ID: 919814386

View in Genome Browser
Species Human (GRCh38)
Location 1:201428438-201428460
Sequence GAAACTAATCATTTTCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919814380_919814386 6 Left 919814380 1:201428409-201428431 CCAGCAAATTGGGTGTAGACCCC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 919814386 1:201428438-201428460 GAAACTAATCATTTTCAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919814386 Original CRISPR GAAACTAATCATTTTCAAGC TGG Intronic
906224420 1:44109582-44109604 CAAACTAATCCTATTCCAGCAGG - Intergenic
907374731 1:54026815-54026837 GAAACCTTTCATTTTCAATCAGG + Intergenic
908056900 1:60297528-60297550 GAAAATAATTATTTTAAAGAAGG - Intergenic
910455470 1:87393171-87393193 CAAACTTGTCATTTTCTAGCTGG + Intergenic
911549998 1:99266865-99266887 GAAATGACTCATTTTGAAGCTGG + Intronic
911620561 1:100063212-100063234 GAAATTAACAATTTTCAATCTGG + Intronic
912079869 1:105922187-105922209 GACACTAATCATATTTAAGTAGG - Intergenic
913671549 1:121101179-121101201 GAAAATAATCATTTTCTACCTGG + Intergenic
914023322 1:143888615-143888637 GAAAATAATCATTTTCTACCTGG + Intergenic
916264684 1:162878829-162878851 GAAAACAAGCATTTTCAAGAGGG - Intergenic
917401913 1:174658956-174658978 AAAACTGATTATTTTCAAGAAGG + Intronic
917546298 1:175972232-175972254 GTAACTAATAATTCTAAAGCAGG + Intronic
918655310 1:187018631-187018653 AATACTAAACATTTTCAAGGTGG - Intergenic
919814386 1:201428438-201428460 GAAACTAATCATTTTCAAGCTGG + Intronic
919817307 1:201449483-201449505 GAAACTGAGCTTTTTCAGGCAGG - Intergenic
920854930 1:209654406-209654428 GACACTGATCATTTCCAAGTGGG + Intergenic
921728239 1:218548194-218548216 TAGATTAATCATTTTCAAACTGG + Intergenic
924111642 1:240705300-240705322 AAAAATAAACATTTTCATGCAGG - Intergenic
1063619825 10:7636428-7636450 GAAAATAATCATTTTGTATCAGG - Intronic
1064233857 10:13555256-13555278 GAAATTAATAATTTGCAAACCGG + Intergenic
1066093472 10:32049767-32049789 AAAAATAATAATTTTCAAGGAGG + Intronic
1068347191 10:55796444-55796466 GAAACTCATCAATAGCAAGCTGG + Intergenic
1068412077 10:56669205-56669227 GACACTAATCCTTTTCATGAGGG + Intergenic
1068770646 10:60817222-60817244 GAAACAAATCATTTTAAAAAGGG + Intergenic
1069105147 10:64374455-64374477 GAAAGTAATCACTCTTAAGCTGG - Intergenic
1069130174 10:64690460-64690482 GAAACTAATTATTCACCAGCTGG - Intergenic
1069579285 10:69554523-69554545 GAAAATATTTATTTTAAAGCTGG + Intergenic
1073078856 10:100843852-100843874 GTAACTAATCATTTTCAAAAAGG + Intergenic
1075728762 10:124624090-124624112 GAAATCAATGTTTTTCAAGCAGG + Intronic
1077625019 11:3763452-3763474 AGAACTAATCAGTATCAAGCTGG + Intronic
1082033272 11:47622900-47622922 GAAACAAATCATATTGAAGCAGG + Intronic
1082045511 11:47722885-47722907 GAAATTATCCATTTTCAGGCTGG - Intronic
1083128298 11:60595882-60595904 GAAACATATCATATTCAAGAGGG + Intergenic
1084246242 11:67859177-67859199 AAGACTACTCATTTTCAAGAGGG - Intergenic
1086037597 11:82435772-82435794 GACACTTGTCATTTTCAAGAAGG + Intergenic
1086591069 11:88514404-88514426 AAATTTATTCATTTTCAAGCAGG + Intronic
1087487556 11:98775524-98775546 GAAACTGCTTCTTTTCAAGCAGG - Intergenic
1088135057 11:106545305-106545327 GAAACTAATCAAAATAAAGCTGG + Intergenic
