ID: 919836767

View in Genome Browser
Species Human (GRCh38)
Location 1:201580160-201580182
Sequence GCCACCATCTAATCTGCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919836767_919836770 -10 Left 919836767 1:201580160-201580182 CCCTTAGCAGATTAGATGGTGGC No data
Right 919836770 1:201580173-201580195 AGATGGTGGCTGCCCACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919836767 Original CRISPR GCCACCATCTAATCTGCTAA GGG (reversed) Intergenic
No off target data available for this crispr