ID: 919816382

View in Genome Browser
Species Human (GRCh38)
Location 1:201443393-201443415
Sequence CCTCTCTCCCCTCCTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919816382_919816388 16 Left 919816382 1:201443393-201443415 CCTGAGGCAGGAGGGGAGAGAGG No data
Right 919816388 1:201443432-201443454 CTGGGCATTTGTATGGAATCAGG No data
919816382_919816387 9 Left 919816382 1:201443393-201443415 CCTGAGGCAGGAGGGGAGAGAGG No data
Right 919816387 1:201443425-201443447 AGAGAAGCTGGGCATTTGTATGG No data
919816382_919816385 -3 Left 919816382 1:201443393-201443415 CCTGAGGCAGGAGGGGAGAGAGG No data
Right 919816385 1:201443413-201443435 AGGTGTGGATAGAGAGAAGCTGG No data
919816382_919816386 -2 Left 919816382 1:201443393-201443415 CCTGAGGCAGGAGGGGAGAGAGG No data
Right 919816386 1:201443414-201443436 GGTGTGGATAGAGAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919816382 Original CRISPR CCTCTCTCCCCTCCTGCCTC AGG (reversed) Intergenic
No off target data available for this crispr