ID: 919824610

View in Genome Browser
Species Human (GRCh38)
Location 1:201494458-201494480
Sequence TTCTGGCCTCCTTTGCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919824607_919824610 16 Left 919824607 1:201494419-201494441 CCTAAGAGTAGTGAACTGCTGAT 0: 1
1: 0
2: 1
3: 7
4: 91
Right 919824610 1:201494458-201494480 TTCTGGCCTCCTTTGCAGGCTGG 0: 1
1: 0
2: 3
3: 32
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919824610 Original CRISPR TTCTGGCCTCCTTTGCAGGC TGG Intronic
900868205 1:5283534-5283556 TTGCTGTCTCCTTTGCAGGCTGG - Intergenic
901228636 1:7629781-7629803 TCCTGCCCTCCTCTCCAGGCTGG + Intronic
901701043 1:11044903-11044925 TTCTGACCTGCTGGGCAGGCCGG + Intronic
902245393 1:15117480-15117502 TTCTCCCCTCCTCTGCAGCCTGG - Exonic
903339437 1:22644470-22644492 TCCTGGCCACCTTTGGGGGCAGG - Intronic
903383996 1:22915033-22915055 TCCTGGCCTCCGATGCAGCCTGG - Intronic
906948937 1:50318769-50318791 TCCTGGCCTCCCTGGCAGGAAGG - Intergenic
908525576 1:64984617-64984639 TGGTGGTCTCCTTAGCAGGCTGG + Intergenic
908735570 1:67272785-67272807 TTCTAGCCTCCCTTGCAGCTAGG + Intergenic
909423972 1:75499872-75499894 TTCTAGCCTCCTTTGTAGTTAGG + Intronic
910338369 1:86157384-86157406 TTCTTGCCTTCTTTGCAGTTAGG + Intergenic
910884713 1:91952390-91952412 CTCTGGCTTCCTCTGCAGTCTGG + Intronic
911702600 1:100971441-100971463 ATCTGACCTCCTTTGGAGGTTGG + Intronic
912631776 1:111252604-111252626 TCTTGGTCTCCTTTGCAGTCTGG - Intergenic
913384728 1:118247234-118247256 TTCTCCCCTCCTTTGAAGGCAGG + Intergenic
915468511 1:156112436-156112458 GCCTGGCTTCCTTTCCAGGCTGG - Intronic
916488982 1:165284875-165284897 TTCTGGCGGCTATTGCAGGCTGG - Intronic
917095510 1:171395144-171395166 TTCTGGGCTCATTTGAAGCCTGG + Intergenic
917396570 1:174600743-174600765 TTCTGGCTGCCTTCACAGGCTGG + Intronic
917701594 1:177587255-177587277 TTCTCCCCTCCTTTCCATGCAGG + Intergenic
917881431 1:179340455-179340477 ATCTGGTCTCCTTTGCATCCAGG - Intronic
918124957 1:181575176-181575198 TTCTGTCCTCCAGTGCAGGAGGG - Intronic
918215141 1:182386842-182386864 TCCTGGCCTACATTCCAGGCAGG + Intronic
918472407 1:184887434-184887456 TTCCAGCCTCCTTTGCAGCTTGG + Intronic
918517321 1:185377193-185377215 TGCTGACCTCCTTTTCATGCAGG - Intergenic
919824610 1:201494458-201494480 TTCTGGCCTCCTTTGCAGGCTGG + Intronic
920396345 1:205648788-205648810 TTCTGGCCTGCATTTGAGGCTGG - Intergenic
920516357 1:206587300-206587322 TTCTTCCTTCCTTTGCCGGCTGG - Exonic
920907358 1:210184238-210184260 TTCTGGTCTCCTTTGGATACAGG - Intergenic
921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG + Intronic
921924584 1:220700749-220700771 TTCTGCCTTCCTTGGCAGGGTGG - Intergenic
923236330 1:232036753-232036775 CTCCCGCCTCCTTTGCTGGCTGG - Intronic
923879934 1:238092552-238092574 TTCCAGCCTCCTTTGCAGACAGG - Intergenic
923932878 1:238722398-238722420 TCCTGGCTGCTTTTGCAGGCTGG - Intergenic
924757318 1:246953141-246953163 TTCAGGCCTCCTTTGGAGGGAGG + Intronic
1064169338 10:13016528-13016550 TTCTGGTATCCTTGGGAGGCAGG + Intronic
1066481530 10:35799872-35799894 TTCTGAACACATTTGCAGGCCGG + Intergenic