1090357111 11:126147433-126147455 GAAACTGCTCAGTTTCAAGAGGG - Intergenic
1090831109 11:130421510-130421532 GATACTTTTCATTTTCAAGAAGG + Intronic
1091178945 11:133586029-133586051 GAAAGTAATTTTTTTCAGGCAGG - Intergenic
1091488312 12:910870-910892 TAAATAAATCATTTTAAAGCAGG - Exonic
1091504045 12:1049011-1049033 GATACTTATAATTTTCAAGAAGG - Intronic
1093386616 12:18564115-18564137 GAAAATAATGATTTTCAAGATGG - Intronic
1094256940 12:28441973-28441995 TAAAATAATCATTATCAAGTAGG + Intronic
1097765342 12:63520107-63520129 GTAAATAATCCTTTTCTAGCAGG + Intergenic
1098498011 12:71159174-71159196 GAAACTATCCATTTTCTAGTAGG - Intronic
1100323785 12:93522037-93522059 GAATCTAAGCATTTTAGAGCTGG - Intergenic
1100691828 12:97046548-97046570 TAATCTAATGATTCTCAAGCAGG + Intergenic
1101976056 12:109359834-109359856 CAAACTAATGTTTTTCAAGATGG + Intronic
1103129678 12:118456968-118456990 CATACCAATCATTTTCAAACAGG - Intergenic
1103476151 12:121220338-121220360 GAAACTAACCATTTTAAGTCGGG + Intronic
1105444356 13:20439845-20439867 GAACCTCATCATTTTCAAAGTGG - Intronic
1105451608 13:20504772-20504794 GAGACTAATCTTTTTCTAACAGG - Intronic
1106051672 13:26196352-26196374 GAAATAAAACATTTTCAGGCCGG + Intronic
1108839821 13:54598968-54598990 TAAAATAATCATTTACAAGCAGG + Intergenic
1110178349 13:72584930-72584952 GGAACTAATCCATTTCAAGAGGG - Intergenic
1111876123 13:93898360-93898382 GAATGTAATCATTTTCAGACAGG + Intronic
1112678264 13:101730485-101730507 GAAACTTTTCATTTTCAAAAAGG - Intronic
1112827794 13:103412233-103412255 GAAAATAATCACTTTGAAGGTGG + Intergenic
1114391861 14:22317549-22317571 GAAAAGAATAATTTTCAAACTGG + Intergenic
1115291695 14:31779366-31779388 GAACCTCATCATTTGCTAGCTGG + Intronic
1121516804 14:94557690-94557712 TAAACTCATCATTTTCTATCTGG - Intergenic
1122089163 14:99326724-99326746 GCAAATAATCATTTTCAGGCTGG + Intergenic
1123197732 14:106632417-106632439 GTAACCCATCATTTCCAAGCTGG + Intergenic
1124216991 15:27815834-27815856 GAAAATAATCATATTCTGGCTGG + Intronic
1124445314 15:29725691-29725713 GAAAGTAGTTATTTTAAAGCTGG + Intronic
1129673588 15:77620629-77620651 GAAACTAGCCTTTTTCCAGCTGG + Intronic
1129817524 15:78567780-78567802 GAATCTTATAATTTTCAAGGTGG - Intronic
1135716789 16:24777535-24777557 TAAAATAATCATTTTAAAGTAGG - Intronic
1138806211 16:60092274-60092296 CAATCTAAACATTTTTAAGCAGG - Intergenic
1140291991 16:73668050-73668072 GTGACTTATCATTTTCAAGAAGG - Intergenic
1140331752 16:74064411-74064433 GAACCTAATCATTTGAAAGCAGG - Intergenic
1141115773 16:81307792-81307814 GAAGCTAATCATTTCTGAGCTGG + Intergenic
1148424096 17:47575981-47576003 GAAGTTAATCTTTTTCAAGACGG + Intronic
1149560921 17:57607483-57607505 GAAAGTTATCATTTACAAGTAGG + Intronic
1151041653 17:70868415-70868437 GAAAATAATGTTTTACAAGCTGG + Intergenic
1151248718 17:72816953-72816975 GAAAATAATTATGATCAAGCTGG - Intronic
1153569618 18:6455868-6455890 AAAATTAATCATTTTAAAGTGGG + Intergenic
1155747455 18:29376694-29376716 GACACTAATTATTTTGAAGAAGG + Intergenic
1156735772 18:40257182-40257204 CAAACTAACCAATTTAAAGCCGG + Intergenic
1156946662 18:42841351-42841373 GAAACTACACATTTTCAAAAAGG - Intronic
1158798063 18:60872254-60872276 GAAACAAATGATTTTGAATCAGG + Intergenic
