ID: 919820982

View in Genome Browser
Species Human (GRCh38)
Location 1:201471842-201471864
Sequence GTCTTCCTGGAGGCCTGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919820978_919820982 -9 Left 919820978 1:201471828-201471850 CCTAACACGACAACGTCTTCCTG No data
Right 919820982 1:201471842-201471864 GTCTTCCTGGAGGCCTGAATGGG No data
919820977_919820982 -3 Left 919820977 1:201471822-201471844 CCAGTTCCTAACACGACAACGTC No data
Right 919820982 1:201471842-201471864 GTCTTCCTGGAGGCCTGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919820982 Original CRISPR GTCTTCCTGGAGGCCTGAAT GGG Intergenic
No off target data available for this crispr