1066829049 10:39701247-39701269 TTCAGGCCTTCTTTGCAAACGGG + Intergenic
1066831394 10:39743727-39743749 TTCAGGCCTTCTTTGCAAACGGG + Intergenic
1066834920 10:39807265-39807287 TTCAGGCCTTCTTTGCAAACGGG + Intergenic
1066837231 10:39849043-39849065 TTCAGGCCTTCTTTGGAAGCGGG + Intergenic
1073159901 10:101383527-101383549 TTCTTTCCTTCTTTCCAGGCTGG + Intronic
1074463931 10:113665598-113665620 TGCTGTTCTCATTTGCAGGCTGG - Intergenic
1074927831 10:118091815-118091837 TTCCTGCCTCCTTTTTAGGCAGG - Intergenic
1076013587 10:127009918-127009940 GTATGGCTTTCTTTGCAGGCGGG + Intronic
1076378994 10:130012262-130012284 TGCTGGCCTCCCTTGCTGGCTGG - Intergenic
1077558019 11:3235717-3235739 TTCTGGCCTGTGTTGCAGTCCGG - Intergenic
1079026521 11:16952364-16952386 TTCTGCCCTCCTTAGCAGAAAGG - Intronic
1079212875 11:18478812-18478834 TTCTGCACTCTTTTGCAAGCAGG - Exonic
1080765065 11:35288387-35288409 GCCTGGCCTCATTTGCATGCAGG + Intronic
1080866645 11:36201151-36201173 TGCTGGTCTTCTTTGAAGGCTGG + Intronic
1081550892 11:44110996-44111018 TTCTTGCCTCCTTTGAATCCAGG - Intronic
1081666790 11:44921266-44921288 TTCAGGCTTCCATGGCAGGCAGG + Intronic
1083265122 11:61543037-61543059 TACTGGCATCCTTTGGAGACAGG + Intronic
1084102656 11:66959886-66959908 GTCTGCTCTCCTTTGAAGGCAGG - Intergenic
1085259397 11:75195695-75195717 CTTTGGCCTCCTCTGCAGCCTGG + Intronic
1085810238 11:79673489-79673511 TCCTAGCCTCCTTTGCAGCTGGG + Intergenic
1086100752 11:83097054-83097076 TCCTGGCCTCCTTTGCAGTTAGG + Intergenic
1086339661 11:85835808-85835830 TGCTGCCCTCCCCTGCAGGCAGG - Intergenic
1086922763 11:92606005-92606027 TTCTCTCCTCATTTGCAAGCTGG + Intronic
1086992164 11:93315259-93315281 TTCTGTCCTCCTCTTCAGTCTGG + Intergenic
1088108735 11:106236473-106236495 TTCTGTCATCCTTAGCATGCTGG + Intergenic
1088413834 11:109567518-109567540 TGCTGGCCTTCTCTGCAGGGAGG - Intergenic
1088811104 11:113393222-113393244 TTGTGGCCACCTTTGCAGAATGG + Intronic
1089583476 11:119495778-119495800 TTCTAGCGCCCTTTCCAGGCCGG - Intergenic
1092475366 12:8814343-8814365 CTCTGGCCTCCCTTGCAGTGAGG + Intergenic
1094099028 12:26741399-26741421 TTCTTACCTCCTTTGCCAGCTGG + Intronic
1094106557 12:26817932-26817954 TTCTAGCCTCCTTTGTAGCCAGG - Intronic
1098318874 12:69220552-69220574 TCCTAGCCTCCTTTGCAGTTAGG - Intergenic
1098871221 12:75819437-75819459 TCCTGTGCTCCTTTGGAGGCTGG - Intergenic
1099122246 12:78705920-78705942 CTATGACCTCCTTTGCAAGCAGG - Intergenic
1099458189 12:82890375-82890397 TTCTAACCTCCTTTGTAGTCTGG + Intronic
1100446996 12:94670119-94670141 TTTTGACCTCCTTTGAAGTCAGG - Intergenic
1100795295 12:98175835-98175857 TACTGGCTTCTTTTTCAGGCAGG + Intergenic
1101734744 12:107454600-107454622 TCCTTGCCACCTTTTCAGGCAGG + Intronic
1102299331 12:111759514-111759536 TCCTGCCCTCCCTTGGAGGCTGG + Intronic
1104391511 12:128394408-128394430 CTCTGGGCTTCTTTACAGGCAGG + Intronic
1104949599 12:132433392-132433414 TTCCAGCCTCCTGTGCAGACAGG - Intergenic
1106121718 13:26865161-26865183 TTCTGGGCCCCTTTGGAGGTAGG + Intergenic
