCCCACCTCGG - Intronic
1152133736 17:78492229-78492251 ACCCAGTGACGCCACCTCCTGGG + Intronic
1152763260 17:82120986-82121008 ACCTAGTGATCCACCCACCTCGG + Intronic
1152868405 17:82737553-82737575 ACCTTGTGATCCGCCCACCCCGG + Intronic
1153047931 18:873359-873381 TACAAGTGATGCCATCACCCAGG - Intergenic
1153315712 18:3719331-3719353 ACCTCGTGATCCGCCCACCCCGG - Intronic
1153744624 18:8164929-8164951 ACCTAGTGATCCGCCCACCTTGG - Intronic
1153815596 18:8787397-8787419 ACCCAGTTCTGCCACCAACCAGG - Intronic
1154210074 18:12372070-12372092 ACCTCGTGATGCACCCACCTCGG - Intronic
1154268697 18:12900704-12900726 ACCTCGTGATGCACCCACCTCGG - Intronic
1154477474 18:14777527-14777549 ACCTCGTGATCCCCCCACCTTGG + Intronic
1154519233 18:15208969-15208991 ACCTCGTGATCCACCCACCCCGG - Intergenic
1154935046 18:21046141-21046163 ACCTCGTGATCCGCCCACCCTGG + Intronic
1157310764 18:46551334-46551356 ACCTTGTGATCCACCCACCCTGG + Intronic
1157932946 18:51842934-51842956 ACATACTGATGCCACCTACCAGG - Intergenic
1158358026 18:56641829-56641851 TCCTGGTGCTGCCAACACCCAGG - Intronic
1158458440 18:57627439-57627461 ACCTTGTGATCCCCCCACCTCGG + Intergenic
1158782735 18:60670328-60670350 ACCTCGTGATGCACCCACCTTGG - Intergenic
1158898473 18:61938283-61938305 ACCTAGTGCTGCCATCACTGAGG - Intergenic
1159491386 18:69139670-69139692 ACCTGGTGATGCGCCCACCGTGG - Intergenic
1159532355 18:69670739-69670761 ACCTCGTGATCCTCCCACCCCGG + Intronic
1159760697 18:72421701-72421723 ACCTAGTGTTGACATCTCCCAGG - Intergenic
1159818948 18:73115426-73115448 ACCTTGTGATCCCACCACCTCGG + Intergenic
1160384880 18:78490130-78490152 ACCTCGTGATGCACCCACCTCGG - Intergenic
1160477148 18:79201790-79201812 ACCTAGTGATCCACCCACCTCGG + Intronic
1161154517 19:2725624-2725646 AAATATTGATGCCACCAGCCTGG - Intronic
1161413955 19:4134090-4134112 ACCTCGTGATTCCCCCACCTCGG - Intergenic
1161658382 19:5530100-5530122 ACCCAGTGAGGCCACACCCCAGG + Intergenic
1161690218 19:5728124-5728146 ACCTCGTGATCCCCCCACCTCGG - Intronic
1161731127 19:5961208-5961230 ACCTCGTGATCCCCCCACCTCGG - Intronic
1161740320 19:6017388-6017410 ACCAACTGATGCCCTCACCCAGG + Intronic
1161882788 19:6968549-6968571 ACCTAGTGATTCACCCACCTTGG + Intergenic
1162242492 19:9366212-9366234 ACCTCGTGATGCGCCCACCTTGG + Intronic
1162259186 19:9518652-9518674 ACCTAGTGATCCACCCACCTCGG + Intergenic
1162269451 19:9602132-9602154 ACCTTGTGATCCCCCCACCTCGG - Intergenic
1162295958 19:9813735-9813757 ACCTCGTGATCCAACCACCTTGG + Intronic
1162379911 19:10325460-10325482 ACCTCGTGATGCACCCACCTCGG + Intronic
1162423148 19:10577666-10577688 ACCTCGTGATCCGCCCACCCCGG + Intronic
1162639623 19:11997955-11997977 ACCTATGTATGCCACCACACTGG + Intergenic
1162901991 19:13800638-13800660 ACCTCGTGATCCCCCCACCTCGG + Intronic
1163140852 19:15347522-15347544 ACCTCGTGATCCACCCACCCCGG - Intergenic
1163450188 19:17372687-17372709 ACCTAGTGATCCACCCACCTCGG + Intronic
1164266210 19:23620228-23620250 ACCTCGTGATCCCCCCACCTCGG + Intronic
1164725979 19:30465981-30466003 ACCTTGTGATCCGACCACCTCGG + Intronic
1166057763 19:40303288-40303310 ACCTCGTGATCCCCCCACCTCGG - Intergenic
1166889875 19:45984460-45984482 ACCTCGTGATCCAACCACCTCGG + Intergenic
1167036013 19:46995423-46995445 AGCTGGTGAAGCCAGCACCCTGG + Intronic
1167043929 19:47039221-47039243 AGCCAGTGAAGCCACCAGCCTGG - Intronic
1167088482 19:47326994-47327016 ACCTAGTGATCCACCCACCTCGG - Intergenic
1167316050 19:48763338-48763360 ACCTTGTGATCCGCCCACCCTGG - Intergenic
1167493365 19:49804306-49804328 ACCTCGTGATCCAACCACCTTGG - Intronic
1167551873 19:50167005-50167027 ACCTCGTGATCCACCCACCCCGG + Intergenic
1168213776 19:54910336-54910358 ACCTTGTGATCCAACCACCTTGG - Intronic
1168231371 19:55034321-55034343 ACCTTGTGATCCGCCCACCCTGG - Intronic
1168393032 19:56026293-56026315 ACCTAGTGATGTACCCACCTCGG - Intronic
1168498631 19:56875097-56875119 TCCTAGTGATTCCAACACCTCGG + Intergenic
1168657384 19:58140646-58140668 ACCTCGTGATCCGCCCACCCCGG + Intronic
1168702120 19:58446806-58446828 ACCTCGTGATCCCCCCACCTCGG + Intergenic
925017399 2:541705-541727 ACCTCGTGATCCCCCCACCTTGG - Intergenic
925387594 2:3472961-3472983 ACCTGGAGATCCTACCACCCTGG - Intronic
926031785 2:9597412-9597434 ACCTCGTGATCCGCCCACCCCGG - Intronic
927463485 2:23320126-23320148 ACCTCGTGAAGACACCACACAGG - Intergenic
927631457 2:24777680-24777702 ACCTCGTGATCCGCCCACCCTGG + Intergenic
