ID: 919816381

View in Genome Browser
Species Human (GRCh38)
Location 1:201443392-201443414
Sequence CTCTCTCCCCTCCTGCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919816381_919816387 10 Left 919816381 1:201443392-201443414 CCCTGAGGCAGGAGGGGAGAGAG No data
Right 919816387 1:201443425-201443447 AGAGAAGCTGGGCATTTGTATGG No data
919816381_919816385 -2 Left 919816381 1:201443392-201443414 CCCTGAGGCAGGAGGGGAGAGAG No data
Right 919816385 1:201443413-201443435 AGGTGTGGATAGAGAGAAGCTGG No data
919816381_919816386 -1 Left 919816381 1:201443392-201443414 CCCTGAGGCAGGAGGGGAGAGAG No data
Right 919816386 1:201443414-201443436 GGTGTGGATAGAGAGAAGCTGGG No data
919816381_919816388 17 Left 919816381 1:201443392-201443414 CCCTGAGGCAGGAGGGGAGAGAG No data
Right 919816388 1:201443432-201443454 CTGGGCATTTGTATGGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919816381 Original CRISPR CTCTCTCCCCTCCTGCCTCA GGG (reversed) Intergenic
No off target data available for this crispr