1107809745 13:44188907-44188929 TTCCAGCCTCCCTTGCAGTCAGG + Intergenic
1107917547 13:45168345-45168367 TTCTGGCCTGCCCTCCAGGCAGG - Intronic
1108323577 13:49308582-49308604 TTCTTGCCACCGTTCCAGGCAGG - Intergenic
1108505510 13:51109039-51109061 TTCTGGACTCCTTTCCAGCTTGG - Intergenic
1109688122 13:65847381-65847403 TTCTGCTCTCCTTATCAGGCTGG - Intergenic
1111621644 13:90732223-90732245 TTCTGGCTTCTTTCGCAAGCTGG - Intergenic
1112325293 13:98439638-98439660 TCCTGTCCCCCTTGGCAGGCAGG + Intronic
1114363282 14:21999674-21999696 TTCTAGCCTCCCTTGCAGATAGG - Intergenic
1114640607 14:24217223-24217245 TTCTGGCTTCCTTTTCCTGCAGG - Exonic
1115612496 14:35062089-35062111 TTCTGCCTTCCTTTGCTGGGAGG + Intronic
1117408110 14:55424882-55424904 ATCTGCCCTCCTCTCCAGGCTGG - Intronic
1118143837 14:63114719-63114741 TTCCAGCCTCCTTTGCAGCTAGG + Intergenic
1118383685 14:65238148-65238170 TTCTGGCCTCCCTTGTAGGGAGG + Intergenic
1118486053 14:66215408-66215430 TCCTGGCTGCCTTTACAGGCTGG + Intergenic
1119548465 14:75490888-75490910 TCCTAGCCTCCTTTGCAGTGAGG - Intergenic
1120234002 14:81870068-81870090 TTCCAGTCTCCTTTGCAGACAGG + Intergenic
1121075317 14:91063264-91063286 TTCTTACCTCCTTTGCAGTTAGG + Intronic
1121895946 14:97647722-97647744 AACTGGCCTCCTTTGCAGTTAGG + Intergenic
1122179682 14:99946275-99946297 TTCTAGGCTCCTGTGCAGCCAGG - Intergenic
1122586042 14:102807274-102807296 TGATGGCCTCCTGGGCAGGCAGG - Intronic
1124886528 15:33692584-33692606 GTCTTGCCTCCTTTTCTGGCAGG + Intronic
1127260818 15:57324644-57324666 TTCTGTCTTCATTTACAGGCAGG + Intergenic
1128720342 15:69943282-69943304 TGCCCGCCTCATTTGCAGGCTGG + Intergenic
1129519754 15:76178219-76178241 TTCTGGCTGCCGTTGGAGGCTGG + Intronic
1130002376 15:80059179-80059201 TTCTGTCTTCCCATGCAGGCCGG - Intergenic
1131823606 15:96297478-96297500 TTCTGGCCAGGTTTGAAGGCAGG - Intergenic
1132116057 15:99137302-99137324 CTGTGGCCTCCACTGCAGGCAGG - Exonic
1132351981 15:101145433-101145455 TCCCAGCCTCCTTTGCAGCCAGG + Intergenic
1132943829 16:2521235-2521257 GTCTGGCCTCCTTTGATGACCGG + Intronic
1133181806 16:4060389-4060411 TTCTGGCCTCCTTTGTGCGTGGG - Intronic
1134215142 16:12311453-12311475 TCCTGGCTTCCTCTGCTGGCTGG + Intronic
1134305991 16:13033001-13033023 TGTTGGCCTCATTTTCAGGCAGG + Intronic
1136043600 16:27599191-27599213 TGCTGGCCTCCATCCCAGGCTGG - Intronic
1136076667 16:27822015-27822037 TACAGGCCCCCTTTTCAGGCAGG + Intronic
1137854514 16:51780447-51780469 TTCTTGCCTCCTTTGAAGTTAGG - Intergenic
1138133054 16:54498696-54498718 TGCTGGGCTCCTTTGCATCCTGG + Intergenic
1138134630 16:54511084-54511106 CTCTGGCCGGCTGTGCAGGCAGG - Intergenic
1138349523 16:56339024-56339046 GGCTGGCCACCTTTGCAGCCCGG + Intronic
1138431376 16:56971273-56971295 CTCTGGCCTCCTTTCCTGCCTGG + Intronic
1140196774 16:72861648-72861670 TTCTGGCATCTTTTGCATGTTGG - Intronic
1140973951 16:80041541-80041563 TTCTGGACTCCTTTGGAAACTGG - Intergenic
1141234081 16:82199411-82199433 TTCTGGCCTACTTTGTAGCTAGG - Intergenic
1142222474 16:88862317-88862339 TCCTGGGCTCCCTTGCAGCCCGG + Exonic
1142477096 17:194842-194864 TTATGGCCTGCCTTGCAGGTTGG - Intergenic
1144825370 17:18102794-18102816 TCCTGCCCTCCTTTGCAGGGTGG + Intronic
1145003501 17:19321771-19321793 TTCTGGCCCCCTGTGGAGCCTGG - Intronic
1145979300 17:29002431-29002453 TCCTGGCCTCCTCAGCAGGGTGG - Intronic
1148716523 17:49719823-49719845 TTCCAGGCTCCTGTGCAGGCAGG + Exonic
1149571758 17:57677178-57677200 TTCTGGACCCCTTTTCAGGAGGG + Intronic
1151227743 17:72659218-72659240 TGCTGGAGTCATTTGCAGGCAGG - Intronic
1152204850 17:78969127-78969149 CTATGGCCTCCCTTGCAGGCAGG + Intergenic
1152315578 17:79578505-79578527 TTGTGCCCTCCCTTGGAGGCAGG + Intergenic
1152373394 17:79904604-79904626 TTCTGGCCTCCTTTGTGATCAGG + Intergenic
1153258212 18:3194547-3194569 TTCTGGCTTCCTGTGCACACTGG + Intronic
1155196123 18:23476499-23476521 TTCTGGCCTCTTTGGGAGGTGGG + Intronic
1156163395 18:34387080-34387102 TTCTTGCTTACTTTGCAAGCTGG - Intergenic
1157169918 18:45393725-45393747 CTCTGGCCTGCTTTGCAGGCTGG + Intronic
1157281875 18:46351573-46351595 TTCTGTCCTGCTTAGCAGGAAGG - Intronic
1159428873 18:68325200-68325222 TTCTAGCCTCCTTTGTATCCTGG + Intergenic
1159931301 18:74315581-74315603 TTCTGGCCGCCCTCGAAGGCGGG - Intergenic
1160325960 18:77948517-77948539 TGCTGCCCTGCTGTGCAGGCAGG - Intergenic
1161350893 19:3790924-3790946 GGCTGGCCTCCTTCTCAGGCAGG - Intronic
1162282471 19:9710246-9710268 TCCTGGACTCCTTTACAGGTGGG - Intergenic
1162634396 19:11955752-11955774 ATCAGTCCTCCTTTGCAGGTTGG + Intronic
1162669188 19:12240145-12240167 TTATGGCCTTCTTTTTAGGCCGG + Intronic
1164946097 19:32294402-32294424 TTCCAGCCTCCTTTCTAGGCAGG - Intergenic
1165350646 19:35273296-35273318 CACTGGCCTCCTTTGCTGTCTGG + Intronic
1167052808 19:47089979-47090001 TGCTGCCCTCCTTGGCACGCCGG + Exonic
1167421043 19:49403498-49403520 TCCTGGGCTCCTTTGCAGCTGGG - Intronic
925453300 2:3990403-3990425 TTCTGGCCACTTTCACAGGCTGG + Intergenic
926111883 2:10188897-10188919 TCCTGGCCGCATTTGGAGGCTGG + Intronic
927364096 2:22274021-22274043 TCCTAGCCTCCTTTGCAGTGAGG - Intergenic
927470871 2:23375593-23375615 TTCTAGTCTCCTTTGCAGGTAGG - Intergenic
927855146 2:26523142-26523164 CCCTGGCATCCTTAGCAGGCAGG + Intronic
927865407 2:26584598-26584620 TTCTGGACTCCATTTCAGGAAGG - Intronic
928095572 2:28402781-28402803 CTCTGGCCTCTTTGTCAGGCTGG + Intronic
928225336 2:29443553-29443575 CTCTGCCCTCCTTTGCCCGCTGG + Intronic
928580935 2:32706916-32706938 TCCTGTCCTCTTTTGCAGGTTGG + Intronic
929978398 2:46656515-46656537 TCCTGGCCTCCCTTGCACCCTGG + Intergenic
931378182 2:61727008-61727030 TCCTGGCCTCCCTTGCAGCTAGG - Intergenic
931786738 2:65625592-65625614 TTGAGGCTTCCTTTGCAGCCTGG - Intergenic
935245895 2:101218751-101218773 CTGTGGTCTCCTTTGCAGGCAGG + Intronic
935930899 2:108124236-108124258 TTCTGGCTTCCTTTACAGGTAGG + Intergenic
935939800 2:108226293-108226315 TTCTGAACTCCTTAGCAGGTAGG + Intergenic
936681521 2:114778744-114778766 TTCTGGCTTCCTTTGCAATTAGG - Intronic
936761311 2:115787118-115787140 TTCTGGCATATGTTGCAGGCAGG - Intronic
936894037 2:117406388-117406410 TTCTGGACTCCTATCCAGGATGG + Intergenic