927788130 2:25988299-25988321 ACCTGGTGATCCAGCCACCCTGG + Intergenic
928046537 2:27939182-27939204 ACCTAGTGATCCGCCCACCTCGG + Intronic
928169774 2:28995838-28995860 ACCTGGAGAAGCCACCACGCAGG - Intronic
928217855 2:29377241-29377263 ACCTCGTGATCCGCCCACCCTGG - Intronic
928548503 2:32350078-32350100 ACCTCGTGATCCGCCCACCCTGG + Intergenic
928691058 2:33799035-33799057 ACCTCGTGATGCACCCACCTCGG - Intergenic
929172024 2:38941776-38941798 ACCTCGTGATCCGCCCACCCCGG + Intronic
929377780 2:41310872-41310894 ACCTAGTGATCCACCCACCTCGG + Intergenic
929535329 2:42779551-42779573 ACCTCGTGATCCCCCCACCTCGG + Intronic
930051237 2:47217753-47217775 ACCTTGTGATCCACCCACCCTGG - Intergenic
930130188 2:47841870-47841892 ACCTCGTGATCCCCCCACCTCGG + Intronic
930178149 2:48321300-48321322 ACCTCGTGATCCGCCCACCCTGG - Intronic
930534230 2:52627860-52627882 ACCTCGTGATCCGACCACCTTGG + Intergenic
930759920 2:55022699-55022721 CCCTAGTCCTGCCATCACCCTGG + Intronic
932044320 2:68332155-68332177 ACCTCGTGATCCGACCACCTCGG + Intergenic
932060384 2:68492243-68492265 ACCTCGTGATCCACCCACCCCGG - Intronic
932155755 2:69415750-69415772 ACCTCGTGATCCACCCACCCCGG + Intronic
932242919 2:70171741-70171763 ACCTCGTGATCCAACCACCTCGG + Intronic
932307329 2:70713377-70713399 ACCTCGTGATCCCCCCACCTTGG - Intronic
932725489 2:74176529-74176551 ACCTAGTGATCCGCCCACCTCGG - Intronic
932927840 2:75997199-75997221 ACCTCGTGATCCCCCCACCTCGG + Intergenic
932960120 2:76403604-76403626 ACCTCGTGATCCAACCACCTTGG - Intergenic
933293885 2:80468647-80468669 ACCTTGTGATCCACCCACCCTGG + Intronic
933404351 2:81839355-81839377 ACCTCGTGATCCACCCACCCTGG - Intergenic
933829041 2:86191668-86191690 ACCTTGTGATCCCCCCACCTTGG - Intronic
934473939 2:94580287-94580309 ACCTTGTGATCCCCCCACCTTGG + Intergenic
935540234 2:104339743-104339765 ACCTCGTGATGCACCCACCTCGG + Intergenic
936027617 2:109045672-109045694 ACCCAGTGCTGCCACTTCCCGGG + Intergenic
936246299 2:110830764-110830786 ACCTTGTGATCCCCCCACCTCGG + Intronic
936713358 2:115159223-115159245 ACCTAGTTATCCGCCCACCCCGG - Intronic
937176695 2:119943823-119943845 ACCTCGTGATCCGCCCACCCCGG + Intronic
937847079 2:126591307-126591329 ACCTCGTGATCCGCCCACCCCGG + Intergenic
938304140 2:130239314-130239336 ACCTAGTGATCCACCCACCTCGG - Intergenic
938412380 2:131075719-131075741 ACCTCGTGATCCGCCCACCCCGG + Intronic
938777415 2:134554189-134554211 ACCTCGTGATCCCCCCACCTTGG - Intronic
938942033 2:136177862-136177884 ACCTCGTGATCCCCCCACCTTGG - Intergenic
939284498 2:140111648-140111670 ACCTAGTGATCCACCCACCTCGG - Intergenic
941557116 2:166995111-166995133 ACCTCGTGATCCCCCCACCTCGG + Intronic
942038648 2:172036082-172036104 ACCTAGTGATCCGCCCACCTTGG - Intronic
942622944 2:177867494-177867516 ACCTCGTGATGCGCCCACCTTGG - Intronic
943307990 2:186290762-186290784 ACCTTGTGATGCCCCCGCCTTGG + Intergenic
944321050 2:198342923-198342945 ACCTAGTGATCCACCCACCTCGG + Intronic
944616143 2:201463102-201463124 ACCTTGTGATCCACCCACCCTGG - Intronic
944700903 2:202245307-202245329 ACCTCGTGATCCCCCCACCTTGG + Intergenic
945069969 2:205979855-205979877 ACCTCCTGATATCACCACCCTGG + Intergenic
945246067 2:207718135-207718157 ACCTCGTGATCCACCCACCCTGG + Intronic
945942831 2:215966831-215966853 ACCTCGTGATCCTACCACCTTGG + Intronic
946120499 2:217508886-217508908 ACCTCCTAATGCCACCACCTTGG - Intronic
946376272 2:219311126-219311148 ACCTCGTGATGCACCCACCTCGG + Intergenic
946734274 2:222738965-222738987 ACCTTGTGACCCCCCCACCCAGG - Intergenic
946777515 2:223158837-223158859 ACCTCGTGATCCAACCACCTCGG + Intronic
947755100 2:232557011-232557033 ACCTAGTGATCCACCCACCTTGG - Intronic
948399045 2:237669713-237669735 CCACAGTGATGCCTCCACCCCGG + Intronic
948761297 2:240193051-240193073 ACCTAGTGATCCACCCACCTTGG - Intergenic
948816899 2:240515301-240515323 ACCTAGTGATCCGCCCACCTTGG - Intronic
1169835466 20:9873242-9873264 ACCTCGTGATGCACCCACCTTGG + Intergenic
1170939485 20:20836651-20836673 ACCTCGTGATCCGACCACCTCGG + Intergenic
1171778091 20:29389790-29389812 ACCTTGTGATCCACCCACCCCGG - Intergenic
1172859485 20:38035995-38036017 ACCTTGTGATGCCCCCGCCTCGG + Intronic
1174229159 20:49030139-49030161 ACCTCGTGATCCCCCCACCTCGG + Intronic
1174629606 20:51944897-51944919 ACCTCGTGATCCGCCCACCCTGG - Intergenic
1174910654 20:54604177-54604199 ACCTAGTGATCCACCCACCTCGG + Intronic
1175693264 20:61081777-61081799 GCCCAGTGATGCCACCAGTCAGG + Intergenic
1176699297 21:10023659-10023681 TCCCAGTGATCCTACCACCCAGG - Intergenic
1176777768 21:13154756-13154778 ACCTCGTGATCCACCCACCCCGG + Intergenic
1176837940 21:13811234-13811256 ACATATTGACGCCACCACCATGG - Intergenic
1176887108 21:14270117-14270139 ACCTTGTGATCCCCCCACCTCGG + Intergenic
1177589506 21:23144553-23144575 ACCTAGTGATCCACCCACCTTGG - Intergenic
1178100912 21:29267616-29267638 ACCTTGTGATCCCCCCACCTCGG + Intronic
1178335440 21:31738399-31738421 ACCTTGTGATCCCCCCACCTCGG + Intergenic
1178394360 21:32228318-32228340 ACCTAGTGATCCGCCCACCTCGG + Intergenic
1178894298 21:36545971-36545993 ACCCATTGAGGCCACCACACTGG - Intronic
1179070539 21:38066848-38066870 ACCTTGTGATCCACCCACCCCGG - Intronic
1179371904 21:40813876-40813898 ACCTAGTGATCCACCCACCTCGG + Intronic
1179439605 21:41383687-41383709 AGCTAGTGAAGACCCCACCCAGG - Intronic
1179587585 21:42383482-42383504 CCCCAGTGATGACAACACCCTGG + Intronic
1179621369 21:42618292-42618314 ACCTTGTGATCCACCCACCCTGG - Intergenic
1180630681 22:17227420-17227442 ACCTCGTGATCCCCCCACCTCGG - Intergenic
1180687405 22:17680275-17680297 ACCTCGTGATGCGCCCACCTCGG - Intronic
1180799721 22:18626083-18626105 CTCCAGAGATGCCACCACCCAGG + Intergenic
1181095476 22:20502358-20502380 ACCTAGTGATCCACCCACCTCGG + Intronic
1181221994 22:21369183-21369205 CTCCAGAGATGCCACCACCCAGG - Intergenic
1181436013 22:22911324-22911346 TCCTGGTGATGGCACCACCATGG - Intergenic
1181470367 22:23135238-23135260 ACCTAGTGATCCGCCCACCTTGG - Intronic
1181548388 22:23618938-23618960 ACCTCGTGATCCCCCCACCTCGG - Intronic
1181637384 22:24180822-24180844 CTCCAGAGATGCCACCACCCTGG - Intergenic
1182207702 22:28645393-28645415 ACCTTGTGATCCCCCCACCTTGG - Intronic
1182855830 22:33516815-33516837 ACCTTGTGATGCGCCCACCTCGG + Intronic
1183009133 22:34930424-34930446 ACCTTGTGATGCCCCCTCCTCGG - Intergenic
1183155300 22:36070264-36070286 ACCTAGTGATCCACCCACCTCGG - Intergenic
1183400323 22:37599883-37599905 ACCTAGTGATCCACCCACCTGGG - Intergenic
1183681521 22:39333151-39333173 ACCTCGTGATCCCCCCACCTCGG - Intergenic
1184072341 22:42153798-42153820 ACCTTGTGATCCCCCCACCTTGG + Intergenic
1184100696 22:42340510-42340532 TCCTGGTGCTGCCACCTCCCAGG - Intronic
1184229306 22:43150089-43150111 ACCTAGTGATCCACCCACCTCGG + Intergenic
1184989395 22:48156816-48156838 ACCTGGAGATGGCACCGCCCAGG + Intergenic
1203290157 22_KI270735v1_random:28793-28815 ACCTCGTGATCCACCCACCCCGG - Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
949575091 3:5331285-5331307 ACCTCGTGATCCGCCCACCCCGG + Intergenic
949645189 3:6085169-6085191 ACCTCGTGATCCGCCCACCCCGG - Intergenic
949729838 3:7096222-7096244 ACCTAGTGATGCTAACCACCTGG + Intronic
949835083 3:8259527-8259549 ACCTAGTGATGAGCCCACCTCGG + Intergenic
949855223 3:8455324-8455346 ACCTTGTCTTCCCACCACCCTGG + Intergenic
949865961 3:8547657-8547679 ACCTAGTGATGCACCCGCCTCGG - Intronic
950050737 3:9986980-9987002 ACCTCGTGATCCCCCCACCTTGG - Exonic
950072847 3:10165959-10165981 ACCTTGTGATCCGCCCACCCTGG + Intronic
950131375 3:10549198-10549220 ACCTAGTGATGCTAGAACTCAGG - Intronic
950131480 3:10549906-10549928 ACCTAGTGATGCTAGAACTCAGG + Intronic
950381436 3:12619010-12619032 ACCTCGTGATGCACCCACCTCGG - Intronic
951367866 3:21806436-21806458 ACCTCGTGATGCACCCACCTCGG + Intronic
952061064 3:29511063-29511085 ACCTAGTGATCCACCCACCTTGG - Intronic
952128760 3:30334717-30334739 AATTAATGATCCCACCACCCAGG - Intergenic
952295592 3:32059353-32059375 ACCTAGTGATCCACCCACCTCGG - Intronic
952917788 3:38262339-38262361 ACCTTGTGATCCACCCACCCCGG - Intergenic
953171020 3:40507321-40507343 ACCTCGTGATTCCCCCACCTTGG + Intronic
953426981 3:42803859-42803881 ACCTGGTGTTTCCTCCACCCTGG - Intronic
953661025 3:44891739-44891761 ACCTCGTGATGCGCCCACCTCGG - Intronic
954027701 3:47796112-47796134 ACCTAGTGATCCGCCCACCTCGG - Intergenic
954236251 3:49259467-49259489 ACCTAGTGATCCGCCCACCTCGG - Intergenic
954774098 3:53000093-53000115 ACCTCGTGATCCGCCCACCCCGG + Intronic
955300629 3:57775273-57775295 ACCTTGTGATCCGCCCACCCCGG + Intronic
955310500 3:57881685-57881707 ACCTCGTGATGCGCCCACCTCGG + Intronic
955583416 3:60449769-60449791 ACCTTGTGATGCACCCACCTCGG - Intronic
955909300 3:63843665-63843687 ACCTCGTGATGCGCCCACCTTGG - Intronic
