ID: 919812150

View in Genome Browser
Species Human (GRCh38)
Location 1:201415475-201415497
Sequence CAGCAGCAGCAGAATCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 922
Summary {0: 1, 1: 0, 2: 9, 3: 95, 4: 817}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919812150_919812151 0 Left 919812150 1:201415475-201415497 CCACTCTGATTCTGCTGCTGCTG 0: 1
1: 0
2: 9
3: 95
4: 817
Right 919812151 1:201415498-201415520 AAATCTTGTAAGATACTATGAGG 0: 1
1: 0
2: 2
3: 14
4: 189
919812150_919812154 19 Left 919812150 1:201415475-201415497 CCACTCTGATTCTGCTGCTGCTG 0: 1
1: 0
2: 9
3: 95
4: 817
Right 919812154 1:201415517-201415539 GAGGGCCACATGGCTTCTACAGG 0: 1
1: 0
2: 1
3: 6
4: 120
919812150_919812152 1 Left 919812150 1:201415475-201415497 CCACTCTGATTCTGCTGCTGCTG 0: 1
1: 0
2: 9
3: 95
4: 817
Right 919812152 1:201415499-201415521 AATCTTGTAAGATACTATGAGGG 0: 1
1: 0
2: 0
3: 15
4: 202
919812150_919812153 9 Left 919812150 1:201415475-201415497 CCACTCTGATTCTGCTGCTGCTG 0: 1
1: 0
2: 9
3: 95
4: 817
Right 919812153 1:201415507-201415529 AAGATACTATGAGGGCCACATGG 0: 1
1: 0
2: 2
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919812150 Original CRISPR CAGCAGCAGCAGAATCAGAG TGG (reversed) Intronic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900780420 1:4614252-4614274 GAGCAGCAGCAGAGTCAGACTGG + Intergenic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
901104859 1:6747228-6747250 CAGCAGCAGGAGATGCAGCGGGG + Intergenic
901164327 1:7206958-7206980 CAGCAGCCACTGAATGAGAGAGG - Intronic
901587522 1:10310316-10310338 CAGCAGCATCAGAATCACCTGGG - Intronic
901764977 1:11494158-11494180 AAGCAAAATCAGAATCAGAGAGG - Intronic
902187250 1:14734637-14734659 CAGCAGCATCCGCATCACAGGGG - Intronic
902582445 1:17416672-17416694 CAGCAGCAGCACAAGCACAAGGG + Intronic
902779235 1:18693731-18693753 CAGCTGCAGGAGGATCAGAGCGG - Intronic
903057384 1:20645616-20645638 CAGCTGCAGCAGCATCATGGCGG - Exonic
903137826 1:21320932-21320954 CTGCAGCAGCAGGATCCTAGAGG - Intronic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903510073 1:23868227-23868249 GAGCAGCAGCAGCAACAGCGCGG + Exonic
903836099 1:26204115-26204137 CAGCAGCAGCAAAATCCGCTGGG - Intergenic
903895405 1:26600069-26600091 CAGCACAAGCAAAATCAAAGAGG + Intergenic
903912181 1:26735722-26735744 TAGCAGCAACAGAATCACAGAGG - Intronic
903989175 1:27253320-27253342 AAGAAGAAGCAGAAACAGAGAGG - Intronic
904760616 1:32801709-32801731 AAGCAGCAGCAGGGTCTGAGAGG - Intronic
904961963 1:34340425-34340447 CAGCAGCAACAGCAGCACAGGGG - Intergenic
904991119 1:34593509-34593531 CAGCAGCAGCAGTATCACCTGGG + Intergenic
905402782 1:37715711-37715733 CAGGAGCAGTAGAACCAGGGAGG - Intronic
905649816 1:39648625-39648647 AAGCTGCAGCAGACCCAGAGGGG + Intergenic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
905905313 1:41614161-41614183 GGTCAGCAGCAGAATCAGAATGG + Intronic
906209680 1:44005595-44005617 CAGCAACAGCAGCACCAGACGGG + Intronic
906498162 1:46320271-46320293 TAGCAGCAGCGGGGTCAGAGAGG - Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
907012854 1:50978911-50978933 CAGCACCTGCAGAAGCACAGTGG + Intergenic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907833419 1:58086738-58086760 CAGCAGAAGCAGAAGTACAGAGG - Intronic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909980637 1:82096096-82096118 CAGCAGCAGCAGCATCACCTGGG - Intergenic
910171862 1:84386495-84386517 CAGCAGCAGAGGTAGCAGAGGGG + Intronic
911002406 1:93180177-93180199 CAGCAGCACCGGAGGCAGAGCGG + Exonic
911136753 1:94448863-94448885 CAGCAGTTGCAAAAGCAGAGGGG + Intronic
911310645 1:96288741-96288763 CAGCAGCAGCAGAGTGCTAGTGG + Intergenic
911452380 1:98080007-98080029 GAGCAGAAGGAGTATCAGAGAGG - Intergenic
911539847 1:99145418-99145440 CAACAGCAGCAGGAGCACAGTGG - Intergenic
912094350 1:106120674-106120696 CACCAGCTGCAGAATGGGAGTGG + Intergenic
912614616 1:111085615-111085637 CAGCAGCAGCTGTGACAGAGGGG + Intergenic
912933294 1:113982774-113982796 TGGCAGCAGGAAAATCAGAGCGG - Intergenic
912947744 1:114098748-114098770 TAGCAACAGCAGAAATAGAGAGG + Intronic
913181384 1:116325777-116325799 CAGCAGCATCAGAATCACCTGGG + Intergenic
913474331 1:119222649-119222671 AAGCAGCAGCAGATTCAGGGTGG + Intergenic
914356808 1:146892939-146892961 AAGCAGCAGCAGGATTTGAGAGG - Intergenic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
915147661 1:153804852-153804874 CAGCAGCATCTGAAACAGATGGG + Exonic
915623819 1:157102348-157102370 CAGCAGCAGCAGCATCACCTAGG - Intergenic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916172010 1:162008646-162008668 CAGCAGCATCAGCATCACACAGG + Intronic
916482324 1:165225753-165225775 CAGCAGCAGCAGCATCACCTGGG - Intronic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
918121294 1:181543234-181543256 CAGCAGCATCAGCATCAGCAGGG - Intronic
919523571 1:198619807-198619829 CAGGAGTACCAGAAACAGAGAGG + Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919927324 1:202199128-202199150 CAGGAGCAGGAGATTCAAAGTGG - Intronic
919974509 1:202602063-202602085 GGGCACAAGCAGAATCAGAGGGG + Intronic
920024179 1:202980434-202980456 AAGCAGCAGCAGGATGTGAGAGG - Intergenic
920170648 1:204070548-204070570 TAGCAACAGCAGATTAAGAGAGG - Intergenic
920636020 1:207704440-207704462 AAGCAGCAGCAGTATCTGGGAGG + Intronic
920662176 1:207924540-207924562 CAGCAGCAGCAGCATCACCTGGG - Intergenic
920977654 1:210801089-210801111 CAGCAGCAGCAATTTCAGGGAGG + Intronic
921132687 1:212233171-212233193 CAGCAGCAGCAGCATCACCTGGG - Intergenic
921384550 1:214555381-214555403 CAGAAGCAGAGGATTCAGAGAGG - Intergenic
921431909 1:215075889-215075911 CAGCATCAGCAGAATAACCGGGG + Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921897791 1:220418931-220418953 AAGCAGCAGCAGAGTTTGAGAGG + Intergenic
921908272 1:220518768-220518790 AAGCAGCAGCAGGATTTGAGAGG + Intergenic
922032592 1:221816532-221816554 CAGCAGCAGCAGGGTGTGAGAGG + Intergenic
922947669 1:229530878-229530900 CAGCAGCCGCAGAACTGGAGGGG + Intronic
923130004 1:231066816-231066838 CAGCAGCATCCTAATCACAGAGG + Intergenic
923273826 1:232379931-232379953 CAGCAGCAGAAGGACCACAGGGG - Intergenic
923952313 1:238970722-238970744 AAGCAGCAGCAGGATTTGAGAGG - Intergenic
924030296 1:239879315-239879337 CAGCAGCAGCAGAATCTCCTGGG - Intronic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924501292 1:244640841-244640863 CCAGAGCAGCAGAACCAGAGGGG + Intronic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
924624259 1:245686673-245686695 CATCATCAGCAGCATCAGCGAGG + Exonic
924628678 1:245716643-245716665 CAGCAGCTGAAGCAACAGAGAGG + Intergenic
1063042407 10:2356755-2356777 CTGAAGCAGGAGAATCACAGAGG + Intergenic
1063308612 10:4931648-4931670 CAGCAGCAGCAGAACCTCTGTGG + Intronic
1063318059 10:5025824-5025846 CAGCAGCAGCAGAACCTCTGTGG - Intronic
1064419569 10:15179261-15179283 CAGCAGCAGCAGTATCTGTGAGG - Intergenic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065447665 10:25819993-25820015 CAGCAAAAGCAGAATTAGAGTGG - Intergenic
1065505711 10:26428290-26428312 CAGCAGGAGGAGAACCAGAAAGG - Intergenic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1066134744 10:32433866-32433888 AAGCAGCAGCAGAGTTTGAGAGG - Intergenic
1066224090 10:33365491-33365513 CGTCAGTAGCAGAAGCAGAGAGG + Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1069872440 10:71541284-71541306 CAGGAGGAGAGGAATCAGAGCGG - Intronic
1069876198 10:71564561-71564583 CAGATGCAGAAGGATCAGAGAGG + Intronic