941268324 2:163392102-163392124 TTCTGGCCCACTTTGGTGGCAGG + Intergenic
941484922 2:166068078-166068100 TGCTGGCTTCATTTGCAGGCTGG - Intronic
942110985 2:172682546-172682568 TCCTGTCCTCCTCTGCATGCAGG + Intergenic
942981836 2:182092858-182092880 TTCTGGCCGCTTTCACAGGCTGG + Intronic
943762815 2:191628493-191628515 TCCTGTCCTCCTATGCATGCTGG + Intergenic
944499749 2:200347279-200347301 TCCTAGCCTCCTTTGCAGTGAGG + Intronic
944619575 2:201500110-201500132 TTCTAGCCTCCTTTGCAGACAGG + Intronic
944667971 2:201972589-201972611 TTCTGGTCTCCTTTACAGATGGG + Intergenic
945471079 2:210228619-210228641 TCTTGACCCCCTTTGCAGGCAGG + Intergenic
946488146 2:220120897-220120919 TTCTAGTCTCCTTGGCAGGCAGG + Intergenic
947241242 2:227996602-227996624 TTCTGGGCTCCTTTACAAGCGGG + Intronic
947620757 2:231589302-231589324 TCCCAGCCTCCTTTGCAGGTAGG - Intergenic
948503948 2:238415398-238415420 TTCTGGGCTGCTTTGCCAGCTGG + Intergenic
948904496 2:240972156-240972178 TTCTGGCCTCGTTTGAAGTTGGG + Intronic
1169457622 20:5766084-5766106 TTCACGGCACCTTTGCAGGCAGG + Intronic
1170935975 20:20809991-20810013 TTCCAGCCTCCCTTGCAGGCAGG + Intergenic
1171110963 20:22482214-22482236 TCCTGGCCTCCTGTGGGGGCTGG - Intergenic
1171504555 20:25623305-25623327 TTCTGGCCTCCCTGGCGGGGTGG - Intronic
1173189155 20:40863072-40863094 TTCTTCCCTCCTCTGCAGCCTGG + Intergenic
1173280632 20:41623827-41623849 TCCTAGCCTCCTTTGCAGCTTGG - Intergenic
1174416231 20:50369111-50369133 TCCCGGCCTCCTTTGCAGTTAGG - Intergenic
1174425155 20:50427098-50427120 TTCCAGCCTCCTTTGCAGCGTGG - Intergenic
1174503960 20:51004846-51004868 TTCTGCCCTCCTTTCCTGGAGGG - Intronic
1174711901 20:52715562-52715584 TCCCGGCCTCCTTTGCAGCTAGG - Intergenic
1175873445 20:62218978-62219000 TTCTTTCCTCCTTTGAGGGCTGG - Intronic
1176430123 21:6570172-6570194 TTCTGGCCTCCCCAGCAGCCTGG - Intergenic
1177610177 21:23435933-23435955 TTCTGCCACCATTTGCAGGCTGG + Intergenic
1178275255 21:31231004-31231026 TTCTGGCCCCCTCTGAAGCCAGG + Intronic
1178795520 21:35740559-35740581 TTCCCGCCTCCTTTGCAGCTAGG - Intronic
1179016174 21:37595929-37595951 CTCTGGCTTCCTGTGCAGCCTGG + Intergenic
1179122000 21:38556572-38556594 TACCAGCCTCCTTTGCAGCCAGG + Intronic
1179705517 21:43177634-43177656 TTCTGGCCTCCCCAGCAGCCTGG - Intergenic
1179887743 21:44321656-44321678 TGCTGACCTCCTGTGCAGGTTGG + Intronic
1184464604 22:44661341-44661363 TTCTGGGCTCCTTTGGACTCTGG - Intergenic
1185104253 22:48858277-48858299 TTCTGGCATCATCTGCAGGATGG - Intergenic
1185133579 22:49055667-49055689 TTCTGGTCTCCTTAGCACCCAGG + Intergenic
1185401887 22:50623242-50623264 TGTTGGCCTCCTCTGCAGGGAGG - Intronic
949842171 3:8331628-8331650 TTCCAGCCTCCTTTGCAGCTGGG - Intergenic
950052975 3:10006036-10006058 ATCTGGCTTCCTCTGTAGGCTGG - Intronic
950054399 3:10012996-10013018 GTCCGGCTTCCTCTGCAGGCTGG - Intergenic
950304487 3:11907649-11907671 CTCTGGCTTTCTCTGCAGGCCGG - Intergenic
950594718 3:13969536-13969558 AACTGGCCTGCTTTGCAGCCAGG - Intronic
951162192 3:19438146-19438168 TTATTTCCTCCTTTGCAGGTTGG + Exonic