955965906 3:64389235-64389257 ACCTAGTGATCCACCCACCTTGG - Intronic
956840157 3:73132329-73132351 ACCTCGTGATCCAACCACCTTGG + Intergenic
957087070 3:75690761-75690783 ACCTTGTGATCCGCCCACCCCGG + Intergenic
957351025 3:79021891-79021913 ACCTAGTGATGCACCCGCCTTGG + Intronic
957388483 3:79530266-79530288 ACCTATTGATGCAATCACCAGGG - Intronic
957846341 3:85741434-85741456 ACCTTGTGATCCCCCCGCCCCGG - Intronic
958008330 3:87842393-87842415 ACCTAGTGATCCACCCACCTTGG + Intergenic
958515076 3:95104045-95104067 ACCTCGTGATCCACCCACCCCGG - Intergenic
958608704 3:96395293-96395315 ACCTCGTGATCCACCCACCCTGG + Intergenic
959260804 3:104077252-104077274 ACCTCGTGATGCACCCACCTTGG - Intergenic
959695430 3:109244789-109244811 ACCTTGTGATGCCCCCACCTTGG + Intergenic
959696049 3:109249762-109249784 ACCTCGTGATCCACCCACCCTGG - Intergenic
960095754 3:113688349-113688371 ACCTCGTGATCCCCCCACCTTGG + Intronic
960422295 3:117461981-117462003 ACCTCGTGATCCCCCCACCTGGG + Intergenic
960550551 3:118971569-118971591 ACCTCGTGATGCACCCACCTCGG - Intronic
960747295 3:120904293-120904315 ACCTCGTGATCCACCCACCCTGG + Intergenic
961342373 3:126236469-126236491 ACCTCGTGATGCTCCCACCTCGG - Intergenic
961418751 3:126782626-126782648 GCCTACTGATGCCCCCACCTTGG - Intronic
961697656 3:128717014-128717036 ACCTAGTGATCCACCCACCTTGG + Intergenic
961891521 3:130134124-130134146 ACCTCGTGATCCGACCATCCTGG - Intergenic
962305984 3:134286643-134286665 ACCTCGTGATCCAACCACCTCGG - Intergenic
962529400 3:136264960-136264982 ACCTAGTGATCCACCCACCTCGG - Intronic
962718943 3:138154355-138154377 ACCTAGTGATCCGCCCACCTCGG + Intergenic
962730666 3:138280723-138280745 ACCTAGTGATCCACCCACCTCGG + Intronic
963831939 3:150017721-150017743 ACCTAGTGATCCGCCCACCTCGG + Intronic
965891756 3:173522664-173522686 ACCTAGTGATCCACCCACCTTGG + Intronic
966347980 3:179000053-179000075 ACCTCGTGATCCGCCCACCCTGG + Intergenic
966685983 3:182696198-182696220 ACCTTGTGATCCGACCACCTCGG - Intergenic
966687912 3:182716038-182716060 ACCTAGTGATCCGCCCACCTCGG + Intergenic
966970730 3:185043032-185043054 ACCTTATGATGGCACCACACAGG + Intronic
967401551 3:189068541-189068563 ACCTAGTGATCCACCCACCTTGG - Intronic
967924878 3:194638203-194638225 ACCTTGTGATCCGCCCACCCTGG - Intergenic
967966668 3:194966039-194966061 ACCTTGTGATCCACCCACCCCGG + Intergenic
968194093 3:196692734-196692756 ACCTAGTGATCCACCCACCTCGG + Intronic
968400959 4:297034-297056 ACCTTGTGATCCCCCCACCACGG - Intronic
969090497 4:4690463-4690485 ACCTCGTGATGTGACCACCTCGG - Intergenic
969544580 4:7816945-7816967 ACCTAGAGCTGGCACCGCCCTGG + Intronic
969751103 4:9111956-9111978 ACCTCGTGATCCGACCATCCTGG + Intergenic
969959763 4:10932712-10932734 ACCTAGTGATCCACCCACCTCGG - Intergenic
970142759 4:13000330-13000352 ACCTCGTGATCCAACCACCTTGG - Intergenic
971776315 4:30970524-30970546 ACCTAGTGATCCCCCCGCCTCGG + Intronic
971989949 4:33879927-33879949 ACCTCGTGATCCCCCCACCTTGG + Intergenic
972188580 4:36563050-36563072 ACCTCGTGATCCTCCCACCCTGG + Intergenic
972294275 4:37721658-37721680 ACCTTGTGATTCAACCACCTTGG - Intergenic
972499273 4:39662434-39662456 ACCTTGTGATCCCTCCACCTCGG + Intergenic
972747916 4:41958240-41958262 ACCTCGTGATCCCCCCACCTCGG + Exonic
973316395 4:48765074-48765096 ACCTAGTGATCCCCCCACCTCGG + Intronic
974576299 4:63728159-63728181 ACCTCGTGATCCCCCCACCTCGG + Intergenic
974610262 4:64207556-64207578 ACCTTTTGATACCACCACCATGG - Intergenic
975081233 4:70283000-70283022 ACCTAGTGATCCGCCCTCCCTGG - Intergenic
975282316 4:72575345-72575367 ACCTAGTGATCCACCCACCTCGG - Intergenic
976793740 4:88909716-88909738 ACCTTGTGATCCGCCCACCCTGG + Intronic
977276997 4:94990122-94990144 ACCTAGTGATCCACCCACCTTGG - Intronic
979814397 4:125082228-125082250 ACCTTGTGATCCACCCACCCCGG - Intergenic
980778297 4:137464330-137464352 ACCTTGTGATCCGACCACCTTGG - Intergenic
981457675 4:144973418-144973440 TCCTAGTGATTCCGTCACCCAGG - Intronic
981645448 4:146993328-146993350 ACCTAGTGATCCGCCCACCTCGG + Intergenic
982013266 4:151127142-151127164 ACCTCGTGATCCCCCCACCTCGG + Intronic
982729808 4:158944085-158944107 ACCTTGTGATGCAACCACCTTGG + Intronic
982793694 4:159621149-159621171 ACCTAGTGATCCACCCACCTCGG + Intergenic
982834978 4:160112296-160112318 ACCTAGTGATCCACCCACCTCGG - Intergenic
983945622 4:173583142-173583164 ACCTAGTGATCCGCCCACCTTGG - Intergenic