1070160772 10:73865577-73865599 CAGCAGCAGTGGCAGCAGAGGGG + Intronic
1070512140 10:77171132-77171154 CAGCAGCAGCAGCATCACTTGGG + Intronic
1070903176 10:80048700-80048722 CAGCAGCAGGAGGAACAGAAAGG - Intergenic
1070994105 10:80760649-80760671 CAGCAGCAGCAGCATCACCTGGG - Intergenic
1071054132 10:81489357-81489379 AAGGAGCAGCAGAATTTGAGGGG + Intergenic
1071444201 10:85730847-85730869 CAGCAGCAGCAGCATCACCTGGG - Intronic
1072270741 10:93773983-93774005 CAACAGCAGCAGCATCATGGAGG - Intronic
1072296652 10:94014887-94014909 CATCAGCATCAGAATCATGGTGG - Intronic
1072562199 10:96586773-96586795 CAGCAGCAGCAGCCACAGCGCGG + Exonic
1073111690 10:101066527-101066549 CCACAGAAGCAGAATCAGAGGGG + Intronic
1075438470 10:122461669-122461691 CAGCAGCAGCGGGAGAAGAGCGG - Exonic
1075969693 10:126642050-126642072 CAGCAGCAGCTCCATCAGTGGGG - Intronic
1076095227 10:127729103-127729125 AAGCAGCAGCAGAGTTTGAGAGG - Intergenic
1076140872 10:128077734-128077756 CAGAAGCAGCAGCAGCAGACAGG + Exonic
1076531312 10:131147131-131147153 CGGCAGCAGCAGAATTAAAAGGG + Intronic
1076868476 10:133181235-133181257 CACCCACAGCAGCATCAGAGCGG + Intronic
1077120990 11:908433-908455 CAGCTGCAGCAGAAAGATAGTGG - Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078467514 11:11561154-11561176 CAGCAGCAGCAGAAACTGCGAGG + Intronic
1078486767 11:11730488-11730510 TAGCAGCAGCAGACTCACAGTGG + Intergenic
1078753960 11:14191174-14191196 AGGCAGCAGCGGACTCAGAGAGG - Intronic
1078975735 11:16473930-16473952 AAGCAGCAGCAGAGTTTGAGAGG - Intronic
1079181380 11:18196747-18196769 CAGCAGCAGCAGTACCAGATAGG - Intronic
1079249961 11:18780183-18780205 CAGCAGCTGGAGGATGAGAGGGG + Intronic
1079453155 11:20615015-20615037 CAGTAGGAGCAGAATCATTGCGG + Intronic
1080229452 11:30002488-30002510 CAGCAGCAGCTAAATCAGCAAGG + Intergenic
1080302358 11:30798654-30798676 TAGCAGTAGCAGAATCAGTTGGG + Intergenic
1080746781 11:35115492-35115514 AAGCAGCAGCAAAATGAGAGAGG + Intergenic
1080943205 11:36942646-36942668 CTGGAGCAGCAACATCAGAGAGG + Intergenic
1081589416 11:44410783-44410805 AGGCAGAAGCAGAATAAGAGAGG + Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1081814380 11:45930331-45930353 AAGCAGCAGCAGGGACAGAGAGG + Intronic
1081866926 11:46365292-46365314 CATCAGGAGCAGAGTCAGAAGGG + Intronic
1081979919 11:47259852-47259874 CAGCAGCTGCATCCTCAGAGAGG + Exonic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1083471204 11:62885267-62885289 CAGTAGAACCAGAATCAGACAGG - Exonic
1083490043 11:63009318-63009340 CAGCTGCTGGAGAAGCAGAGAGG - Intronic
1083788185 11:64966170-64966192 CAGCAGCAGTAGTTTCAGAAGGG + Intronic
1084086581 11:66857749-66857771 CAGCAGCAGCAGGAGCGGCGGGG - Exonic
1084284894 11:68124762-68124784 CATCAGCAGGAAATTCAGAGTGG - Intergenic
1084385302 11:68839846-68839868 CAGCCGCAGCAGTATCGGAAGGG + Intronic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084753932 11:71222748-71222770 GAGCAGGAGCAGACTGAGAGAGG - Intronic
1084954853 11:72685737-72685759 CAGCTGCAGCAGCTTCAGCGGGG - Intronic
1085022244 11:73217224-73217246 CACCAGGAGCAGTAGCAGAGTGG - Intergenic
1085305661 11:75484337-75484359 CAGCAGCAGCTGCACCAGAGGGG + Intronic
1085401551 11:76238810-76238832 CAGCAGCAGCAGCTTCTGTGGGG - Intergenic
1085768627 11:79305999-79306021 CTGCGCCAGCAGAGTCAGAGAGG - Intronic
1085808426 11:79658078-79658100 CAGAAGCATCAGCATCAGCGGGG + Intergenic
1085854683 11:80162850-80162872 CAGCAGCAGTACACTGAGAGGGG + Intergenic
1086330421 11:85748373-85748395 CAGCAGCTGAAGAATATGAGTGG - Exonic
1086516141 11:87615475-87615497 CAGCTGCACCAGAATCACAAAGG - Intergenic
1086733861 11:90282513-90282535 AAGCAGCAGCAGAGTTTGAGAGG - Intergenic
1086774931 11:90818913-90818935 CAGCAGCAACAGAGTTTGAGAGG - Intergenic
1086896817 11:92322581-92322603 AAGCAGCAGCAGAGTTTGAGAGG - Intergenic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1088560536 11:111110941-111110963 CAGGAGGATCAGAGTCAGAGGGG + Intergenic
1088594467 11:111429799-111429821 CAGCAGCAGAAGAATTGAAGTGG - Intronic
1089166228 11:116478694-116478716 CTTCAGCAGCAGAATCTCAGAGG + Intergenic
1089609457 11:119661355-119661377 CAGCAGTGGCAGCAGCAGAGGGG + Exonic
1089621122 11:119722782-119722804 CACGAGTAGCAGACTCAGAGGGG + Intronic
1090469030 11:126962631-126962653 AAGCAGCAGCAGGATTTGAGAGG + Intronic
1090500102 11:127252805-127252827 CTGCACCAGCACAGTCAGAGTGG + Intergenic
1090764485 11:129864907-129864929 GAACAGCAGTGGAATCAGAGAGG + Intronic
1091105336 11:132913898-132913920 GAGCTGCAGCAGAGGCAGAGAGG - Intronic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091603555 12:1932272-1932294 CAACAGCAGCAGAATAGCAGAGG + Intergenic
1093073477 12:14732152-14732174 CACCAGCAGCAAAAGCTGAGTGG - Intergenic
1093092456 12:14936989-14937011 CTGAAGGAGCAGAATAAGAGAGG - Intronic
1093112389 12:15167388-15167410 CAGCATCAGCAGAATCACCTGGG + Intronic
1093450831 12:19311484-19311506 AAGCAGCAGCAGAGTTTGAGAGG - Intronic
1094439088 12:30455007-30455029 AAGCAGCAGCAGCAACACAGTGG - Intergenic
1094501977 12:31029697-31029719 CAGCAGCAGCAGGATCACCTGGG - Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1095614057 12:44167679-44167701 CATAAGCTGTAGAATCAGAGGGG + Intronic
1095726387 12:45457837-45457859 AAGCAGCAGCAGCATTTGAGAGG + Intergenic
1096070426 12:48772367-48772389 AAACACCAGCAGAATCACAGGGG + Exonic
1096111728 12:49032778-49032800 CAGCAGCAACAGCAGCAGATGGG - Exonic
1096112854 12:49039519-49039541 CAGCAGCTGCAGGAGCAGTGGGG - Exonic
1096476862 12:51913815-51913837 TAGGAACTGCAGAATCAGAGGGG + Intronic
1096647088 12:53044754-53044776 CAGCAGCAGGAGCTTCAGAGAGG - Intergenic
1097242210 12:57583273-57583295 CAGCAGCAGGAAAACCAAAGAGG - Intronic
1097585481 12:61510695-61510717 CAGCAGCAGCAGGAGAAGAATGG + Intergenic
1098608451 12:72423807-72423829 AAGCAGAAGAGGAATCAGAGAGG + Intronic
1099982132 12:89616877-89616899 CAGGAGAACCAGAACCAGAGTGG - Exonic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1101097494 12:101357851-101357873 CAGTATCAGCAGCATCTGAGGGG + Intronic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1101961316 12:109252639-109252661 CAACAGCATCAGCATCAGATGGG + Intronic
1102347204 12:112167844-112167866 CAGCAGCAGCAGCGACAGCGAGG + Exonic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1102541033 12:113619335-113619357 CACCAGCAGCCCCATCAGAGGGG + Intergenic
1102833170 12:116026592-116026614 CAGCAGCAGCAGCATCACATGGG - Intronic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103956855 12:124582220-124582242 CAGCAGCAGCAGCACCAGCCTGG - Intergenic
1104310454 12:127650126-127650148 CAGAATCAGCACATTCAGAGAGG - Intergenic
1104642011 12:130473419-130473441 GAGCAGCAGCAGCATCTGGGGGG + Intronic
1104991693 12:132627960-132627982 AAGCAGCAGCAGAATTTGAGAGG - Intronic
1105239285 13:18595917-18595939 CAGCACCAGGAGCATCAAAGTGG + Intergenic
1105926266 13:25011563-25011585 CAGCAGGATCAGTATCAGAGAGG + Intergenic
1106038720 13:26069414-26069436 CAGCAGGATCAGAATCAGAGAGG - Intergenic
1106109287 13:26762187-26762209 CAGCAGCAGCAGCATCACTGGGG - Intergenic
1106147565 13:27063795-27063817 CTGCAGTAGCACAATCACAGTGG - Intergenic
1106513360 13:30430723-30430745 CAGGAGCAGGAAAATCTGAGAGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107097174 13:36549500-36549522 TAGCAGCAGCAGTATCTAAGTGG - Intergenic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108557387 13:51607942-51607964 CAGAAGGATTAGAATCAGAGAGG + Intronic
1108695639 13:52900201-52900223 CAGCAGCAGCAGCATCACCTGGG + Intergenic
