ID: 919839976

View in Genome Browser
Species Human (GRCh38)
Location 1:201601902-201601924
Sequence CCTCCTCGACACCACCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919839976_919839986 23 Left 919839976 1:201601902-201601924 CCTCAGTGGTGGTGTCGAGGAGG No data
Right 919839986 1:201601948-201601970 CTCTGAGTTCCAGCCAGCTCAGG No data
919839976_919839981 -4 Left 919839976 1:201601902-201601924 CCTCAGTGGTGGTGTCGAGGAGG No data
Right 919839981 1:201601921-201601943 GAGGGGATCCACAGGCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919839976 Original CRISPR CCTCCTCGACACCACCACTG AGG (reversed) Intergenic
No off target data available for this crispr