984072227 4:175129391-175129413 ACCTGGTGATCCGCCCACCCTGG + Intergenic
984194057 4:176637316-176637338 ACCTCGTGATTCCCCCACCTTGG - Intergenic
984561282 4:181273653-181273675 ACCTAGTGATCCACCCACCTCGG + Intergenic
984735494 4:183103865-183103887 ACCTTGTGATGCGCCCACCTTGG + Intronic
986945704 5:13016599-13016621 ACCTATTAATACCATCACCCTGG + Intergenic
988077219 5:26367984-26368006 ACCTAGTAAAGCCACTTCCCAGG - Intergenic
989055065 5:37358783-37358805 ACCTTGTGATTCGCCCACCCCGG - Intronic
989303671 5:39926386-39926408 ACCTCGTGATGCTCCCACCTCGG - Intergenic
989380727 5:40807243-40807265 ACCTCGTGATGCACCCACCTTGG + Intergenic
989422306 5:41254166-41254188 ACCTAGTGATCCACCCACCTCGG - Intronic
989487592 5:42010264-42010286 ACCTAGTGATCCACCCACCTTGG - Intergenic
989589876 5:43103450-43103472 ACCTCGTGATCCGACCACCTCGG - Intronic
990035739 5:51317113-51317135 ACCTCGTGATTCCCCCACCTCGG + Intergenic
991224274 5:64251473-64251495 AGCTAATGATGGCACCAGCCTGG - Intronic
991239907 5:64445655-64445677 ACCTTGTGGTACCCCCACCCAGG + Intergenic
991916496 5:71610751-71610773 ACCTCGTGATCCCCCCACCTCGG - Intronic
992027148 5:72681530-72681552 ACCTAGTAATGTCCCCAACCAGG + Intergenic
992047268 5:72906521-72906543 ACCTTGTGATGCACCCACCTCGG + Intronic
992150231 5:73895309-73895331 ACTTAGTCCTTCCACCACCCTGG - Intronic
993634824 5:90331311-90331333 ACCCACTGCTGCCACCACCAGGG - Intergenic
994101982 5:95903460-95903482 ACCTCGTGATCCCCCCACCTCGG + Intronic
994361928 5:98861733-98861755 ACCTTGTGATGCGCCCACCTTGG + Intronic
995159853 5:108967044-108967066 AGCCAGTGATGCCCCCACCTAGG + Intronic
995360579 5:111292119-111292141 ACCTAGTGTTACCATCACCTAGG - Intronic
996395590 5:123010518-123010540 ACCTCGTGATCCAACCACCTTGG + Intronic
996573591 5:124959479-124959501 ACCCAGTGATCCTCCCACCCTGG + Intergenic
997304445 5:132827381-132827403 ACCTAGTGATCCGCCCACCTCGG - Intronic
997829831 5:137140259-137140281 CCAGAGTGATGCCACGACCCAGG - Intronic
997936685 5:138118356-138118378 ACCTAGTGATCCACCCACCTCGG + Intronic
998110018 5:139494037-139494059 ACCTCGTGATCCGCCCACCCCGG - Intergenic
998285134 5:140852507-140852529 ACCTTGTGATGCTCCCACCTCGG + Intronic
998902723 5:146873269-146873291 CTCTACTGATGCCACCATCCTGG + Intronic
998936753 5:147237077-147237099 ACCTTGTGATGCACCCACCTCGG - Intronic
999648355 5:153741205-153741227 ACCTAGTGATCCGCCCACCTCGG + Intronic
999777090 5:154820197-154820219 CCCTAATGATGGCACCACCAGGG - Exonic
1000355661 5:160392013-160392035 ACCTAGTGATCCGCCCACCTTGG + Intergenic
1000423864 5:161068053-161068075 TCCTAGAAATGCCCCCACCCTGG - Intergenic
1001030854 5:168261714-168261736 ACCGGGTCATGCCACCACTCGGG - Intronic
1003633205 6:7807510-7807532 ACCTAGTGATCCGCCCACCTTGG + Intronic
1003881317 6:10482663-10482685 ACCTAGTGAATCCACCATCAGGG + Intergenic
1003886229 6:10523737-10523759 ACCTCGTGATCCGCCCACCCCGG - Intronic
1004210698 6:13639409-13639431 ACCTCGTGATCCGCCCACCCTGG + Intronic
1004608172 6:17213367-17213389 ACCTCGTGATGCGCCCACCTCGG - Intergenic
1004657190 6:17674533-17674555 ACCTCGTGATGCGCCCACCCCGG - Intronic
1004700472 6:18074683-18074705 ACCTCGTGATCCCCCCACCTTGG + Intergenic
1004742378 6:18474759-18474781 ACCTAGTGATCCGCCCACCTCGG - Intergenic
1005080309 6:21950485-21950507 ACCTTGTGATGCCCCCGCCTCGG + Intergenic
1005478577 6:26233579-26233601 ACCTCGTGATGCCCCCGCCTCGG + Intergenic
1005605552 6:27473416-27473438 ACCTAGTGATCCACCCACCTCGG - Intergenic
1005614679 6:27561293-27561315 ACCTAGTGATCCGCCCACCTCGG + Intergenic
1005689835 6:28293172-28293194 ACCTAGTGATGTGCCCACCTTGG + Intronic
1005833564 6:29690404-29690426 ACCTAGTGATCCGCCCACCTCGG + Intergenic
1005949653 6:30622327-30622349 ACCTAGTGATACACCCACCTTGG - Intronic
1006036973 6:31221493-31221515 ACCTAGTGATCCACCCACCTCGG - Intergenic
1006385757 6:33729943-33729965 ACCTTGTGATCCACCCACCCTGG + Intronic
1006674283 6:35751143-35751165 ACCTCGTGATCCCCCCACCTTGG + Intergenic
1006994952 6:38250837-38250859 ACCTTGTGATCCCCCCACCTCGG - Intronic
1007141426 6:39578562-39578584 ACCTCGTGATCCACCCACCCTGG + Intronic
1008055256 6:46939100-46939122 ACCTCGTGATCCCCCCAGCCTGG + Intronic
1008678325 6:53844969-53844991 ACCTAGTGATCCCCCCGCCTTGG - Intronic
1009892732 6:69707398-69707420 ACCTAATGATGCCCTCATCCAGG - Intronic
1009898178 6:69778952-69778974 ACCTAGTGATCCGCCCATCCTGG - Intronic
1010971255 6:82265521-82265543 ACCTCGTGATCCACCCACCCAGG + Intergenic
