ID: 919829614

View in Genome Browser
Species Human (GRCh38)
Location 1:201531374-201531396
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919829604_919829614 30 Left 919829604 1:201531321-201531343 CCGGTATCCAGGCTCTCCCAGAG No data
Right 919829614 1:201531374-201531396 GAGTGTGTGCAGCGCTCCCACGG No data
919829606_919829614 23 Left 919829606 1:201531328-201531350 CCAGGCTCTCCCAGAGCGGCACT No data
Right 919829614 1:201531374-201531396 GAGTGTGTGCAGCGCTCCCACGG No data
919829608_919829614 14 Left 919829608 1:201531337-201531359 CCCAGAGCGGCACTTTAGCTGGC No data
Right 919829614 1:201531374-201531396 GAGTGTGTGCAGCGCTCCCACGG No data
919829612_919829614 -8 Left 919829612 1:201531359-201531381 CCAAGGCCTGGAGCAGAGTGTGT No data
Right 919829614 1:201531374-201531396 GAGTGTGTGCAGCGCTCCCACGG No data
919829609_919829614 13 Left 919829609 1:201531338-201531360 CCAGAGCGGCACTTTAGCTGGCC No data
Right 919829614 1:201531374-201531396 GAGTGTGTGCAGCGCTCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr