ID: 919834297

View in Genome Browser
Species Human (GRCh38)
Location 1:201563182-201563204
Sequence GACTCAGGGCTAGCTGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919834292_919834297 22 Left 919834292 1:201563137-201563159 CCGGATCGTCAGAGGGTGCAGAC No data
Right 919834297 1:201563182-201563204 GACTCAGGGCTAGCTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919834297 Original CRISPR GACTCAGGGCTAGCTGCCCC TGG Intergenic
No off target data available for this crispr