1011056193 6:83205880-83205902 ACCTAGTGATCCACCCACCTCGG - Intergenic
1011365937 6:86582886-86582908 ACCTAGTGATCCACCCACCTTGG - Intergenic
1013291711 6:108725632-108725654 ACCTCGTGATCCCCCCACCTTGG - Intergenic
1013322189 6:109004661-109004683 ACCTCGTGATGCGCCCACCTCGG + Intronic
1014920677 6:127211566-127211588 ACCTAGTGATCCGCCCACCTCGG - Intergenic
1014941158 6:127440557-127440579 ACCTCGTGATCCCCCCACCTTGG + Exonic
1015007579 6:128302153-128302175 ACCTCGTGATCCGCCCACCCCGG - Intronic
1015750664 6:136555125-136555147 AAATATTGATGCCACCACCTTGG - Intergenic
1016976358 6:149812803-149812825 ACCTTGTGATCCCCCCACCTCGG + Intergenic
1017089878 6:150749838-150749860 ACCTCGTGATCCACCCACCCTGG - Intronic
1017866027 6:158443984-158444006 ACCTTGTGATCCGCCCACCCTGG - Intronic
1017907274 6:158765434-158765456 ACCTCGTGATCCGACCACCTCGG + Intergenic
1018536530 6:164826478-164826500 ACCTAGTGATCCGCCCACCTCGG - Intergenic
1018643669 6:165928658-165928680 ACCTGGTGGTGCCAACATCCCGG + Intronic
1019111001 6:169713888-169713910 ACCTAGTGATCCGCCCACCTTGG - Intronic
1019394765 7:811816-811838 ATCTAGAGATGCGACCATCCTGG - Intergenic
1019697537 7:2454582-2454604 ACCTTGTGATGCACCCACCTCGG - Intergenic
1020382848 7:7565825-7565847 ACCTCGTGATGCGCCCACCTCGG - Intergenic
1020827016 7:13041832-13041854 ACCTAGTGATCCGCCCACCTCGG - Intergenic
1020840456 7:13211284-13211306 ACCTAGTGATCCACCCACCTCGG - Intergenic
1021488879 7:21196944-21196966 ACCTCGTGATGCTCCCACCTTGG + Intergenic
1021681767 7:23140319-23140341 ACCTCGTGATCCGCCCACCCTGG - Intronic
1022033077 7:26509631-26509653 ACCTCGTGATGCCCCCGCCTCGG + Intergenic
1022125171 7:27349407-27349429 ACCTTGGGATCCCACAACCCTGG + Intergenic
1022326578 7:29337590-29337612 ACCTACTGATGCTGTCACCCAGG + Intronic
1022682093 7:32558387-32558409 ACCTCGTGATCCACCCACCCCGG + Intronic
1023254296 7:38297930-38297952 ACCTCGTGATCCGCCCACCCTGG + Intergenic
1023429441 7:40074287-40074309 ACCTAGTGATCCGCCCACCTCGG - Intronic
1023446109 7:40233450-40233472 ACCTAGTGATCCACCCACCCCGG + Intronic
1023447899 7:40251060-40251082 ACCTTGTGATCCATCCACCCCGG + Intronic
1023867509 7:44245233-44245255 ACCCAGTGATGCCCCCACCCTGG + Intronic
1024004517 7:45215764-45215786 ACATGGTGATGCCAGCACACAGG + Intergenic
1024110938 7:46145772-46145794 ACCTTGTGATTCCCCCACCTCGG - Intergenic
1024314008 7:47997031-47997053 ACCTAGTGATGTACCCACCTCGG + Intronic
1024780023 7:52837027-52837049 ACCTAGTGATCCGCCCACCTTGG - Intergenic
1025879429 7:65520696-65520718 ACCTCGTGATCCACCCACCCCGG - Intergenic
1025885228 7:65583601-65583623 ACCTCGTGATCCACCCACCCCGG - Intergenic
1025928560 7:65978041-65978063 ACCTCGTGATCCCCCCACCTTGG + Intronic
1025939147 7:66061334-66061356 ACCTTGTGATCCACCCACCCCGG - Intergenic
1025964265 7:66253602-66253624 ACCTTGTGATCCGCCCACCCTGG + Intronic
1026160859 7:67867613-67867635 ACCTCCTGAGGCCACCAGCCAGG + Intergenic
1026732501 7:72924177-72924199 ACCTTGTGATCCGCCCACCCCGG + Intronic
1026977704 7:74508456-74508478 ACCTAGTGATCCACCGACCCCGG - Intronic
1027430651 7:78109397-78109419 ACCTCGTGATGCACCCACCTTGG - Intronic
1027475847 7:78630646-78630668 ACCTTGTGATTCCCCCACCTCGG + Intronic
1027686680 7:81287184-81287206 ACCTCGTGATCCACCCACCCTGG + Intergenic
1028074814 7:86498936-86498958 ACCTTGTGATGCACCCACCTTGG + Intergenic
1028791636 7:94860183-94860205 ACCTTGTGATCCAACCACCTCGG + Intergenic
1028840632 7:95426155-95426177 AACAACTGATGCCATCACCCAGG - Intronic
1029054586 7:97728314-97728336 ACCTTGTGATCCACCCACCCCGG + Intergenic
1029307868 7:99634174-99634196 ACCTGGTTCTACCACCACCCAGG - Intergenic
1029868485 7:103662386-103662408 ACCTCGTGATCCGCCCACCCCGG - Intronic
1030024716 7:105312206-105312228 ACCTTGTGATCCCCCCACCTTGG - Intronic
1030250171 7:107434735-107434757 ACCTAGTGATCCGCCCACCTTGG - Intronic
1030385035 7:108857854-108857876 ACCTCGTGATCCGACCACCTCGG - Intergenic
1030912831 7:115274135-115274157 ACCTAGTGATCCACCCACCTTGG - Intergenic
1031999780 7:128257335-128257357 ACCTTGTGATCCCCCCACCTTGG - Exonic
1032031608 7:128488869-128488891 ACCTCGTGATCCACCCACCCTGG - Intronic
1032777324 7:135127321-135127343 ACCTCGTGATCCACCCACCCTGG - Intronic
1033135601 7:138781561-138781583 ACCTCGTGATCCACCCACCCTGG + Intronic
1033436538 7:141338068-141338090 ACCTCGTGATGCACCCACCTCGG + Intronic