1108727582 13:53200039-53200061 CAGCAGCCACAGAATCAGCAAGG - Intergenic
1108882782 13:55141763-55141785 CAGCAGCAGCAGTATCACCTAGG - Intergenic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1110447361 13:75601261-75601283 AAGCAGCAGCAGAATTTGAGAGG + Intronic
1110470035 13:75849151-75849173 CATCAGGAGCAGAATTGGAGAGG + Exonic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1110895697 13:80749586-80749608 CAGCATGAGCAGAACTAGAGTGG + Intergenic
1111046728 13:82823504-82823526 CAGCAGCACCAGACTAAGGGTGG + Intergenic
1111173984 13:84567952-84567974 CAGCAGCAGCAGAGTTTGAAAGG - Intergenic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1111746018 13:92270413-92270435 CAGGAGCAGGAGAAAGAGAGAGG - Intronic
1112030311 13:95450573-95450595 GAGTAGCAGGAAAATCAGAGCGG - Intronic
1112200338 13:97268425-97268447 CAGCAGCAGCAGCATCCGCTGGG - Intronic
1112273436 13:97993167-97993189 TAGCAGCTGCAGTCTCAGAGAGG - Exonic
1112643079 13:101298902-101298924 CAAAAGCTGAAGAATCAGAGAGG - Intronic
1113094199 13:106646460-106646482 CCTCAGCAGCAGATGCAGAGAGG + Intergenic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113462461 13:110491707-110491729 AAGCAGCAGCAGCAACAGCGTGG - Intronic
1113467529 13:110522769-110522791 CAGCAGCAGCAGACCCGAAGGGG + Intergenic
1114212804 14:20630281-20630303 CACCTGCTGCAGAATCACAGAGG + Intergenic
1114261896 14:21043021-21043043 CAGCAGCAGAAGCAGCAGAAGGG - Exonic
1114734403 14:25029124-25029146 CAGCAGCAGCAGAGTTTGAAAGG + Intronic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1114961764 14:27900676-27900698 CACCAGGAGTAGAATCAAAGAGG + Intergenic
1115058561 14:29162304-29162326 CAGCAGCAGCACCAGCAGAAGGG - Intergenic
1115418983 14:33170585-33170607 AAGCAGCAGCAGGATTTGAGAGG - Intronic
1115424615 14:33243517-33243539 CAGCAGCAGCAGTATCACCTGGG - Intronic
1115923882 14:38409213-38409235 CAGAGGCAGCAGGATCAGTGTGG + Intergenic
1115944846 14:38648455-38648477 CAGCAGCAGCAAAATGAGTTAGG + Intergenic
1116238252 14:42308984-42309006 CAGCAGTTGCAAAAGCAGAGGGG - Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117082995 14:52170695-52170717 CAGCAGTTGCAAAAGCAGAGGGG + Intergenic
1117835587 14:59802274-59802296 CAGCAGCACCAGCATCAGCTGGG + Intronic
1117863895 14:60124732-60124754 CAGGATCAGTAGAATCACAGAGG + Exonic
1118019495 14:61695947-61695969 GAGCAGCAGCAGAAACAAAAAGG - Intronic
1118058014 14:62102769-62102791 CAGCAGCAGGAAAATATGAGAGG - Exonic
1118231478 14:63954477-63954499 CAGCAGCATCAGTATCACATGGG - Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119464403 14:74843683-74843705 CAGCAGAAGCAGAATAAAACAGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119688720 14:76653937-76653959 CAGCAGCAACAGAATGGTAGGGG + Intergenic
1120175201 14:81286221-81286243 AAGCAGCAGCAGGATTTGAGAGG + Intronic
1120185876 14:81393417-81393439 CAGCAGCAGCAGGAAGAGTGAGG + Intronic
1120367508 14:83589750-83589772 CGGCTACAGCAGATTCAGAGGGG + Intergenic
1120902194 14:89585156-89585178 CAGCATCAGCAAAATTATAGAGG - Intronic
1121038360 14:90725334-90725356 CAACAGCAGCAGCAGCAGACAGG - Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121223852 14:92306949-92306971 CAGCAGCAGCAGCATCACCTAGG - Intergenic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121308410 14:92922005-92922027 CAGCAGCCGCAGATGGAGAGGGG + Intergenic
1121309836 14:92929734-92929756 CATCAGCAGAAGAAACACAGCGG + Exonic
1121512886 14:94525778-94525800 GAGATGCAGCAGAAACAGAGTGG - Intergenic
1121857149 14:97280702-97280724 CAGCGCCAGCAAAATCACAGAGG + Intergenic
1122738696 14:103858482-103858504 CAGCAGCATCAGCAGCACAGGGG - Intergenic
1123491959 15:20788169-20788191 CAGCACCAGGAGCATCAAAGTGG - Intergenic
1123548464 15:21357259-21357281 CAGCACCAGGAGCATCAAAGTGG - Intergenic
1123721375 15:23064553-23064575 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
1123971293 15:25510302-25510324 CATCAGAAGCACAATCTGAGAGG - Intergenic
1124413481 15:29455815-29455837 CAGCAGCAGCAGATTCTCATAGG + Intronic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1125768408 15:42149960-42149982 CACCAGCACCAGAACCAGGGAGG + Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126356587 15:47802431-47802453 CAGCAGCAGCAGAGTCATCAGGG - Intergenic
1126589574 15:50325403-50325425 CAGCAGAAACAGAACCAGACAGG - Intronic
1127428580 15:58880435-58880457 CAGCAGCAGCAGCACCAGCTGGG + Intronic
1127840194 15:62825024-62825046 CACCAACAGCAACATCAGAGAGG + Intronic
1127903307 15:63357331-63357353 CAGCAGCAGCAGCATCACCTGGG - Intronic
1127961555 15:63894405-63894427 CAGCATCAGCAGGGTCAGAGAGG + Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128819694 15:70640633-70640655 CTGCAGCAGCACAATGGGAGTGG - Intergenic
1129126329 15:73444343-73444365 AAGCAGCAGCAAAATGTGAGAGG - Intronic
1129466783 15:75728563-75728585 CAGCAGCAGCAAAGCCAGAGCGG - Intergenic
1129607095 15:77030314-77030336 GAGCAGCAGCAGCACCAGCGTGG + Intronic
1129720462 15:77875215-77875237 CAGCAGCAGCAAAGCAAGAGCGG + Intergenic
1129789017 15:78328429-78328451 CAGCAGCATCAGAATCACCTGGG - Intergenic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1130020597 15:80227980-80228002 AAGCAGCAGCAGAGTTTGAGAGG - Intergenic
1130040946 15:80404693-80404715 CCGCAGCATCAGCACCAGAGCGG + Intronic
1130296552 15:82650426-82650448 CAGAAGCAGCAGAAACAAATAGG + Intergenic
1130881753 15:88061526-88061548 GAGCAGGAGCAGGAGCAGAGTGG + Intronic
1131139347 15:89964439-89964461 CAGCAGCAGCAGGATCAGTCAGG - Intergenic
1131478438 15:92761692-92761714 CAGTAGCAGCAGAAGCCTAGTGG + Intronic
1131654426 15:94440907-94440929 CAGGAGCAGGAGAGTCAGAGTGG - Intronic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132032858 15:98452524-98452546 CTGCTGCAGCAGAGCCAGAGAGG + Intronic
1202956797 15_KI270727v1_random:84490-84512 CAGCACCAGGAGCATCAAAGTGG - Intergenic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1132743911 16:1428883-1428905 CAGCCACAGCTGGATCAGAGGGG + Intergenic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133382133 16:5340026-5340048 CAGCACCAGCAAAATCAGTATGG + Intergenic
1133456839 16:5949729-5949751 CAGCAGCAGCAGCATCAACTAGG + Intergenic
1134188934 16:12106459-12106481 AAGCAGCAGCAGAAAAGGAGGGG - Intronic
1136248921 16:28990930-28990952 CAGCAGCATCAGAATCACACAGG - Intergenic
1136344714 16:29667195-29667217 CTGCAGCTGCAGAATGACAGAGG + Exonic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136390837 16:29963211-29963233 AAGGAGCAGCAGGATCAAAGTGG - Exonic
1137060340 16:35787607-35787629 GAGCAGCAACAAGATCAGAGAGG - Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137449850 16:48561652-48561674 AATCAGCAGAAGAATCAGATAGG + Exonic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137846441 16:51694044-51694066 CAGGTGAAGCACAATCAGAGTGG + Intergenic
1138420987 16:56898941-56898963 CAGCCGAATCAGAATCAGCGTGG + Intronic
1138461587 16:57151546-57151568 GAGGAGCAGCAGAAACAGTGGGG + Intergenic
1139292499 16:65871270-65871292 CAGAGGCAGCAGAATCACTGGGG + Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139389895 16:66600759-66600781 CAGCAGCAGCAGAAAAAGCTGGG + Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1139803784 16:69546386-69546408 AAGCAGCAGCAAAATTAGAGAGG + Intergenic
1139937239 16:70580115-70580137 AAGCAGCAGCAGAATCGGGGTGG - Intronic
1139977206 16:70822514-70822536 AAGCAGCAGCAGGATTTGAGCGG + Intronic
1140200362 16:72889940-72889962 CACCTGCAGCAGCATGAGAGTGG - Exonic
