ID: 919821148

View in Genome Browser
Species Human (GRCh38)
Location 1:201472763-201472785
Sequence GTCCTGGGTAGCCACCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919821148_919821155 -3 Left 919821148 1:201472763-201472785 CCCTCTGGGTGGCTACCCAGGAC No data
Right 919821155 1:201472783-201472805 GACAAGGCGGAAAGAAAGATGGG No data
919821148_919821157 7 Left 919821148 1:201472763-201472785 CCCTCTGGGTGGCTACCCAGGAC No data
Right 919821157 1:201472793-201472815 AAAGAAAGATGGGAATAAGGCGG No data
919821148_919821158 8 Left 919821148 1:201472763-201472785 CCCTCTGGGTGGCTACCCAGGAC No data
Right 919821158 1:201472794-201472816 AAGAAAGATGGGAATAAGGCGGG No data
919821148_919821154 -4 Left 919821148 1:201472763-201472785 CCCTCTGGGTGGCTACCCAGGAC No data
Right 919821154 1:201472782-201472804 GGACAAGGCGGAAAGAAAGATGG No data
919821148_919821159 15 Left 919821148 1:201472763-201472785 CCCTCTGGGTGGCTACCCAGGAC No data
Right 919821159 1:201472801-201472823 ATGGGAATAAGGCGGGTTAGAGG No data
919821148_919821156 4 Left 919821148 1:201472763-201472785 CCCTCTGGGTGGCTACCCAGGAC No data
Right 919821156 1:201472790-201472812 CGGAAAGAAAGATGGGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919821148 Original CRISPR GTCCTGGGTAGCCACCCAGA GGG (reversed) Intergenic
No off target data available for this crispr