ID: 919814098

View in Genome Browser
Species Human (GRCh38)
Location 1:201426847-201426869
Sequence CAGCCCCACATGAAGGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919814093_919814098 12 Left 919814093 1:201426812-201426834 CCAAAAGCTGTCACCCTCAATTT 0: 1
1: 0
2: 1
3: 21
4: 197
Right 919814098 1:201426847-201426869 CAGCCCCACATGAAGGTTTGTGG 0: 1
1: 0
2: 0
3: 15
4: 125
919814095_919814098 -2 Left 919814095 1:201426826-201426848 CCTCAATTTTTCACCACAAATCA 0: 1
1: 0
2: 1
3: 22
4: 262
Right 919814098 1:201426847-201426869 CAGCCCCACATGAAGGTTTGTGG 0: 1
1: 0
2: 0
3: 15
4: 125
919814094_919814098 -1 Left 919814094 1:201426825-201426847 CCCTCAATTTTTCACCACAAATC 0: 1
1: 0
2: 0
3: 19
4: 232
Right 919814098 1:201426847-201426869 CAGCCCCACATGAAGGTTTGTGG 0: 1
1: 0
2: 0
3: 15
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919814098 Original CRISPR CAGCCCCACATGAAGGTTTG TGG Intronic
903366448 1:22808240-22808262 CAGCACCGCATTCAGGTTTGGGG - Intronic
904377754 1:30092507-30092529 CTGCCCAAATTGAAGGTTTGAGG + Intergenic
906318895 1:44804765-44804787 CAGCACCTCATGAAGGTGTGAGG + Exonic
907032444 1:51185776-51185798 CAGACCTACATTAAAGTTTGAGG + Intergenic
907233752 1:53025612-53025634 CACCCCCACAGCAAGGCTTGTGG + Intronic
908058687 1:60322635-60322657 AAGTCCCACATAAATGTTTGTGG - Intergenic
910528591 1:88210109-88210131 ATGCCCCAGATGAAGTTTTGTGG - Intergenic
912796588 1:112697118-112697140 CAGTCCCAGATGAAGTTTTCAGG + Intronic
916749844 1:167714155-167714177 TATCCCCAAATGAAGGTTCGGGG + Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919814098 1:201426847-201426869 CAGCCCCACATGAAGGTTTGTGG + Intronic
919816830 1:201446423-201446445 GACCCCCACATGAAGCTTAGGGG + Intergenic
920670280 1:207998844-207998866 GAGCCCCACAGGGAGGTCTGTGG - Intergenic
923226374 1:231942112-231942134 ATGCCCCACCTGAAGGTTTTGGG + Intronic
923533157 1:234827658-234827680 GAGCCCCACATGCAGCTGTGGGG + Intergenic
1063241653 10:4175812-4175834 CAGGCCCACATGGAGGTCTGTGG - Intergenic
1067334871 10:45352701-45352723 TATCCCCACAACAAGGTTTGTGG - Intergenic
1068842671 10:61632606-61632628 AAGCCCCAAATGAAGGCTTTTGG - Intergenic
1070537178 10:77388321-77388343 CAGCCCCACCAGGAGCTTTGTGG - Intronic
1073317606 10:102593779-102593801 GAGCCCCACATGGAGGGTAGTGG - Intronic
1076212235 10:128657944-128657966 CAGCCCAAAAGGAAGGTCTGAGG - Intergenic
1079650066 11:22916693-22916715 CAGCCTCACATGAACGCTTTTGG - Intergenic
1091461164 12:644229-644251 CAGGCCCACATTTAGGTTTGAGG - Intronic
1096271147 12:50167254-50167276 CAGCCCCACAGCAAGCTTAGGGG + Exonic
1097880046 12:64678677-64678699 CAGCCCCACAAGAGGTTTTTGGG - Intronic
1099700413 12:86075725-86075747 CAGCACCACGTGCAGGCTTGGGG + Intronic
1110720427 13:78754955-78754977 CCGACCCATATAAAGGTTTGAGG + Intergenic
1110730072 13:78870101-78870123 TAGCCACAAATGAAAGTTTGTGG + Intergenic
1111270077 13:85869938-85869960 CAGCCCCACAAAAAGTTTAGTGG - Intergenic
1113477738 13:110597129-110597151 CAGCACCACATGCACGTGTGAGG + Intergenic
1113587289 13:111474195-111474217 CAGCCCCACATCAAAGTTGCAGG - Intergenic
1115980563 14:39047231-39047253 AAGCCCAACAAGAAGGCTTGAGG + Intronic
1117799328 14:59427157-59427179 AAGCCCAACATGAAGGGGTGTGG - Intergenic
1126279132 15:46922575-46922597 TAGCCCCACATGAAAGATTAAGG - Intergenic
1128240249 15:66096619-66096641 CAGGCCCACAAGAAGGTCAGTGG + Intronic
1130720589 15:86382240-86382262 CAGACCCGCAGGAAGGTTTTAGG + Intronic