952744773 3:36766318-36766340 TTCTAGCCTCCCTTGCAGCAAGG + Intergenic
954895424 3:53971092-53971114 TTCTAGCTTCCTTTGCAGCTAGG + Intergenic
956200433 3:66700056-66700078 TTCTGGCCTCCATTGCAGCTAGG - Intergenic
958057205 3:88428004-88428026 TTCTGGCTGCTTTTACAGGCTGG - Intergenic
958212424 3:90504081-90504103 TTGTGGCCTTCTTTGAAAGCGGG - Intergenic
960029078 3:113039693-113039715 TCCTGGCCTCCCTTGCAGTTAGG - Intergenic
960259492 3:115550343-115550365 TTATGGCCTCATTCCCAGGCAGG + Intergenic
960589911 3:119355384-119355406 TTCTGGGCTCCTTTGCTATCTGG - Intronic
960670188 3:120148147-120148169 TTGTGGCCTCCTTTGGATTCCGG - Intergenic
960673241 3:120171731-120171753 TTCTGGCCTTCTGTGTAGCCAGG + Intronic
961506934 3:127376212-127376234 TTCTCGCCTCCTTTTCAGCTGGG + Intergenic
961518778 3:127455262-127455284 CTTTGGCCTCTGTTGCAGGCTGG - Intergenic
961525211 3:127492480-127492502 TTCTGCTCTGCCTTGCAGGCTGG + Intergenic
961536017 3:127571242-127571264 TTCTAGCCTTCCTTGCAGGTGGG - Intergenic
961714322 3:128848276-128848298 GGCTGGCTTCCTCTGCAGGCCGG + Intergenic
963497842 3:146090594-146090616 TTCTGGCATTCTTTGCAGATAGG + Intronic
964158589 3:153617719-153617741 TTCTGGCACCCTGTCCAGGCTGG + Intergenic
966878878 3:184338616-184338638 TTCTGGCTCCCTTTTCCGGCGGG + Intronic
967014976 3:185473523-185473545 TTCTGGCCTGCACTGAAGGCAGG - Exonic
968543306 4:1179286-1179308 ACCTGGCCTCCTTTGCAAGGTGG - Intronic
968607835 4:1543859-1543881 TTCTGGCCTCAGTAGCAGGAAGG - Intergenic
969612797 4:8236525-8236547 TCCTGGTCTCCTGTCCAGGCAGG + Intronic
970153782 4:13120009-13120031 TTCTAGTTTCATTTGCAGGCAGG - Intergenic
970302123 4:14692429-14692451 TTCTTGGCTGCTTTCCAGGCTGG - Intergenic
970454418 4:16208379-16208401 TCCTAGCCTCCTTTGCAGCTGGG + Intronic
971354609 4:25884041-25884063 TTCTGGGCTCCTTTTCACACTGG + Intronic
971802803 4:31314672-31314694 TTCTAACCTCATTTGCAGTCAGG - Intergenic
972017334 4:34263236-34263258 TCCTGGCTGCCTTTACAGGCTGG + Intergenic
972378879 4:38500409-38500431 TCCCGGCTTCCTTTGCAGCCAGG + Intergenic
972666248 4:41167882-41167904 CTCTGGCCTCCTCTGCTAGCTGG - Intronic
973597373 4:52506399-52506421 TTCTGGCCTCCTTTGTATCCTGG - Intergenic
980188088 4:129488330-129488352 TTCTAGGCTCCTTTGCCAGCTGG + Intergenic
981079301 4:140622758-140622780 TCCCGCCCTCCTTTGCAGGCTGG + Exonic
983484744 4:168320141-168320163 TTTTGGCCTCTTTTGGAGGGAGG - Intergenic
984512223 4:180693117-180693139 TTCTGGCTGCCTTTACAGGCTGG + Intergenic
985023199 4:185713087-185713109 ATCTCCCCTCCTTTGCTGGCCGG + Intronic
986514916 5:8551265-8551287 TTCTGGCCTCCTTGGAAGAGTGG - Intergenic
986603379 5:9496701-9496723 TTCTTGACTACTTGGCAGGCAGG - Intronic
986627136 5:9732564-9732586 TTCTGGCTTCCATAGCAGGGTGG + Intergenic
988873960 5:35423198-35423220 TCTTTGCCTCCTTTCCAGGCTGG - Intergenic
990279674 5:54236917-54236939 TTCCAGACTCCTTTGCAGCCAGG + Intronic
992904948 5:81336981-81337003 TCATGTCTTCCTTTGCAGGCTGG - Intronic
992970932 5:82057056-82057078 TGATGGCCTACTTTCCAGGCAGG + Intronic
998046733 5:138993078-138993100 TCTCGGCCTCCTTTGCAGGGAGG + Intronic