1140376159 16:74446935-74446957 CAGCAGCAGAAGGCTCAGGGAGG + Intergenic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140521485 16:75585680-75585702 CAGCAGCAGCTGAAACACACTGG + Intergenic
1140550157 16:75856603-75856625 CAGCAGGAGCAGGATCTGTGTGG - Intergenic
1140820795 16:78661243-78661265 CTCCAGCAGCAGCAACAGAGAGG + Intronic
1140837432 16:78808194-78808216 CAGGAGGAGCATATTCAGAGGGG - Intronic
1140870957 16:79106081-79106103 CAGCAGCATCAGAATCACCTGGG + Intronic
1141071138 16:80955324-80955346 CAGCAGCAGCAGCAGCGTAGTGG - Intergenic
1141099268 16:81185186-81185208 CAGCTGGAGCAGGAACAGAGCGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141894208 16:86948170-86948192 GAGCAGGAGCAGGAGCAGAGTGG - Intergenic
1143338218 17:6189446-6189468 CAGCATGTGCAGAATCAAAGAGG - Intergenic
1143637416 17:8174089-8174111 CAGCAGAAGCAGTTTCCGAGGGG + Exonic
1143897372 17:10146480-10146502 CAGCAGCACCAGAATCACCTGGG + Intronic
1144517320 17:15927790-15927812 CAGCAGCAGCAGGCACTGAGGGG - Intergenic
1144707024 17:17376046-17376068 TAGCAGCAGCAGGATTTGAGAGG + Intergenic
1145847060 17:28049488-28049510 CAGCAGCAGCAGCTTAATAGAGG - Intronic
1145991125 17:29080102-29080124 CATCAGCAGCAGAGGCGGAGCGG + Intronic
1146718109 17:35103328-35103350 CAGGAGGAGGAGAAGCAGAGAGG + Intronic
1147190097 17:38733447-38733469 CAGCAGCAGCCCCCTCAGAGTGG - Exonic
1147231329 17:39020724-39020746 AAGCAGCAGCAGAGTTTGAGAGG + Intergenic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147631203 17:41933098-41933120 CAGCAGGAGGAGAATAAGTGGGG - Intronic
1147964826 17:44188980-44189002 CAGCATCAGCAGAGCCTGAGGGG - Intronic
1148476900 17:47934720-47934742 AAGCAGCATCAGAATCAGAGTGG + Intergenic
1148612133 17:48971601-48971623 CAGAAGCAGCAGAATATGCGAGG + Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1148953875 17:51337438-51337460 CAGAAGCCTCAGAATCAGGGAGG - Intergenic
1149092542 17:52801464-52801486 CAGCAGTAGCAGTAGCAGATTGG - Intergenic
1149092567 17:52801728-52801750 CATCAGCAGCAGCATCTGAAGGG + Intergenic
1149239052 17:54627120-54627142 CAGCAGCCGCAGAGTGAGGGTGG - Intergenic
1149601968 17:57898990-57899012 CAGCAGGAGCACAGGCAGAGTGG + Intronic
1149849906 17:60028215-60028237 CACCAGCAACAGCATCTGAGAGG + Intergenic
1149860262 17:60118309-60118331 CACCAGCAACAGCATCTGAGAGG - Intergenic
1150163994 17:62924117-62924139 CCACAGGAGCAGAAGCAGAGGGG - Intergenic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1150812470 17:68367542-68367564 GAGCAGCTGCAGAATCACAACGG - Intronic
1151119964 17:71782009-71782031 AAGCAGCAGCAGGATTTGAGAGG + Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151285753 17:73109842-73109864 CAGCAGCAGCAGCGACAGAAAGG + Intergenic
1151437001 17:74103998-74104020 CAGCAGCATCAGTATCACTGGGG - Intergenic
1152207532 17:78982295-78982317 CAGCAGTGGCAGAAGCTGAGAGG - Intergenic
1152345125 17:79746829-79746851 CAGCAGCAGCGGAATCACGCAGG - Intergenic
1152972115 18:172447-172469 AAGCAGCAGCAGGATTTGAGAGG + Intronic
1153066356 18:1050069-1050091 CAGCAGCAGAAGATAGAGAGAGG + Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154184947 18:12174982-12175004 CAGCAGTAGCAGCAGCATAGTGG + Intergenic
1154449509 18:14462720-14462742 CAGCACCAGGAGCATCAAAGTGG - Intergenic
1155089206 18:22489782-22489804 CAAGAGGAGCAGAATCAGATGGG + Intergenic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1156181683 18:34612248-34612270 CAGCAGCTGCAGGATCCCAGAGG - Intronic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1157400282 18:47381564-47381586 CATCAGCAGCTGAAGCAGACGGG + Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160047380 18:75399719-75399741 CAGCAGCAGCAGCAGCAAAAGGG - Intergenic
1160047733 18:75402704-75402726 CAGCAGAAGCAGAAATAGAGAGG + Intergenic
1160077801 18:75694457-75694479 CCACAGCAGCAGACTCAGTGTGG - Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160455548 18:78996499-78996521 CAGCAGCAGAAGATGCAAAGTGG + Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161642435 19:5432729-5432751 CACCAGAATCAGAATCAGAAAGG + Intergenic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162870160 19:13580438-13580460 CAGCAGCAGCAGCATCACCTAGG + Intronic
1163612769 19:18309704-18309726 CAGCAGCAGAAGCAGCAGAAAGG - Exonic
1164424542 19:28129217-28129239 CAGCAGCAGGAGAAAGAGAGAGG - Intergenic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165340467 19:35208188-35208210 TAGTAAGAGCAGAATCAGAGAGG + Intergenic
1165452258 19:35890416-35890438 CAGCAGCAGCTGAACCAGAGTGG + Exonic
1166836235 19:45669528-45669550 CAGCAGCTGCAGGATCGGAGAGG - Exonic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167034030 19:46982715-46982737 CAGCAGCAGCAGCATCATCTGGG + Intronic
1167066093 19:47187186-47187208 CAGGAGAGCCAGAATCAGAGTGG + Intronic
1167251004 19:48398430-48398452 CAGCAGCAGCAGCATCTTAGCGG - Exonic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167436226 19:49480367-49480389 CAGCAGTAGGAGGAGCAGAGGGG - Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167617215 19:50541932-50541954 TAGCAGCAACAGCAGCAGAGTGG + Intronic
1168541202 19:57211923-57211945 CAGCACCAGCGGATTCACAGTGG + Exonic
1168546353 19:57253645-57253667 CAGCACCAGCGGATTCACAGTGG + Exonic
925485856 2:4329862-4329884 AAGGAACAGCAGATTCAGAGAGG - Intergenic
926021422 2:9499054-9499076 CAGCAGCAGCAGCATCACCTGGG - Intronic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927257913 2:21056424-21056446 CAGCAGCAGCAGAATAACCCAGG + Intergenic
927275959 2:21262695-21262717 CCGCAGCAGCAGGACAAGAGGGG + Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
928032780 2:27795929-27795951 AGGCAGCAGGAGAAACAGAGGGG - Intronic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
928164032 2:28956532-28956554 CAGCAGCAGCAGCATCACGTGGG - Intergenic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928622585 2:33105956-33105978 AAGCAGCAGCAGGATTTGAGAGG - Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
929026698 2:37611707-37611729 CAGCAGCATCAGCATCAGCTGGG + Intergenic
929483349 2:42333831-42333853 CAGCAGCCACAGAAACAGAATGG + Intronic
929529591 2:42739719-42739741 AAGCAGCAGCAGAGTTTGAGAGG - Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929607053 2:43241695-43241717 CAGCAGCTGCTGGAGCAGAGCGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
931243273 2:60471384-60471406 AAGAAGCAGCAGAATCAGCTGGG - Intronic
931426794 2:62178756-62178778 CAGCAGCAGGAGAGTAAGGGAGG + Intergenic
931516941 2:63055534-63055556 CAGCAGCAGCAGAGCGGGAGCGG + Exonic
931836613 2:66105595-66105617 GAGCCCCAGCAGAATGAGAGAGG - Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932132337 2:69199274-69199296 CAGCAGCATCAGCATCACATGGG - Intronic
932752169 2:74378218-74378240 CAGCGGCAGCAGGATGAGTGCGG - Exonic
932893055 2:75612527-75612549 CAGAAGCAGCAGAAACTAAGAGG - Intergenic
933301924 2:80550526-80550548 AAGCAGCAGCAGAGTTTGAGAGG - Intronic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
933873714 2:86596936-86596958 AAGCAGCAGCAGGATTTGAGAGG + Intronic
934770425 2:96904199-96904221 CAGCAGCAGCAACAGCACAGTGG + Intronic
935834671 2:107037365-107037387 CAGCAGATGCAGTAGCAGAGAGG - Intergenic
935848116 2:107188213-107188235 CAGCAGCAGCAGTAACAGCACGG - Intergenic
935852816 2:107241726-107241748 GAGCAGCAGCAGCAGCAGACAGG + Intergenic
936370186 2:111897340-111897362 CAGCAAAAGCAAAATCAGTGTGG - Intergenic
936839450 2:116752414-116752436 CATCTACAGCAGATTCAGAGGGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937318108 2:120944868-120944890 CAGCAGCAGCAGCATCCCTGTGG + Intronic