1159589872 18:70322439-70322461 AAAAGGAATAATTTTCAAGCAGG + Intronic
1161036726 19:2089206-2089228 GAAACTCATCATTTCCTGGCTGG + Intronic
1161129793 19:2581203-2581225 GAGATTAATCACTTTCAGGCTGG - Intronic
1164167225 19:22691777-22691799 GATACTAATCATTTTGTAACTGG + Intergenic
1164434414 19:28217083-28217105 GCAACATATTATTTTCAAGCTGG - Intergenic
1165205291 19:34179595-34179617 GAAACTGTTCATTTTCTAGTAGG + Intronic
1167957234 19:53075783-53075805 CAAACTAATCAATTTCAAGGAGG + Intronic
928353942 2:30590694-30590716 GAAACTAATTATTTAGCAGCAGG + Intronic
928523316 2:32113379-32113401 AAAACTAATCAATTTTAGGCCGG - Intronic
929092564 2:38233957-38233979 GAATCTCATCATTTTCAAGGAGG + Intergenic
929719055 2:44347921-44347943 GAAAATAATCATTTTCACAAAGG + Intronic
931001241 2:57785280-57785302 GAAACTATTCATCTTCATGGAGG + Intergenic
931610589 2:64095237-64095259 GAAACCAATCAGTTACAAGATGG - Exonic
931839090 2:66129868-66129890 GGAACTGAGCATTTTAAAGCAGG + Intergenic
933015966 2:77127842-77127864 GAAACAAATGTTTTTTAAGCCGG + Intronic
935117701 2:100151406-100151428 AAATCTAATCATTCTGAAGCTGG + Intergenic
935748098 2:106206916-106206938 GAAGCTTATCATTGACAAGCAGG - Intergenic
935821564 2:106897977-106897999 AAAACTAAACACTTTCAAGATGG + Intergenic
935929462 2:108107841-108107863 GAACCTAATCAATTTGCAGCAGG - Intergenic
940552575 2:155179794-155179816 GAACCTAATCATTTTTAAACTGG - Intergenic
940664955 2:156597567-156597589 GAAAATAATTATTTTAATGCTGG - Intronic
941907822 2:170734128-170734150 GAATCATGTCATTTTCAAGCAGG - Intergenic
943529132 2:189056944-189056966 GAAAGTATTCCTTTTCTAGCTGG - Intronic
943624551 2:190183861-190183883 AAAGCAAATGATTTTCAAGCTGG - Intronic
944312679 2:198251652-198251674 AAACCTAATGACTTTCAAGCAGG - Intronic
945012053 2:205475458-205475480 GAAACTATAAATTTTGAAGCTGG + Intronic
949004935 2:241640120-241640142 GAAAATCATCATGTTCAAGTTGG + Intronic
1169546690 20:6657636-6657658 TAAAATAATAGTTTTCAAGCTGG - Intergenic
1170642834 20:18170831-18170853 GAAAATAATCTTTTTCAGGCCGG - Intronic
1174216977 20:48923066-48923088 GAAAGTAATCTTTTCCAAGAGGG + Intronic
1174224156 20:48983337-48983359 TTAACTAATCATTTACAAGTTGG - Intronic
1174880289 20:54272039-54272061 GCAAATATTTATTTTCAAGCTGG + Intergenic
1175286911 20:57842929-57842951 GAAACTAATCATGTTTAATTAGG + Intergenic
1176996664 21:15562758-15562780 GGCACTAATTATTTTTAAGCAGG + Intergenic
1177716869 21:24850011-24850033 GCAACTAATCATTTTATAGGGGG - Intergenic
1177720592 21:24901880-24901902 AATACTAATAATTTTTAAGCTGG + Intergenic
1178468181 21:32868137-32868159 TAAACTAATCATCTTCAAGATGG - Intergenic
1179240697 21:39588613-39588635 GCAACTAATCCTATTCAAGAGGG + Intronic
1179401469 21:41087973-41087995 GAAAGAAATCATTTTCAATCAGG - Intergenic
1182905204 22:33929866-33929888 GAAACTCCTCACTTTCTAGCAGG - Intergenic
1183374960 22:37457736-37457758 GACACTGAGCATTTTCCAGCAGG + Intergenic
950884783 3:16353695-16353717 GACACTAATCCTGTTCAATCAGG - Intronic
959139810 3:102472228-102472250 CAAACCAGTCATTTTTAAGCCGG - Intronic
959242973 3:103823270-103823292 CAAACCAATCATTTTACAGCTGG - Intergenic
959383305 3:105669287-105669309 GAAACTAATCCCTTTCATGAGGG - Intronic