1131894353 15:97009398-97009420 GAGCCGGACATGAAGGTTTATGG + Intergenic
1133102084 16:3485799-3485821 CAGCCCCTCATGGAGGAGTGGGG - Exonic
1134881760 16:17750922-17750944 GAGCCCCAAATCCAGGTTTGTGG - Intergenic
1134899288 16:17921502-17921524 CAGCCCCACCTGATGGCTTTTGG - Intergenic
1137495429 16:48965664-48965686 CAGCCCAAAATGAAGGCTGGAGG + Intergenic
1140553753 16:75895919-75895941 CAGCCACACATAAGGGTGTGAGG - Intergenic
1140564356 16:76023764-76023786 GAGACACACATGAAGGTTTCGGG + Intergenic
1142595338 17:1027065-1027087 CAGCCACACCTGCAGGCTTGGGG + Intronic
1148634143 17:49134077-49134099 CAGTCACCCATGAAGGATTGTGG - Intronic
1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG + Intergenic
1152563628 17:81090677-81090699 CAGCCCCACATCGGAGTTTGAGG + Intronic
1156397081 18:36707970-36707992 CTGCCACACATGAAGGCTGGAGG - Intronic
1158670246 18:59467971-59467993 CAGCATCACATGTAGGTTTAGGG - Intronic
1162156838 19:8684242-8684264 CAGCCCCACAACACGGCTTGTGG - Intergenic
1162247361 19:9412987-9413009 CATACACACATTAAGGTTTGTGG + Exonic
925037959 2:706337-706359 GAGGCCCACCTGAAGGTCTGTGG + Intergenic
926152879 2:10434590-10434612 CAGCCCCACAGGAGGGGTGGCGG + Intergenic
926207068 2:10841352-10841374 CATCCCCTCCTGAAGGTCTGGGG - Intergenic
926551515 2:14307083-14307105 CAGACCCACATGATGTTTTAAGG + Intergenic
934109463 2:88728567-88728589 CATTCAAACATGAAGGTTTGAGG + Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
936032176 2:109081359-109081381 CAGCCCCCCATGCAGGGATGGGG + Intergenic
937888408 2:126916121-126916143 CAGACCCACATGACGCTCTGAGG + Intergenic
939562910 2:143752760-143752782 CAGACCCACAGGAAGCTCTGGGG + Intronic
943463817 2:188203643-188203665 CAGCCACACAGAAAGATTTGTGG - Intergenic
947847780 2:233259380-233259402 CAGGCCCAGTTGAAGGGTTGGGG + Intronic
948322917 2:237085420-237085442 CTGCCCAACAAGCAGGTTTGCGG + Exonic
948660512 2:239503627-239503649 AAGCCCCACATGGAGTTCTGTGG - Intergenic
1169037685 20:2467160-2467182 CAGCTCCCCATGTGGGTTTGGGG - Intronic
1171368704 20:24646147-24646169 AAGCCCCACATGCAGCTCTGAGG + Intronic
1178499778 21:33116087-33116109 CAGCTCCACATGGAGCTCTGCGG + Intergenic
1182146453 22:27999594-27999616 GAGCCACACATGAAGGTCTGTGG - Intronic
1183619925 22:38966347-38966369 CAGCCACACAGGAAGAGTTGGGG + Intronic
1184372212 22:44089788-44089810 CTGAACCCCATGAAGGTTTGAGG - Intronic
949162684 3:900229-900251 CATCCCCACAAAAAGGGTTGTGG + Intergenic
950739495 3:15038868-15038890 CAGCCCCACATGATTGGTTCTGG - Intronic
951634414 3:24757227-24757249 CAGGACCACATGAAGTTTTCTGG - Intergenic
953999081 3:47542124-47542146 CAGCCACAGATGGAGGTCTGGGG + Intergenic
955057906 3:55472545-55472567 CAGAGCCACATGAAAATTTGGGG - Intronic
956020196 3:64925811-64925833 CAGGCCCAGGTGAAGCTTTGTGG - Intergenic
960373518 3:116870227-116870249 GAAAACCACATGAAGGTTTGAGG - Intronic
961474423 3:127137718-127137740 GAGCCCGAGATGAGGGTTTGAGG - Intergenic
964126022 3:153234369-153234391 TTGCCCAAAATGAAGGTTTGTGG + Intergenic
967882223 3:194309855-194309877 CAGCCCTCCATGAAGCTTCGTGG + Intergenic
968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG + Intergenic
971309797 4:25515395-25515417 CAGCACCATATCAAGGTTAGGGG + Intergenic
972093531 4:35318757-35318779 CAGCCCAAAATGTAGATTTGAGG + Intergenic
973044747 4:45521823-45521845 TATCCACACATGAAGATTTGGGG - Intergenic
979385024 4:120054563-120054585 CAGCCCTAAATTGAGGTTTGGGG + Intergenic
985669971 5:1202066-1202088 GAGCCCCACACGAAGTCTTGGGG - Intronic