938123136 2:128647680-128647702 CTCCAGAAGCAGAATAAGAGAGG - Intergenic
938168823 2:129057039-129057061 AAGCAGCAGCAGCATCTGAGAGG - Intergenic
938481930 2:131670024-131670046 CAGCACCAGGAGCATCAAAGTGG + Intergenic
938621434 2:133058748-133058770 AAGCAGCAGCAGATTTTGAGAGG + Intronic
939568085 2:143808316-143808338 CAGCAGGAGCTGAATGGGAGGGG + Intergenic
940428514 2:153558396-153558418 CAGCAGCAGCTTAAGAAGAGTGG + Intergenic
940531708 2:154886335-154886357 CAGCAGCTGCAGTAGCACAGTGG + Intergenic
940613389 2:156020003-156020025 GAGCAGCAGAGCAATCAGAGAGG - Intergenic
940788305 2:158005495-158005517 CAACAGAATCAGAATCAGGGTGG + Intronic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941291042 2:163675426-163675448 CAGCAGCAACAGCATCACTGGGG + Intronic
941389571 2:164894990-164895012 CAGCAGCAGCAGCATCACCTGGG + Intergenic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942033073 2:171982426-171982448 CAGCAGCAGCAGAGATGGAGAGG - Intronic
942198772 2:173550188-173550210 CACCAGTGGCAGAATCAAAGTGG - Intergenic
942389048 2:175472950-175472972 CAGCATCAGCACAATCCCAGGGG + Intergenic
942895771 2:181052428-181052450 CAGCAGCAGCAAAATAAGGCAGG + Intronic
943972974 2:194434506-194434528 CAGCAGCAACAGAGTCAGTTGGG + Intergenic
944310774 2:198231671-198231693 CAGCAACAGCAGAGTGGGAGGGG - Intronic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
945181573 2:207097063-207097085 CAGCAGCATCAGCATCAGCTGGG - Intronic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945487134 2:210409482-210409504 GAGCAGCAGCAGGATTTGAGAGG - Intergenic
945986484 2:216358520-216358542 CAGCAGAAGTAGAAGCAGCGTGG + Intronic
946709605 2:222492474-222492496 CAGCTGGAGCTGAATCAGCGGGG + Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947399054 2:229714358-229714380 CAGCAGCAGCAGGGCCAGCGCGG + Exonic
948270241 2:236668607-236668629 CAGCTCCAGCAGAATGACAGGGG - Intergenic
948506425 2:238430251-238430273 AAGCAGCAGCAGGGTTAGAGAGG - Intronic
948766151 2:240220557-240220579 GAGAAGCAGCAGAATTAGACAGG - Intergenic
949070318 2:242020560-242020582 CTGCAGCTGCAGACCCAGAGAGG + Intergenic
1169344511 20:4819902-4819924 CAGCTGTGGCAGAACCAGAGAGG - Intronic
1169816359 20:9660915-9660937 CAGCAGCATCAGCATCACTGGGG + Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170330199 20:15201046-15201068 CAGCAGCAGCAGCACCTGGGAGG - Intronic
1170545592 20:17433505-17433527 CAACAGGAGCAGAGGCAGAGAGG + Intronic
1171229502 20:23472122-23472144 CAGCAGCTGCAAAAGCAGAAGGG + Intergenic
1172042296 20:32053868-32053890 CAGCAGCAGCAGCATCACCGGGG - Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172577207 20:36018535-36018557 CAGCTGTAGGAGAATGAGAGTGG + Intronic
1172741192 20:37168873-37168895 TAGAAGTAACAGAATCAGAGAGG - Intronic
1172814702 20:37677130-37677152 CAGCAGCTCCAGTCTCAGAGGGG - Intergenic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1174298853 20:49568063-49568085 TAGCAGCAGCAGCAACAGTGCGG + Exonic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1174952028 20:55052696-55052718 CAGCAGCAACAAAATCATAGTGG - Intergenic
1175403805 20:58714729-58714751 CAGCAGCTCCAGAGCCAGAGGGG - Intronic
1175579968 20:60090784-60090806 CTGCTTCAGCAGAATCTGAGCGG + Intergenic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175597856 20:60249742-60249764 CAGCAGCATCAGCATCACTGGGG - Intergenic
1175741499 20:61422851-61422873 CAGCAGCAGGAGAAGCACTGAGG - Intronic
1175834884 20:61987081-61987103 CAGCAGCAGCAGCAACAGCCAGG + Intronic
1176056883 20:63153503-63153525 CTGCAGCAGCTTACTCAGAGAGG + Intergenic
1176360185 21:5988718-5988740 CAGCAGCAGCAGCATCTGGCAGG - Intergenic
1176446663 21:6827665-6827687 CAGCACCAGGAGCATCAAAGTGG + Intergenic
1176824834 21:13692695-13692717 CAGCACCAGGAGCATCAAAGTGG + Intergenic
1177215734 21:18125868-18125890 AAGCAGCAGCAGGTTTAGAGAGG + Intronic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1178320595 21:31602255-31602277 CAGCAGCAGCAGAAGAAAACTGG + Intergenic
1178728227 21:35074298-35074320 CAGAAGCATCAGTGTCAGAGTGG + Intronic
1179035044 21:37752465-37752487 CAACAGCAGCAAAAGCCGAGAGG + Intronic
1179763333 21:43549832-43549854 CAGCAGCAGCAGCATCTGGCAGG + Intronic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1180054075 21:45348106-45348128 CAGCAGCAGCAGCCCGAGAGTGG + Intergenic
1180188852 21:46153294-46153316 CAGGAGCAGCAGCACCTGAGCGG + Intronic
1180255435 21:46624279-46624301 CAGCAGCAGCAAGTTCAGGGTGG - Intergenic
1180740853 22:18052400-18052422 CAGCAGCAGCAGAGGCACCGGGG + Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181115544 22:20630934-20630956 CAGCACCAACAGCTTCAGAGAGG + Intergenic
1181323624 22:22027798-22027820 CAGAAGTAGCAGAAACAGGGTGG + Intergenic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181541473 22:23575232-23575254 CAGCACCAACAGTTTCAGAGAGG - Intronic
1181551355 22:23640591-23640613 CAGCACCAACAGCTTCAGAGAGG - Intergenic
1181569940 22:23763116-23763138 CTGAAGCAGCAGAACCACAGAGG + Exonic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181796908 22:25318070-25318092 CAGCACCAACAGCTTCAGAGAGG + Intergenic
1182108514 22:27706181-27706203 CAGAAGCAGCAAAATCCTAGAGG + Intergenic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182277696 22:29200966-29200988 AAGCAGGAGGAGAATGAGAGTGG - Intergenic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182998209 22:34833689-34833711 CAGAAGAGGCAGAAACAGAGGGG + Intergenic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183327606 22:37202943-37202965 CAGCATCAGCATTATCAGAGGGG - Intergenic
1183404085 22:37621599-37621621 CAGCATCTGCAGAGACAGAGGGG - Exonic
1183630163 22:39027752-39027774 GAGCAGCAGAGGAACCAGAGGGG - Intronic
1183633593 22:39047621-39047643 GAGCAGCAGAGGAACCAGAGGGG - Intronic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1184085660 22:42262074-42262096 AAGCAGCAGGAGGGTCAGAGAGG + Intronic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184389821 22:44196898-44196920 GAGCAGGAGCAGAATCTCAGGGG + Intronic
1184559685 22:45254878-45254900 CAGCGGCAGCAGAATCAGCAGGG - Intergenic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185207533 22:49548726-49548748 CAGTAGCCCCAGATTCAGAGAGG - Intronic
1203296105 22_KI270736v1_random:44445-44467 CAGAAGCAGCACAGGCAGAGGGG - Intergenic
949934691 3:9107615-9107637 CAGCAGCAGCAGCATCACTTAGG + Intronic
950435676 3:12978321-12978343 CAGCAGCAGCAGCCTCAGCTGGG + Intronic
950716295 3:14850048-14850070 CAGCAGCTGGAGATTCACAGAGG - Intronic
950971502 3:17193179-17193201 CTGAAGCAGCACAATCAGCGAGG - Intronic
951592104 3:24277513-24277535 CAGCAGCATCAGCATCACCGGGG - Intronic
951995196 3:28719729-28719751 CAGCAGCAGCAGCATCACCTGGG - Intergenic
952157167 3:30655910-30655932 CAGCAGCAGCAGGATCACCCGGG + Intronic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
952859206 3:37798450-37798472 CAGCAGCATCAGCATCATGGGGG + Intronic
952933558 3:38377873-38377895 CAGCAGCTTCAGAGCCAGAGAGG - Intronic
953358770 3:42276938-42276960 CAGCTGCAGGTGAACCAGAGTGG + Intergenic
954222796 3:49164943-49164965 CAGCAGCTGGAGAAACAGATGGG - Intronic
954269356 3:49495539-49495561 CAGCCTCAGCAGAATCCAAGTGG - Intronic
956023903 3:64961804-64961826 CTACTGCAGCAGAATCAGATTGG - Intergenic
956054085 3:65279978-65280000 CAGAGGCATTAGAATCAGAGGGG - Intergenic
956522535 3:70121718-70121740 CACCAGCACCAGAAACACAGTGG - Intergenic
956609145 3:71104395-71104417 CAGCAGCAACAGCAGCAGAAGGG - Intronic