962656661 3:137552525-137552547 GAAACTGATAAATTTCTAGCTGG + Intergenic
964045493 3:152319926-152319948 GAAGCTATTCATTTTCATGAAGG - Intronic
965584962 3:170309927-170309949 GAAAGTATTCATTTTCTAACAGG + Intergenic
969538108 4:7769065-7769087 GAAATAAATCATTTTCCTGCTGG - Intronic
970701600 4:18747144-18747166 GAAAAAAATAATTTTTAAGCTGG - Intergenic
971728635 4:30347362-30347384 GAAATTGGTCAATTTCAAGCAGG - Intergenic
972424530 4:38919913-38919935 GAAACTAATCATTTTCGGCTGGG + Intronic
973837875 4:54828941-54828963 GAAAGAAATCATATTCAAGTAGG + Intergenic
975280336 4:72554837-72554859 GAACCTAAGTATTTTCAATCTGG - Intronic
977335918 4:95699386-95699408 GAAACTAATCATAATCATGATGG - Intergenic
977366641 4:96077478-96077500 GAAAGTAATCTTTTTCAGGAAGG - Intergenic
979398251 4:120216181-120216203 GAAACTAAGCATTTTTAAATTGG + Intergenic
979817901 4:125133100-125133122 GAAATTAAACATTTTGAATCTGG + Intergenic
979971146 4:127136981-127137003 GAAATCAATCCTTTGCAAGCTGG - Intergenic
980077053 4:128305031-128305053 GAAACTGATCATTTGCATCCAGG + Intergenic
982616685 4:157646046-157646068 GAAATTATTCTTTTTCAAGGAGG + Intergenic
983518127 4:168678392-168678414 GGAACTCATCATTTTCTAGCAGG + Intronic
984186853 4:176554779-176554801 GAAAATACTCATTTTCAACATGG - Intergenic
985298239 4:188458115-188458137 AAAACTCATAATTTTCAAGTTGG + Intergenic
986342507 5:6802934-6802956 GTAACTCATCATTTTCAGGAAGG + Intergenic
989595541 5:43152904-43152926 GACAATAATCTTTGTCAAGCTGG - Intronic
991015188 5:61924881-61924903 GAAACTAATGATTTGCCAGGAGG + Intergenic
992022606 5:72639080-72639102 GAAACTCATGACTTTAAAGCAGG - Intergenic
992160541 5:73996501-73996523 AACCCAAATCATTTTCAAGCAGG - Intergenic
992971882 5:82069476-82069498 GGAACAAAACATTTTCAAACTGG + Intronic
993079476 5:83277983-83278005 AAAATACATCATTTTCAAGCAGG + Intronic
994787448 5:104182242-104182264 GAAACTAGACATGTTCAAGATGG + Intergenic
995430429 5:112068752-112068774 GAAACTACTCCTTTTCAAGTTGG - Intergenic
997985035 5:138494695-138494717 GAAACCAAACCTTCTCAAGCTGG + Intergenic
999212449 5:149901892-149901914 AAAACAAATCATTATCAATCAGG - Intronic
1001459190 5:171894439-171894461 GAAACTAATGATTCTAAAACAGG - Intronic
1005176907 6:23057411-23057433 GAACAAAATCATTTTCAATCTGG + Intergenic
1006357227 6:33567103-33567125 CAAACTCATCATGTTCAGGCAGG - Intergenic
1007868451 6:45003407-45003429 AAACCTAATCATTTTCAAAACGG + Intronic
1008201340 6:48594199-48594221 TAAATTAACCAGTTTCAAGCAGG - Intergenic
1008234923 6:49033587-49033609 GGTACTAATCATTTTCATGAGGG - Intergenic
1009296776 6:61960707-61960729 AAAATTGATCATTTTCATGCAGG - Intronic
1010369985 6:75096450-75096472 GAAACTAATGATTTTGAAACTGG - Intronic
1010915679 6:81615237-81615259 GAACCTAATCATTTTCAAAAGGG - Intronic
1011056640 6:83211634-83211656 GAAACTCATCATTTTTATACAGG - Exonic
1012580353 6:100861502-100861524 GAGACTAATCCTTTCAAAGCTGG + Intronic
1013483918 6:110577155-110577177 AAAACTAGTCATTATCAGGCTGG - Intergenic
1013912061 6:115287749-115287771 GAAAGTGATGAATTTCAAGCAGG - Intergenic
1015840259 6:137468903-137468925 TAAACAAATCATTTTAAAGATGG + Intergenic
1016315322 6:142779214-142779236 AAAACTAATGATTTCCAAGCTGG - Intronic