1033982415 7:147181891-147181913 ACCTAGTGATCCACCCACCTCGG - Intronic
1034124837 7:148662206-148662228 ACCTTGTGATCCAACCACCTCGG + Intergenic
1034545029 7:151784031-151784053 ACCTTGTGATAGGACCACCCTGG - Intronic
1035654396 8:1294564-1294586 ACCCAGTGATGCCACGACACAGG - Intergenic
1036101661 8:5793604-5793626 ACCTAGTGATCCACCCACCTTGG - Intergenic
1036564811 8:9929649-9929671 ACCTACTAATGCCATCACCGTGG + Intergenic
1037563468 8:20095818-20095840 ACCTTGTGATCCCACCAACTCGG - Intergenic
1037675235 8:21045268-21045290 ACCTCGTGATCCCCCCACCTCGG - Intergenic
1038448189 8:27618810-27618832 ACCTAGTGATCTCCCCACCTCGG - Intergenic
1038771937 8:30490696-30490718 ACCTCGTGATGCGCCCACCTCGG + Intronic
1039364133 8:36912736-36912758 ACCTTGTGATCCCCCCACCTCGG - Intronic
1039991846 8:42495086-42495108 ACCTCGTGATCCACCCACCCTGG + Intronic
1039995218 8:42526438-42526460 ACCTAGTGATCCGCCCACCTTGG - Intronic
1040459552 8:47634219-47634241 ACCTCGTGATCCATCCACCCTGG - Intronic
1041436308 8:57845831-57845853 ACCTCATGATCCGACCACCCCGG - Intergenic
1041440266 8:57887598-57887620 ATCTAGTGAAGCTACCAGCCAGG - Intergenic
1041668653 8:60470445-60470467 ACCTAGTGATCCATCCACCTCGG - Intergenic
1042217600 8:66441761-66441783 ACCTCGTGATCCACCCACCCCGG - Intronic
1042754320 8:72193581-72193603 ACCTCGTGATCCCCCCACCTCGG + Intergenic
1042893028 8:73634294-73634316 ACCTCGTGATCCGCCCACCCCGG - Intronic
1043097379 8:75992952-75992974 ACCTAGTGATCCACCCACCTTGG - Intergenic
1043651538 8:82600210-82600232 ACCTAGTGATCCGCCCACCTTGG + Intergenic
1044057103 8:87584852-87584874 ACCTCGTGATCCACCCACCCCGG - Intronic
1044414914 8:91926355-91926377 AGCTGGTGATGCCCCCACCTGGG - Intergenic
1044422710 8:92016441-92016463 ACCTCGTGATGCTCCCACCTCGG - Intronic
1044442055 8:92234577-92234599 ACCTCGTGATCCACCCACCCCGG + Intergenic
1044666137 8:94636453-94636475 ACCTCGTGATCCAACCACCTTGG + Intergenic
1045901864 8:107291642-107291664 ACCTAGTGATCCACCCACCTCGG + Intronic
1046187750 8:110745406-110745428 ACCTAGTGATCCACCCGCCCTGG + Intergenic
1046662283 8:116961194-116961216 ACCTCGTGATCCAACCACCTCGG - Intronic
1047128377 8:121988950-121988972 ACCTAGTGATCCGCCCACCTCGG - Intergenic
1047212728 8:122853176-122853198 ACCTAGTGATGGCACCAGTGTGG - Intronic
1047268414 8:123330593-123330615 ACCTCGTGATCCGCCCACCCTGG + Intronic
1047371689 8:124261224-124261246 AGCCAGGGATGCCACCTCCCAGG - Intergenic
1047552058 8:125884959-125884981 ACCTTGTGATCCAACCACCTCGG + Intergenic
1047763669 8:127972504-127972526 ACCTTGTGATCCGACCACCTCGG - Intergenic
1048949678 8:139485540-139485562 ACATAGTGCTGCCAACACCTTGG - Intergenic
1049754769 8:144305532-144305554 ACCTCGTGATCCAACCACCTTGG + Intronic
1050060542 9:1704944-1704966 ACCTTGTGATCCTACCACCTCGG - Intergenic
1050063356 9:1733500-1733522 ACCTTGTGATCTGACCACCCCGG - Intergenic
1050311220 9:4354881-4354903 ACCTAGTGATCCGCCCACCTCGG - Intergenic
1052819427 9:33127194-33127216 ACCTAGTGATCCGCCCACCTCGG + Intronic
1052969625 9:34369447-34369469 ACCTAGTGATGCACCCACCTTGG - Exonic
1053251679 9:36579393-36579415 ACCTCGTGATCCGCCCACCCTGG + Intronic
1053429243 9:38031086-38031108 ACCTCGTGATGCTCCCACCTTGG - Intronic
1053636406 9:40009846-40009868 TCCCAGTGATCCTACCACCCAGG - Intergenic
1053684135 9:40505845-40505867 ACCTTGTGATCCCCCCACCTTGG - Intergenic
1053769588 9:41454802-41454824 TCCCAGTGATCCTACCACCCAGG + Intergenic
1053856856 9:42346518-42346540 ACCTCGTGATCCACCCACCCTGG - Intergenic
1054256026 9:62814133-62814155 ACCCTGTGATCCCCCCACCCTGG + Intergenic
1054279587 9:63119108-63119130 ACCTTGTGATCCCCCCACCTTGG + Intergenic
1054297229 9:63341309-63341331 ACCTTGTGATCCCCCCACCTTGG - Intergenic
1054317273 9:63606926-63606948 TCCCAGTGATCCTACCACCCAGG - Intergenic
1054335282 9:63801479-63801501 ACCCTGTGATCCCCCCACCCCGG - Intergenic
1054395249 9:64645817-64645839 ACCTTGTGATCCCCCCACCTTGG - Intergenic
1054429896 9:65151017-65151039 ACCTTGTGATCCCCCCACCTTGG - Intergenic
1054500487 9:65870515-65870537 ACCTTGTGATCCCCCCACCTTGG + Intergenic
1054548255 9:66366281-66366303 TCCCAGTGATCCTACCACCCAGG + Intergenic
1054753097 9:68928929-68928951 ACCTCGTGATCCGCCCACCCCGG - Intronic
1054761417 9:69007622-69007644 ACCTAGTGATCCGCCCACCTTGG - Intronic
1054843984 9:69772928-69772950 ACCTAGTGATCCGCCCACCTTGG - Intergenic
1054908220 9:70429456-70429478 ACCTCGTGATCCAACCACCTCGG - Intergenic
