ID: 919816385

View in Genome Browser
Species Human (GRCh38)
Location 1:201443413-201443435
Sequence AGGTGTGGATAGAGAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919816382_919816385 -3 Left 919816382 1:201443393-201443415 CCTGAGGCAGGAGGGGAGAGAGG No data
Right 919816385 1:201443413-201443435 AGGTGTGGATAGAGAGAAGCTGG No data
919816381_919816385 -2 Left 919816381 1:201443392-201443414 CCCTGAGGCAGGAGGGGAGAGAG No data
Right 919816385 1:201443413-201443435 AGGTGTGGATAGAGAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919816385 Original CRISPR AGGTGTGGATAGAGAGAAGC TGG Intergenic
No off target data available for this crispr