985992438 5:3574758-3574780 CAGTCCCACATGAGGGTGTTGGG - Intergenic
988704747 5:33714003-33714025 CAAGCCCACATGAAGATTTCAGG - Intronic
988820753 5:34882534-34882556 GAGCCTCACATGAAGCTTGGAGG - Intronic
993126666 5:83844165-83844187 CAGACCCACATGTAGATGTGGGG + Intergenic
999144817 5:149385504-149385526 CAGCCCCACATGGGGGCCTGAGG - Intronic
999372990 5:151067590-151067612 CAACACCACATGAAGGCATGGGG + Intronic
1001759320 5:174194501-174194523 CACCCCCACATGGAGGATTTCGG + Intronic
1001770876 5:174294993-174295015 CTGACTCACACGAAGGTTTGTGG + Intergenic
1004303100 6:14476188-14476210 CAGAGGCACATAAAGGTTTGGGG + Intergenic
1008231159 6:48986430-48986452 CAACCCAACATGAAGTTTTCTGG + Intergenic
1012056232 6:94414317-94414339 CAGACCTAAATGAAGGTGTGTGG + Intergenic
1012741716 6:103024433-103024455 TAGCTCCATATTAAGGTTTGAGG - Intergenic
1013311398 6:108897707-108897729 CAGCACCATTTGATGGTTTGAGG + Intronic
1015885297 6:137911590-137911612 CAGCCCCCCATGAAGGTCATGGG - Intergenic
1023105086 7:36756029-36756051 CTGCCACACAGGCAGGTTTGGGG + Intergenic
1023447971 7:40251592-40251614 CACTCCCACATGAAGGTACGTGG + Intronic
1026681096 7:72467259-72467281 CAGCCCCACCAGCAGGATTGGGG - Intergenic
1028231191 7:88307685-88307707 CAACCCCACAAGAAGCTATGAGG - Intergenic
1029364003 7:100105873-100105895 CAGCCCCACATGGAGGTCCCTGG + Intronic
1029413914 7:100431290-100431312 CATCCTCACAGGAAGGATTGCGG - Exonic
1033170650 7:139080723-139080745 CAGCCCCACCTAAAAGTTTTGGG - Intronic
1035031797 7:155865695-155865717 GAGCCCAAAATGAGGGTTTGGGG + Intergenic
1035495300 7:159320136-159320158 CAGCCCGACATGACTGCTTGTGG + Intergenic
1035867161 8:3097282-3097304 CTGCCCCAAATTAAGGTGTGTGG - Intronic
1036085153 8:5605679-5605701 AACCCCAACATGAAGGTCTGTGG + Intergenic
1036899065 8:12658373-12658395 AAGCCACACAGGAAGATTTGGGG + Intergenic
1037142886 8:15539797-15539819 CAGCCCCACTGGAAGGCCTGAGG - Intronic
1038284140 8:26191808-26191830 CTGTCCCACATGCAGGTGTGTGG - Intergenic
1039890241 8:41680999-41681021 CAGCCACACATATTGGTTTGGGG + Intronic
1042430754 8:68703703-68703725 CAACCCCACAAGAATTTTTGAGG - Intronic
1042774850 8:72419229-72419251 CTGCCCTACATGAAGGGTTGGGG - Intergenic
1047991340 8:130289729-130289751 CAGCCCCAGCTAAAGGATTGTGG - Intronic
1048267435 8:132999867-132999889 AAGACCCACATAAAGGATTGAGG - Intronic
1049430718 8:142562875-142562897 AAGCCCCACAGGAGGGTTTAGGG + Intergenic
1052268342 9:26600417-26600439 CAGCCTCACATGAAAGTCTCAGG - Intergenic
1052511134 9:29422253-29422275 AATCCCCACATGAAGTTTTAAGG + Intergenic
1052799532 9:32955495-32955517 CAGCCCCACTAGAAGCTTTGAGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053420130 9:37972144-37972166 CAGCACCACAGGCAGGTGTGGGG - Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1058872997 9:109218591-109218613 CAGTGCCACATAAAGGATTGTGG - Intronic
1059745281 9:117194161-117194183 AAGGCCCACATGAGGGTTTTAGG - Intronic
1060146986 9:121261412-121261434 CAGCCCCACATGAAAGGCAGTGG + Intronic
1062081979 9:134629134-134629156 CAGCCCCACATGGACATGTGTGG + Intergenic
1062185599 9:135216527-135216549 GAGCCCCACATCAGGGTCTGGGG + Intergenic
1187196884 X:17095391-17095413 CAGGCCCAGATGAAGGCATGAGG - Intronic
1189019121 X:37316403-37316425 CAGGCCCACCTGATGGCTTGTGG + Intergenic
1192441749 X:71179722-71179744 CAGCCCCTCTTAAAGGTTAGGGG + Intergenic
1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG + Exonic
1197754883 X:129986373-129986395 CAGACCCACATGAGTGTTTTTGG - Intronic