999401686 5:151269190-151269212 TTCTGGGCTCATTTGAAGCCTGG + Exonic
999428747 5:151508373-151508395 TCCTGCCCTGCTTTGCAGTCGGG - Intronic
1000712528 5:164599121-164599143 TTCCTCCCTCCTGTGCAGGCTGG + Intergenic
1002130618 5:177079364-177079386 TCCTGGCTTCCTTTGCAGCTAGG + Intronic
1004409887 6:15371266-15371288 TTATTGCATCCTGTGCAGGCTGG - Intronic
1004425523 6:15504432-15504454 GTCTGGCCTCATTTGCAGTAGGG + Intronic
1006258927 6:32852830-32852852 TTCTGGGCTCCATTGCTGACCGG - Intronic
1007743187 6:44025160-44025182 TTCTGGGCTCCTTTGCAACTAGG - Intergenic
1007994305 6:46289845-46289867 TTCCAGCCTCCTTTGCAGTTAGG + Intronic
1008886777 6:56439884-56439906 TTCTGGACTCCCTTGCAGCTAGG - Intergenic
1011765390 6:90614298-90614320 TTATGACCTCCTTTGAGGGCAGG + Intergenic
1011876318 6:91966309-91966331 TTCTGGCTGCCTTCACAGGCTGG - Intergenic
1012205976 6:96460527-96460549 TGGTGGCTGCCTTTGCAGGCCGG + Intergenic
1012889714 6:104884529-104884551 TCCTGGCCTCCTATGCAGGTAGG - Intergenic
1013249777 6:108322500-108322522 TCCTGGCCTCTCTTGCAGTCAGG - Intronic
1015376256 6:132513298-132513320 TTCTGTCCTTTTTTGCACGCAGG - Intergenic
1016312315 6:142747146-142747168 GACTGGCCACCTCTGCAGGCTGG - Intergenic
1016390434 6:143569129-143569151 TTCTGGCCTCCCTTGCAGTTAGG + Intronic
1017585950 6:155923195-155923217 TTCAAGACTACTTTGCAGGCTGG + Intergenic
1017721570 6:157246583-157246605 TGCTGGCCTCCTTTGGCCGCCGG + Intergenic
1021907011 7:25344524-25344546 TCCTGACCTCCTTTGCAGCCAGG - Intergenic
1023004682 7:35850636-35850658 ATGTGACCTCCTTTCCAGGCTGG + Intronic
1023108834 7:36789769-36789791 TTCTGGCCTCTTTTGAAGCTTGG + Intergenic
1024282790 7:47733319-47733341 TCCTGCCCTCCTCTGCAGCCTGG + Intronic
1025218679 7:57085017-57085039 ATGTGACCTCCTTTCCAGGCTGG - Intergenic
1025629600 7:63258615-63258637 ATGTGACCTCCTTTCCAGGCTGG - Intergenic
1025652667 7:63485422-63485444 ATGTGACCTCCTTTCCAGGCTGG + Intergenic
1026109440 7:67447184-67447206 TCCCAGCCTCCTTTGCAGGTAGG + Intergenic
1026372739 7:69717934-69717956 CTTTGGCCTCCTTTGCTGGCCGG - Intronic
1026595248 7:71729300-71729322 TCCTGGCCTCCCTTGCAGACAGG + Intergenic
1026824118 7:73570669-73570691 TTCTGGCCTCCTGTGGGGACCGG - Exonic
1028137233 7:87234806-87234828 TTCTGGCCTTCCATGCATGCAGG - Intergenic
1028538862 7:91920489-91920511 TCCTAGCCTCCTTTGCAGCAAGG - Intergenic
1029402812 7:100356250-100356272 TTCGGCCCACCTTTGCAGGTGGG + Intronic
1031427326 7:121621446-121621468 TTCTTACCTCCATTGCAGGTAGG - Intergenic
1032059527 7:128712929-128712951 TCCTGGCCTCCCTTGCAGCTAGG - Intronic
1032382683 7:131501615-131501637 TTCTGGCCTCCTGTGCAGCTTGG + Intronic
1032557057 7:132847226-132847248 TCCTAGCCTCCTTTGCAGCTGGG - Intronic
1033048629 7:137984293-137984315 TCCTGGCCTCTTTTGCAGCTAGG + Intronic
1033223642 7:139544511-139544533 TCCTGGCCTCCTTTGTCTGCAGG + Exonic
1033646305 7:143307213-143307235 TTCTGCCCTCATTTACAGCCTGG - Exonic
1034194715 7:149237546-149237568 GTGCTGCCTCCTTTGCAGGCTGG + Intergenic
1034568183 7:151932587-151932609 TTCTGGCCACCTTTGGAGACTGG - Intergenic