956812256 3:72875030-72875052 CAGCAGCAGCAGGATCTAACAGG + Intergenic
957710450 3:83851041-83851063 CAGGAGCAGTAAAATTAGAGAGG + Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
959094462 3:101938584-101938606 CTACAGCAGCAGGGTCAGAGGGG - Intergenic
959238428 3:103755784-103755806 AAGCAGCAGCAGAGTTTGAGAGG - Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959955352 3:112231802-112231824 CAGCAGCATCAGAATCACCTGGG + Intronic
960154483 3:114284456-114284478 AAGCAGCAGCAGGATTTGAGAGG - Intronic
960409979 3:117311056-117311078 AAGCAGATGCAGAAACAGAGAGG - Intergenic
960624108 3:119663482-119663504 TAGAAGCAGCAGGCTCAGAGAGG + Intronic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960949205 3:122988156-122988178 CAGCAGCAGCAGCATCACTTGGG - Intronic
961082997 3:124042501-124042523 AAGCAGCAGCAGAAATGGAGAGG + Intergenic
961087308 3:124079173-124079195 CAGCTGCAGAGGAAGCAGAGGGG + Intergenic
961370670 3:126427908-126427930 CAGCAGCAAGAGAATGGGAGTGG + Intronic
961410776 3:126718799-126718821 CTGCACCAACAGAACCAGAGGGG - Intronic
961763585 3:129190137-129190159 CTGAGGCAGGAGAATCAGAGCGG + Intergenic
961988117 3:131158689-131158711 CAGCAGCAGCAGAGACAGAATGG - Intronic
961994084 3:131222726-131222748 CAGCAGCATCAGCATCAGCTGGG + Intronic
962015467 3:131434802-131434824 CAGCAACAACAAAAACAGAGTGG + Intergenic
962469776 3:135695922-135695944 CAGCAGCATCAGCATTAGATAGG + Intergenic
962630751 3:137273075-137273097 CAGCCTCAGCAGAATAAAAGTGG + Intergenic
962654171 3:137525696-137525718 CAGCAGCTGCCAAGTCAGAGGGG + Intergenic
963733834 3:148996785-148996807 CAGCAGCACCAGACCCAGGGTGG + Exonic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964061407 3:152528672-152528694 AAGCAGCAGCAGAGTTTGAGAGG - Intergenic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
964605068 3:158552267-158552289 AAGCAGCAGCAGAATAGGAGGGG - Intergenic
964989124 3:162784952-162784974 CAGCAGCATCAGAATCATCTGGG + Intergenic
965230832 3:166050559-166050581 CAACAGAAGCATAATTAGAGTGG - Intergenic
965398103 3:168185222-168185244 CAGAAGGAGAAGATTCAGAGGGG - Intergenic
965656738 3:170994349-170994371 TAGCAGCAGATGGATCAGAGTGG + Intergenic
966027053 3:175296913-175296935 CAGGAGCAGAAGACTCAGAATGG + Intronic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
967572400 3:191045292-191045314 AAGCAGCAGCAGAATTTGAAAGG + Intergenic
967659603 3:192090707-192090729 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
967826962 3:193884746-193884768 AAGCAGCAGCAGAGTCAGCTGGG + Intergenic
968539564 4:1157551-1157573 AAGCAGCAGCAGAATTGGAGAGG - Intergenic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
970016767 4:11520671-11520693 CAGCAGCAGCACATTCAGCCTGG - Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970384120 4:15538872-15538894 CAGCAGCATCAGCATCACTGAGG + Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970491551 4:16580235-16580257 CAGCAGAGGCAGGATCACAGAGG + Intronic
970557952 4:17254440-17254462 CAGAAGCATTAGAATAAGAGTGG + Intergenic
970689609 4:18607415-18607437 CAGCAGCAGCGGCATCAGCTGGG - Intergenic
970884495 4:20971876-20971898 AAGCAGCAGCAGGATTTGAGAGG - Intronic
971395959 4:26227704-26227726 CAAGAGCAGCAGATTCTGAGAGG - Intronic
971481361 4:27117618-27117640 CAGCAGCAGAAGAGTCCCAGAGG - Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972835248 4:42862573-42862595 CAGCAGCAGCAGAGTCCAGGCGG - Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974201462 4:58646793-58646815 AAGCAACAGCAGTATCACAGTGG + Intergenic
975752262 4:77536047-77536069 CACCAGCAGAAGATTGAGAGAGG - Intronic
975940741 4:79642516-79642538 CTGCAGCATCAGAATGTGAGAGG + Intergenic
976938598 4:90671335-90671357 AAGCAGCAGCAGAGTTTGAGAGG - Intronic
976991693 4:91375375-91375397 AAGCAGCAGCAAAATTTGAGAGG + Intronic
977314402 4:95427328-95427350 AAGCAGCAGCAGAGTATGAGAGG + Intronic
977320009 4:95501944-95501966 CAGCCACAGCAGAAGAAGAGAGG + Intronic
977578663 4:98701336-98701358 AAGCAGCAGCAGAGTGCGAGGGG - Intergenic
977862560 4:101982079-101982101 CAGCTGCAGCAGACCCAGGGAGG - Intronic
978885356 4:113761467-113761489 CAGGAGGAGTAGAAGCAGAGGGG + Intronic
978923777 4:114217731-114217753 CAGCAGCAGCATAGGCAGTGTGG - Intergenic
979471889 4:121108705-121108727 CAGCAGCAGCAACATCAGCTGGG - Intergenic
979976657 4:127205076-127205098 CAGCCACATCAAAATCAGAGTGG - Intergenic
979980594 4:127249757-127249779 GAGAAGCAGCACAATTAGAGAGG + Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
982635822 4:157895478-157895500 AAGCAGAGCCAGAATCAGAGGGG + Intergenic
983188444 4:164728076-164728098 AAGCAGGAGCAGGCTCAGAGGGG - Intergenic
984473863 4:180213045-180213067 CAGCAGCAGCAGAATAAAAGAGG - Intergenic
984538850 4:181011904-181011926 CAACAGCAGAAGAAACAGATGGG + Intergenic
985369501 4:189270572-189270594 AAGCAGCAGCAGGGTTAGAGAGG + Intergenic
985506326 5:283109-283131 TCGTAGCTGCAGAATCAGAGAGG + Intronic
986329958 5:6710779-6710801 CAGCAACACCAGAAGCTGAGAGG + Intergenic
986466924 5:8034997-8035019 GAGCAGCAGCAGCACCAGGGAGG + Intergenic
987095767 5:14548016-14548038 CAGCAGCAGCAGGGTTTGAGAGG - Intergenic
987209780 5:15669011-15669033 CAGCAGCAGCAGAAACAATAAGG - Intronic
987385839 5:17328530-17328552 CAGCAGCAGCAGCATCACCTGGG - Intergenic
988387528 5:30585115-30585137 CACCATAAGGAGAATCAGAGAGG - Intergenic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
990522959 5:56597287-56597309 AAGCAGCAGCAGAGTTTGAGAGG - Intronic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
991077653 5:62559455-62559477 AAGCAGCAGCAGAATCTGAGAGG - Intronic
991089847 5:62683800-62683822 GAGCACAGGCAGAATCAGAGAGG - Intergenic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
993021536 5:82597533-82597555 AAGCAGCAGCAGGATTAAAGAGG + Intergenic
994082023 5:95717602-95717624 CAGAGGCAGCAGAATGAGACAGG - Intronic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994559408 5:101347783-101347805 CAGCTGCAGCAAAAGCAGATGGG - Intergenic
994662212 5:102667618-102667640 CAGTAGCAGCAAAATGAGATTGG + Intergenic
994807770 5:104473878-104473900 AAGCAGCAGCAGGATTTGAGAGG - Intergenic
994961209 5:106604995-106605017 AAGCAGCAGCAGGATCTGAGAGG + Intergenic
995604351 5:113835373-113835395 CTGCAGCAGTAAAATCACAGGGG + Intergenic
995879652 5:116830124-116830146 CAGCAGCAGCAGATTCTGGCAGG - Intergenic
996398321 5:123035046-123035068 GAGCAGCAGCGGAATCACACAGG - Intronic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996581389 5:125035889-125035911 GAGCAGCATCAGAAGCGGAGGGG + Intergenic
997001064 5:129762594-129762616 CAGCAGCAGCACAATCAGTCAGG + Intronic
997017136 5:129949175-129949197 CAGCAGCAACAAAATAATAGTGG + Intronic
997163100 5:131629993-131630015 AAGCAGCAGCAGAATTTGGGAGG + Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997743327 5:136277102-136277124 CAGCAGCAGAAGCATGGGAGAGG - Intronic
997801718 5:136869437-136869459 CAGAAGCAGCTGACTCATAGAGG + Intergenic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998182336 5:139954251-139954273 CAGCAGCAGCCAAGCCAGAGAGG + Intronic
998510493 5:142709855-142709877 CAGAAGCAGCAGCATTTGAGAGG + Intergenic
999257012 5:150215349-150215371 GTGAAGCAGCAGATTCAGAGGGG - Intronic
999363620 5:151006824-151006846 CAGCAGCAGCACAATCAGTGGGG - Intergenic
999897412 5:156050072-156050094 AAGCAGCAGCAGGATTTGAGAGG + Intronic
1000195520 5:158953766-158953788 CAGGAGCCCCAGAATCAAAGAGG + Intronic
1000782537 5:165500563-165500585 AAGCAGCAGCAGCATTTGAGAGG - Intergenic