1018384310 6:163289299-163289321 GAACCTAATCAGTTCCAAGATGG + Intronic
1018508919 6:164504114-164504136 GAAACTCATCATTCTGAAGTTGG - Intergenic
1018795937 6:167185712-167185734 GAAACTGATCATTCTAAAGAGGG - Intronic
1018820380 6:167369352-167369374 GAAACTGATCATTCTAAAGAAGG + Intronic
1020417326 7:7960868-7960890 GACACTGAACATTTTTAAGCAGG + Intronic
1020541760 7:9467762-9467784 GAGACTAAACATGTTCAAGATGG - Intergenic
1021240450 7:18194371-18194393 GAAATTAATCATTTTCATTGTGG + Intronic
1023534970 7:41198799-41198821 GAATGTAATCATTTACAATCAGG + Intergenic
1028042303 7:86069014-86069036 AAAATTAATCATTTCAAAGCAGG - Intergenic
1028862848 7:95673193-95673215 GAACCACATCATTTTCAAGAAGG + Intergenic
1030428349 7:109409183-109409205 GTAAAAAATCATGTTCAAGCAGG - Intergenic
1031252585 7:119406600-119406622 GAGAGTGATCATTTTCAAGAGGG - Intergenic
1031603391 7:123740906-123740928 AAAGAAAATCATTTTCAAGCTGG + Intronic
1032697616 7:134350936-134350958 GAAACACATCATTTTCAGGAAGG - Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034080310 7:148270962-148270984 GAAACTAATCTATTTACAGCAGG + Intronic
1036731857 8:11272652-11272674 GGATCTAATCATCTTCAAGCTGG + Intergenic
1038176943 8:25189226-25189248 TAAAATAATCATTTTAAAGATGG + Intronic
1038287584 8:26219356-26219378 TAAATTGATCATTTTCAAGTGGG - Intergenic
1039170980 8:34744574-34744596 AAAACTAGTCATTTTCCACCTGG - Intergenic
1042521711 8:69719442-69719464 GAAACTAGTCATTGTGAAGTAGG + Intronic
1042982812 8:74549388-74549410 GAAACTATGCATTTTCCAGATGG - Intergenic
1043242599 8:77954464-77954486 AAAATTAATCATTTTCTAACTGG - Intergenic
1043984978 8:86683332-86683354 CAAACTAAGCATATCCAAGCAGG + Intronic
1044950144 8:97427943-97427965 AAAACAGACCATTTTCAAGCTGG - Intergenic
1045410147 8:101909054-101909076 GAAAGTGATCTTTTTCAAGGTGG + Intronic
1045963085 8:107991698-107991720 GAAAAAAATCATTAACAAGCAGG + Intronic
1048742029 8:137571675-137571697 GAAAATAGTCATTGTCAAGAAGG - Intergenic
1051477767 9:17527358-17527380 AAAACTAAAACTTTTCAAGCAGG + Intergenic
1052097992 9:24408430-24408452 GGAAGTCATTATTTTCAAGCTGG + Intergenic
1055914195 9:81383691-81383713 TAAAATAATCATTTTCAACATGG + Intergenic
1057091273 9:92260298-92260320 GATACAAATCATTTGCAAACAGG + Intronic
1057256349 9:93550897-93550919 GGGACTAATCATTTCCAAACTGG - Intronic
1187815045 X:23222536-23222558 AAAACAAATTATTTTCAAGTTGG - Intergenic
1188352459 X:29148974-29148996 GAGACAAATGATTATCAAGCAGG - Intronic
1188484441 X:30667789-30667811 GTAATTAATCATTTTCAAGGAGG - Intronic
1189543516 X:42017993-42018015 GAAATTAATAATTTACAAGTTGG + Intergenic
1189703068 X:43731938-43731960 GAAACAAAGTATTTTCAAACTGG + Intronic
1191198837 X:57755345-57755367 AAAAATAATCATATTCAATCTGG + Intergenic
1193145346 X:78070134-78070156 GACACTGAAAATTTTCAAGCAGG - Intronic
1193277446 X:79605509-79605531 GAAATTAATGTTTTTCAAACGGG - Intergenic
1195612881 X:106889273-106889295 GATACTAAACATTTTAAAGAGGG + Intronic
1197865858 X:131016496-131016518 GAAAGCAATCATCTGCAAGCCGG - Intergenic
1198632995 X:138662996-138663018 GGAACTAGTCTTGTTCAAGCTGG - Intronic
1199730175 X:150623834-150623856 CAAAGTGATCTTTTTCAAGCAGG - Intronic
1200233875 X:154459057-154459079 GAAACTTTGCAGTTTCAAGCTGG + Intronic