1054944435 9:70781090-70781112 ACCTCGTGATCCTCCCACCCTGG - Intronic
1055170586 9:73253723-73253745 ACCTCGTGATCCGCCCACCCTGG + Intergenic
1055438336 9:76314871-76314893 ACCTCGTGATCCGACCACCGTGG + Intronic
1056066345 9:82939478-82939500 ACCTCGTGATCCCCCCACCTTGG + Intergenic
1056542293 9:87582784-87582806 ACCTCGTGATCCCCCCACCTCGG + Intronic
1057607563 9:96511337-96511359 ACCTCGTGATCCAACCACCTCGG - Intronic
1058224834 9:102347123-102347145 ACCTCGTGATCCCCCCACCTCGG + Intergenic
1058442253 9:105020312-105020334 ACCTCGTGATTCACCCACCCTGG - Intergenic
1058609661 9:106761907-106761929 ACCTCGTGATCCAACCACCTTGG - Intergenic
1058970474 9:110077780-110077802 ACCTCGTGATCCGACCACCTCGG - Intronic
1058990550 9:110251990-110252012 ACCTAGTGATCCGCCCACCTCGG - Intronic
1059093957 9:111392005-111392027 ACCTAGTGATCCACCCACCTCGG - Intronic
1059423654 9:114207542-114207564 ACTTTGAGATGCCACCAGCCTGG - Intronic
1059473311 9:114523852-114523874 ACCTAGAGATGAAATCACCCTGG - Intergenic
1059480044 9:114582304-114582326 ACCTTGTGATCCCCCCACCTCGG + Intergenic
1059609965 9:115882071-115882093 ACCTCGTGATCCAACCACCTTGG + Intergenic
1059644829 9:116254547-116254569 ACCTTGTGATCCGCCCACCCTGG - Intronic
1060125583 9:121041534-121041556 ACCTTGTGATCCCCCCACCTCGG + Intronic
1060581572 9:124752035-124752057 ACCAAGTGATCCGCCCACCCCGG - Intronic
1060824953 9:126682661-126682683 ACCTCGTGATCCCCCCACCTAGG - Intronic
1061070409 9:128306667-128306689 ACCTCGTGATCCGCCCACCCTGG + Intergenic
1062633178 9:137476378-137476400 AACTAGTGATGGGACCACACTGG + Intronic
1203489892 Un_GL000224v1:94877-94899 ACCTCGTGATCCCCCCACCTCGG - Intergenic
1203502515 Un_KI270741v1:36763-36785 ACCTCGTGATCCCCCCACCTCGG - Intergenic
1185726874 X:2428884-2428906 ACCTCCTGATACCATCACCCTGG - Intronic
1185790201 X:2923566-2923588 TCCTCCTGAGGCCACCACCCTGG + Intronic
1185869517 X:3652183-3652205 ACCTTGTGATGCGCCCACCTTGG - Intronic
1186118349 X:6329199-6329221 ACCTAGTGATTCACCCACCTCGG - Intergenic
1186353352 X:8763210-8763232 ACCTCGTGATGCACCCACCTCGG + Intergenic
1187001347 X:15182300-15182322 ACCTAGTGATCCACCCACCTCGG + Intergenic
1187347226 X:18476999-18477021 ACCTCGTGATCCGTCCACCCTGG + Intronic
1187387895 X:18864846-18864868 ACCTCGTGATCCGACCACCTCGG - Intergenic
1187465276 X:19521182-19521204 ACCTAGTGATTCGCCCACCTCGG - Intergenic
1187689303 X:21848429-21848451 ACCTCGTGATCCACCCACCCTGG - Intronic
1187895413 X:23975539-23975561 ACCTCGTGATCCCCCCACCTTGG + Intergenic
1188461120 X:30428447-30428469 TCCCAGTGATTCCATCACCCAGG - Intergenic
1188663680 X:32791414-32791436 ACCAACTGATGCCACCACTGGGG + Intronic
1188678176 X:32968794-32968816 ACCTCGTGATCCACCCACCCTGG - Intronic
1188695452 X:33184953-33184975 ACCTCGTGATGCTCCCACCTCGG + Intronic
1188892461 X:35627516-35627538 ACCTAGTGATCCGCCCACCTCGG + Intergenic
1190280343 X:48925043-48925065 ACCTCGTGATCCGACCACCTCGG - Intronic
1190329825 X:49228948-49228970 AGCTAGGGATCCCACCAACCGGG + Intronic
1190869770 X:54415229-54415251 ACCTAGTGATCCGCCCACCTCGG + Intergenic
1192231947 X:69271474-69271496 ACCTCGTGATGCACCCACCTCGG + Intergenic
1193548943 X:82865629-82865651 ACCTAGTGATCCACCCACCTCGG - Intergenic
1193940172 X:87672958-87672980 ACCTCGTGATTCCCCCACCTCGG + Intergenic
1194878656 X:99221613-99221635 ACCTTGTGATTCAACCACCTTGG - Intergenic
1195064236 X:101225217-101225239 ACTCAGTTATGCCACTACCCAGG - Intronic
1196255327 X:113511527-113511549 ACCTCGTGATGCACCCACCTCGG + Intergenic
1197144249 X:123153989-123154011 ACCTCGTGATCCCCCCACCTTGG + Intergenic
1197204052 X:123774556-123774578 ACCTAGTGATCCACCCACCTCGG + Intergenic
1197343978 X:125309543-125309565 ACCTCGTGATCCAACCACCTCGG - Intergenic
1197969956 X:132104457-132104479 ACCTCGTGATCCCACCACCTCGG - Intronic
1198140976 X:133803156-133803178 ACCTCGTGATCCGCCCACCCTGG + Intronic
1198246640 X:134838534-134838556 ACCTCGTGATCCAACCACCTCGG + Intronic
1198829120 X:140730106-140730128 ACCTAGTGATCCCCCCGCCTCGG + Intergenic
1198865045 X:141113472-141113494 ACCTTGTGATCCCCCCACCTTGG - Intergenic
1198897640 X:141473916-141473938 ACCTTGTGATCCCCCCACCTTGG + Intergenic
1200040987 X:153369126-153369148 ACCTTGTGATCCCCCCACCTCGG + Intergenic
1200754652 Y:6979164-6979186 ACCTAGTGATCCACCCACCTTGG + Intronic
1201978344 Y:19878798-19878820 ACCTCGTGATCCACCCACCCTGG - Intergenic