1038307740 8:26419999-26420021 TTCCAGCCTCTCTTGCAGGCAGG - Intronic
1038407736 8:27334516-27334538 TTCTGGGCTTCTTTGCATCCTGG + Intronic
1038547438 8:28436263-28436285 TTCTGGGCTCCTGAGCAGACAGG - Intronic
1039657614 8:39427051-39427073 TTCCAGCCTCCTTTGCAGTTAGG - Intergenic
1040524287 8:48205504-48205526 TTCTCCCCACCTTTGCAGGTTGG - Intergenic
1040656191 8:49511939-49511961 TTCTCCCATCCTTTGCAGACTGG + Intergenic
1041479739 8:58306960-58306982 TCCTGGCAGCCTTTGCAAGCTGG + Intergenic
1042343346 8:67703349-67703371 TGCTGGCCTCCTGTCCAGGAGGG - Intronic
1045329092 8:101140164-101140186 TGCTGGCCTCTTTCTCAGGCTGG + Intergenic
1045344643 8:101283099-101283121 TTCTGGCCTGAGTTGCAGGCAGG + Intergenic
1045828391 8:106428414-106428436 TCCCAGCCTCCCTTGCAGGCAGG - Intronic
1046146870 8:110172098-110172120 TCCTGGCTGCCTTTACAGGCTGG - Intergenic
1046358399 8:113117658-113117680 TCCTGGCTGCCTTTACAGGCTGG - Intronic
1046773629 8:118140709-118140731 TTCTAGCCTCTTTTGCAGTTTGG + Intergenic
1047507020 8:125488102-125488124 TTCTGGCCATCTGTTCAGGCAGG + Intergenic
1047728807 8:127708810-127708832 TCCTGGCTTCCCTTGCAGGAAGG - Intergenic
1048228727 8:132616215-132616237 CTCTGGCCTCCCTTGCAGGTGGG + Intronic
1049191007 8:141287529-141287551 TTCTGGCCTCCTTGGCTGACTGG + Intronic
1049423206 8:142525901-142525923 TCCTGGCCTCCTCTGCTGGGGGG - Intronic
1049432142 8:142570101-142570123 CTCCGGCCTCCTTTGCGGGTGGG - Intergenic
1049789765 8:144467185-144467207 TTCTTGTCTCCTTCGCAGTCTGG + Exonic
1057696427 9:97326125-97326147 AGCTGACCTCCTGTGCAGGCAGG - Intronic
1057817218 9:98304478-98304500 ATCTGGCCTCTTTTACAGGATGG + Intronic
1057873578 9:98736056-98736078 TCCTGGCCTCCTCTGCATCCAGG + Exonic
1058578548 9:106430057-106430079 TTCTGGCCTCAGCTGCATGCAGG - Intergenic
1058788496 9:108416674-108416696 TGCTGGCCTCCTTGACAGGTGGG - Intergenic
1060085444 9:120695878-120695900 TTCTGGCCTCCCCTGCAGCCAGG + Intronic
1060494400 9:124107371-124107393 TTCTGGCCACCTTGGCCAGCTGG + Intergenic
1061388013 9:130301756-130301778 TGCTGGGCTCCTCTGCTGGCGGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1189072599 X:37880325-37880347 TCCTAGCCTCCTTTGCAGATAGG - Intronic
1189181229 X:39006424-39006446 TTTTGGCCTATTTTGCAGGCGGG + Intergenic
1189295957 X:39917911-39917933 TTTTAGCCTCCTTTGCAGGCTGG - Intergenic
1189370213 X:40422031-40422053 TCCCAGCCTCCTTTGCAGGTAGG + Intergenic
1190784357 X:53629721-53629743 TTCTGCCCTCCATTGCTGGTTGG - Intronic
1192967552 X:76195345-76195367 TTCTGGCTACTTTTACAGGCTGG + Intergenic
1193439030 X:81515880-81515902 TCCTGGCTTCCTTCACAGGCTGG - Intergenic
1195942079 X:110175129-110175151 TTTTGGCCCTCTTTGAAGGCAGG + Exonic
1198450160 X:136759286-136759308 TTCAGGCCTGCTTCACAGGCAGG + Intronic
1199328548 X:146531072-146531094 TTCTGGTTTCCTGTGCAGTCTGG + Intergenic
1200133309 X:153863016-153863038 CTCTGGCCACCCTGGCAGGCAGG + Intronic
1200854853 Y:7926468-7926490 TTATAATCTCCTTTGCAGGCAGG + Intergenic
1200858671 Y:7966533-7966555 TTGTAATCTCCTTTGCAGGCAGG + Intergenic
1200897653 Y:8392740-8392762 TTTTAACCTCCTTTGTAGGCAGG + Intergenic