1001084275 5:168689187-168689209 CAGCAGCATCAGCATCACATGGG - Intronic
1001236171 5:170031422-170031444 CAACAGGAGCAGAAGCAGTGTGG + Intronic
1001647958 5:173296199-173296221 CAGCAGCTGGAAAATCAGACTGG - Intergenic
1001664511 5:173421392-173421414 CAGTACCAGCAGACCCAGAGAGG - Intergenic
1001854859 5:175002305-175002327 CAGCAATTACAGAATCAGAGTGG - Intergenic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003564920 6:7214709-7214731 CAGAGGCAGCAGAACCACAGTGG + Intronic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003897318 6:10619918-10619940 CAGCAAAGGCAGAGTCAGAGTGG + Intronic
1004177150 6:13349822-13349844 CAGCAGCATCAGCATCACATAGG - Intergenic
1004753131 6:18583916-18583938 TATCAGCAGCAGAGGCAGAGAGG + Intergenic
1004997665 6:21209758-21209780 CAGCAGCAGCAGAACCTGAAAGG + Intronic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1005563608 6:27066779-27066801 CACAAGCAGCAGAATCATTGGGG + Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006171400 6:32095464-32095486 CAGGGGCAGCAGAACCACAGGGG - Intronic
1006871335 6:37254987-37255009 CAGCAGCAGCAGATTCTCACAGG - Intronic
1006911361 6:37565773-37565795 CGGCAGCAGCAGCCTCAGGGAGG - Intergenic
1007276702 6:40679454-40679476 CATCAGCAGAAGAATCAGGGAGG + Intergenic
1007339920 6:41184885-41184907 CAGCAGCAGCAGCAGCACAACGG + Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007379907 6:41482222-41482244 AAGCAGCAGCAAAATTTGAGAGG + Intergenic
1007558871 6:42789078-42789100 AAGCAAGAGAAGAATCAGAGTGG + Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1008399679 6:51050086-51050108 CAACAGCAGAAGAATCTGTGAGG - Intergenic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1009573639 6:65423568-65423590 CAGCAGCATCAGAATCACCTGGG - Intronic
1009621556 6:66084647-66084669 CAGCAGGAGCAGCAGCACAGTGG + Intergenic
1010397227 6:75406327-75406349 CAACATGAACAGAATCAGAGTGG - Intronic
1011016912 6:82767153-82767175 CAGCAGCAGCAGCATCACCTGGG + Intergenic
1011019902 6:82801336-82801358 AAGCAGCAGCAGCATTTGAGAGG + Intergenic
1011071778 6:83393020-83393042 CAGCACCAGTAGAGGCAGAGAGG - Intronic
1011178482 6:84591633-84591655 AAGCAGCAGCAGAATTTGAGAGG - Intergenic
1011292464 6:85790923-85790945 CAGCTGAAGGAGTATCAGAGTGG + Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011610397 6:89145785-89145807 CCACAGCAGCAGAATGAGAACGG - Intergenic
1012092887 6:94921208-94921230 AAACAGCAGCAGAATTTGAGAGG + Intergenic
1012100325 6:95076353-95076375 TACCAGCAGCAGAATCTGGGTGG - Intergenic
1012228963 6:96737737-96737759 CAGCAGCAGCAGGGCTAGAGGGG + Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012616424 6:101284132-101284154 CAGCAGAAGCAGTGGCAGAGAGG - Intergenic
1012797435 6:103780417-103780439 CAGCAGCATCAGCATCAGTTAGG - Intergenic
1013007598 6:106088353-106088375 CATCAGCACCAGAATCCCAGGGG - Exonic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013437210 6:110122519-110122541 CAGGAGTAGCAGAGGCAGAGAGG - Intronic
1013618470 6:111866907-111866929 CAGCATCAGGAGAACTAGAGGGG - Intronic
1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG + Intergenic
1014066714 6:117135483-117135505 CAGCAGCATCAGAATCACCAGGG - Intergenic
1014171264 6:118281607-118281629 CAGCAGGGGTAGAATCACAGAGG - Intronic
1014307266 6:119758122-119758144 CAGCAGTGGCATAACCAGAGTGG + Intergenic
1015277521 6:131399555-131399577 CAGAATCAGCAGATTCACAGAGG + Intergenic
1016334539 6:142990377-142990399 TAGGAGCAGCATAATCATAGAGG - Intergenic
1016343948 6:143090948-143090970 AAGCAGCAGCAGGATCTGAGAGG - Intronic
1017869352 6:158473751-158473773 CTGAAGCAGGAGAATCAGTGAGG - Intronic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018858013 6:167689289-167689311 CAACAGTCTCAGAATCAGAGGGG + Intergenic
1019032297 6:169024112-169024134 AATCAGCAGCAGAAGCAGAGGGG + Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019822448 7:3255362-3255384 AAGCAGCAGCAGAGTTTGAGAGG + Intergenic
1019869525 7:3746521-3746543 AAGCAGCAGCAGGATTTGAGAGG - Intronic
1020011209 7:4806814-4806836 CAGCACCTGCAGAATCCGAAGGG - Intronic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020079702 7:5280924-5280946 CAGCAGCAGAGGAAGGAGAGGGG + Intronic
1020423431 7:8036062-8036084 CAGCTACAGCAGAAGCAGATGGG - Intronic
1020760429 7:12262043-12262065 CAGAAGCAGCAGAAGAAAAGTGG + Intergenic
1020833438 7:13119916-13119938 AAGCAGCAGCAGGATTTGAGAGG + Intergenic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021341540 7:19469225-19469247 CAGTAGGAGCAGTATCAGAGTGG - Intergenic
1021386523 7:20037620-20037642 CAGCAGGGTCAGAGTCAGAGAGG + Intergenic
1021429412 7:20543185-20543207 CAGCAGCAGCAGCATCACCTTGG + Intergenic
1021561361 7:21971859-21971881 GAGCAGCAGCTGCAGCAGAGAGG - Intergenic
1021568280 7:22036512-22036534 CAGCAGCATCAGCATCACATGGG - Intergenic
1021570149 7:22056915-22056937 CAGCAGCAGCAGCATCACCTGGG - Intergenic
1021614096 7:22485118-22485140 AAGCAGTAGCAGGATCTGAGAGG + Intronic
1022163070 7:27731388-27731410 CAGAAGAAGCAGAAACAGAGAGG - Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022226723 7:28371168-28371190 CAGCAGCAGAAGATTCAGGGAGG + Intronic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022480195 7:30738612-30738634 CAGCAGCAGCAGCATCACCAGGG - Intronic
1022499689 7:30874710-30874732 CAGCAAGAACAGAAGCAGAGAGG - Intronic
1022970226 7:35510405-35510427 CAGCAGCATCAGAATCACCTGGG - Intergenic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1023962139 7:44935730-44935752 CACCACCTGCAGACTCAGAGGGG - Intergenic
1025199202 7:56951279-56951301 CAGCAGCAGAGGAAGGAGAGGGG - Intergenic
1025672744 7:63625654-63625676 CAGCAGCAGAGGAAGGAGAGGGG + Intergenic
1025819499 7:64948855-64948877 CAGCAGTAGCAAAAACAAAGGGG + Intergenic
1026173993 7:67979726-67979748 CAGCAGCAGGAGAAGCATGGAGG - Intergenic
1026402368 7:70027498-70027520 CAGCAGCAGCAGCATCACCTGGG + Intronic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028176952 7:87671300-87671322 CTGCAGCGGCAGTCTCAGAGAGG + Intronic
1028661033 7:93275242-93275264 AAGCAGCAGCAGGGTCTGAGAGG + Intronic
1028927767 7:96378159-96378181 CAGGAGCAGGAGAGACAGAGAGG + Intergenic
1029152136 7:98488210-98488232 GAGCAGCAGCAGAACCTGGGGGG + Intergenic
1029207368 7:98878000-98878022 AAGCAGCTGCAGAATCAATGGGG + Intronic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1032121944 7:129162849-129162871 CAGCTGCAGCAGGAACACAGCGG - Exonic
1032146807 7:129390602-129390624 CAGCTCCAAGAGAATCAGAGAGG - Intronic
1032180760 7:129675013-129675035 AAGCAGCAGCAGAGTTGGAGGGG - Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033280924 7:140005901-140005923 CAGCAGCAGCAGCATCACCCGGG - Intronic
1033673015 7:143511272-143511294 CAGCAGCAGCAGCACCAGGCAGG + Intergenic
1033765693 7:144488052-144488074 CAGCAGCAGCAGCATCCCTGGGG + Intronic
1034010429 7:147523623-147523645 AAGCTGCTGCAGAAGCAGAGAGG - Intronic
1034066876 7:148145432-148145454 TAGCAGTAGGAGAATCACAGAGG + Intronic
1034219439 7:149432647-149432669 CAGCAGCAGCGGAACCGGCGCGG - Exonic
1034331530 7:150287352-150287374 CAGCAGCAGCAGCATCCTGGCGG - Intronic
1034426346 7:151016201-151016223 CAGCAGCAGCAGGAGCCGTGGGG - Exonic
1034666513 7:152822509-152822531 CAGCAGCAGCAGCATCCTGGCGG + Intronic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035140588 7:156756285-156756307 TAGCAGCACAAGATTCAGAGAGG + Intronic
1036422127 8:8606854-8606876 CAGCAGCAGCAGCATCACCTGGG - Intergenic
1036478030 8:9111599-9111621 CAGCAGCGGCAGGATTTGAGAGG - Intronic
1036690782 8:10943489-10943511 CAGCAGGAGCAGATACAGAGAGG - Intronic
1037292523 8:17366439-17366461 CAGCATCAGCAGAATGGGAAGGG + Intronic
1037581962 8:20250695-20250717 CTGAGGCAGGAGAATCAGAGGGG - Intronic
1037944013 8:22975205-22975227 CACCAAGAGCAGCATCAGAGGGG - Intronic
1038156536 8:24996687-24996709 CAGGAGCACCAGCATCAGACTGG - Intergenic
1039757687 8:40540806-40540828 AAACAGAATCAGAATCAGAGAGG - Intronic
1040083858 8:43318509-43318531 CAGCAGCAGCACCATCAGTCAGG - Intergenic
1041802193 8:61812444-61812466 CAGCAGCATCAGAAAGAGGGTGG - Intergenic
1042841484 8:73128501-73128523 AAGCAGCATCAGAATTTGAGAGG + Intergenic
1043031010 8:75133500-75133522 CAGCAGCATCAGAAGCACAAGGG - Intergenic
1043275813 8:78391307-78391329 AAGCAGCAGCAGAGTTTGAGAGG + Intergenic
1043305189 8:78785066-78785088 CAGTTGGAGGAGAATCAGAGTGG - Intronic
1043671815 8:82895873-82895895 CTGCAGAATCAGGATCAGAGGGG + Intergenic
1043925436 8:86031174-86031196 GAGCAGAAGCAAAACCAGAGAGG + Intronic
1044032996 8:87261454-87261476 AAGCAGCCCCAGAATCACAGTGG + Intronic
1045158168 8:99503524-99503546 CAGCAGCAGCAAAGTTTGAGAGG - Intronic
1045232816 8:100321238-100321260 AAGCAGCAGCAGAGTTTGAGAGG - Intronic
1045339890 8:101244218-101244240 CAGCAGCTTCAGAATCACATGGG - Intergenic
1045388634 8:101693585-101693607 CAGCAGCATCAGCATCACACCGG - Intronic
1045438700 8:102189175-102189197 CAGCAGCATCAGCATCACCGTGG - Intergenic
1045491309 8:102671360-102671382 AAGCAGGAGGAGGATCAGAGGGG - Intergenic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1047021348 8:120777930-120777952 CAGCAGCAGCAGAAACACTTTGG + Intronic
1047048666 8:121083870-121083892 AACCTGCAGCAGAAACAGAGTGG + Intergenic
1047412420 8:124634770-124634792 CAGCAGCAGCAGAATCACCTGGG + Intronic
1047645527 8:126866118-126866140 CAGCAGCATCAGCATCAGCTGGG - Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048047404 8:130785850-130785872 CAGCTGGAGCAGAGTGAGAGAGG - Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048859659 8:138714670-138714692 CAGGAGCAGCACAATCAAAATGG - Intronic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1050077744 9:1882349-1882371 CAGCAGCTACAAAATCACAGTGG - Intergenic
1050559689 9:6821939-6821961 AAGCAGCAGCAGAATAAAAGAGG - Intronic
1051253346 9:15185503-15185525 CAGCAGCAGCAGCATCACCTGGG + Intronic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052586800 9:30439826-30439848 CTGCAGCAGCATAATCCGTGGGG - Intergenic
1052688828 9:31789072-31789094 AAGCAGCAGCAGGATTTGAGAGG + Intergenic
1052695321 9:31870194-31870216 CAGCAATATCAGCATCAGAGAGG + Intergenic
1053020930 9:34693453-34693475 CAGCAGCAGCAGCATCACTTGGG + Intergenic
1053279453 9:36808388-36808410 CAGCCCCAGCAGAACCAGATGGG - Intergenic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1054716635 9:68563535-68563557 CGGCAGCAGCAGCATCAGCTGGG + Intergenic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055434936 9:76283183-76283205 AAGTAGCAGCAGAATTTGAGAGG + Intronic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056204979 9:84311131-84311153 CAGCAGAAGCACAATCACAGTGG - Intronic
1056227378 9:84509284-84509306 AAGCAGCAGCAGGATTTGAGAGG + Intergenic
1056808849 9:89748896-89748918 CAGCTGCAGGAAACTCAGAGAGG + Intergenic
1057061529 9:92008146-92008168 CTGCAGTAGCAGTTTCAGAGAGG + Intergenic
1057077539 9:92146610-92146632 CAGGAGCAGGAGACTCAAAGAGG - Intergenic
1057984604 9:99699413-99699435 AAGCAGCAGCAGATTTTGAGAGG + Intergenic
1058000171 9:99856830-99856852 CAGCAGCATCAGCATCACTGGGG - Intronic
1058111360 9:101033762-101033784 CTGAAGCAGCTGAAACAGAGAGG + Intronic
1058186671 9:101863584-101863606 CAGCACAAGCAGAAGCATAGAGG - Intergenic
1058427638 9:104889181-104889203 CAGCAGCAGCTGACACTGAGTGG + Exonic
1059134148 9:111787709-111787731 AAGCAGCAGCAGAGTTTGAGAGG + Intronic
1059249633 9:112877114-112877136 CAGCAGCAGCAGCATCACCTGGG - Intronic
1060018365 9:120106993-120107015 CAGCAGCATCAGTATCACATGGG + Intergenic
1060913979 9:127373707-127373729 AAACAGCAGCAAAATCAAAGTGG - Intronic
1060970883 9:127737192-127737214 CAGCAGCAGCAGAGTGGGAAAGG - Intergenic
1061483055 9:130906596-130906618 CAGCAGCAGGAGAGTCAGGGAGG - Intronic
1062067576 9:134537073-134537095 CAGCAGGGGCAGAATCGGTGGGG + Intergenic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062164027 9:135096665-135096687 CAGCAGCTGCAGAATGACAAGGG - Intronic
1062309156 9:135926659-135926681 CAGCACCAGCTGAAGGAGAGAGG - Intergenic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1203522528 Un_GL000213v1:56866-56888 CAGCACCAGGAGCATCAAAGTGG - Intergenic
1203377450 Un_KI270442v1:387224-387246 AAGCAGCAGCAGGATTTGAGAGG + Intergenic
1186145175 X:6617588-6617610 CAGCAGCAAGAGAGCCAGAGGGG - Intergenic
1186199488 X:7142612-7142634 CAGCAGCAGCAGAGTTTGAGAGG + Intronic
1186285032 X:8033978-8034000 GGAGAGCAGCAGAATCAGAGAGG - Intergenic
1186454629 X:9701408-9701430 CTGCAGGAGCTGACTCAGAGTGG + Intronic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186495283 X:10008111-10008133 CAGCAGCGGCAGCATCACGGGGG - Intergenic
1186890909 X:13958254-13958276 CAGCAGCAACAGTATCAGCTGGG + Intergenic
1187023290 X:15406785-15406807 CAGCAGCAGAAGGGACAGAGCGG - Intronic
1188154414 X:26723090-26723112 CAGCAACATCAGAGTCAGATGGG - Intergenic
1188643793 X:32538693-32538715 CAGTAGCAGCAGAATCACGTGGG + Intronic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1189072551 X:37879582-37879604 GAGCAGCAGCAGAGTTTGAGAGG + Intronic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189105791 X:38233903-38233925 AAGCAGCAACAGAATCAGTAAGG - Intronic
1189613703 X:42763871-42763893 CAGCAGCAGAAGGTTCAGACAGG - Intergenic
1189875044 X:45427535-45427557 CAGCAGCACCAGAATCACTTGGG - Intergenic
1190133935 X:47777104-47777126 CAGCAGCAGCAAATTCACACAGG - Intergenic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1191666239 X:63705718-63705740 CAGCAGCATCAGAATCACCAGGG + Intronic
1191813895 X:65222170-65222192 CAGCAGCAGCAGCATAGAAGGGG + Intergenic
1192307805 X:69981973-69981995 CAGCAGCATCTGAAGCATAGTGG + Intronic
1193824347 X:86204782-86204804 CAGCAGCAGCTCAATCGGATGGG + Intronic
1193971367 X:88058397-88058419 AAGCAGCAGCAGGATTTGAGAGG + Intergenic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1195454373 X:105051477-105051499 CAGCTGCAGCTGCATCCGAGAGG + Intronic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196748474 X:119093272-119093294 CCTCAGCAGCAGAACCAGAAAGG - Intronic
1196804469 X:119572340-119572362 CAGCAACAGCAGAACCAGAACGG - Intergenic
1197707196 X:129642632-129642654 CAGCAGCATCAAACTCAAAGAGG + Intergenic
1197902841 X:131392540-131392562 CAGCAGCATCTGATTCAGGGAGG - Intronic
1198502647 X:137267315-137267337 CAGCAGCATCAGCATCAGCTGGG - Intergenic
1198737284 X:139800594-139800616 CAGCAGCAGCAGCATTACTGGGG - Intronic
1199681250 X:150225960-150225982 CAGCAGCGGCAGCATTAGGGAGG + Intergenic
1199766358 X:150944485-150944507 CAGCAGCATCAGCATCACATGGG - Intergenic
1199781208 X:151061690-151061712 CAGCAGGAGCAGAAACATGGTGG - Intergenic
1199788686 X:151129451-151129473 AAGCAGCAGCAGAATTTGAAAGG - Intergenic
1199891999 X:152094343-152094365 CAACAGCAGGAGATTGAGAGAGG + Intergenic
1200105660 X:153710628-153710650 CAGCAGCAGCAGACTATGGGGGG + Intronic
1201146848 Y:11069493-11069515 GAGCAGGGGCAGAATCAGTGTGG - Intergenic
1202340597 Y:23861006-23861028 CAGCAGCAGCCCATTTAGAGAGG + Intergenic
1202530169 Y:25809076-25809098 CAGCAGCAGCCCATTTAGAGAGG - Intergenic