ID: 919841024

View in Genome Browser
Species Human (GRCh38)
Location 1:201609494-201609516
Sequence CAGTGGCCCTGGAAGTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919841014_919841024 -2 Left 919841014 1:201609473-201609495 CCTTCATCCCTTGCCCCAGACCA No data
Right 919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG No data
919841007_919841024 29 Left 919841007 1:201609442-201609464 CCACGATCTCTCCTGTCCCGGCA No data
Right 919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG No data
919841012_919841024 6 Left 919841012 1:201609465-201609487 CCAAGGACCCTTCATCCCTTGCC No data
Right 919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG No data
919841013_919841024 -1 Left 919841013 1:201609472-201609494 CCCTTCATCCCTTGCCCCAGACC No data
Right 919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG No data
919841010_919841024 13 Left 919841010 1:201609458-201609480 CCCGGCACCAAGGACCCTTCATC No data
Right 919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG No data
919841006_919841024 30 Left 919841006 1:201609441-201609463 CCCACGATCTCTCCTGTCCCGGC No data
Right 919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG No data
919841011_919841024 12 Left 919841011 1:201609459-201609481 CCGGCACCAAGGACCCTTCATCC No data
Right 919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG No data
919841009_919841024 18 Left 919841009 1:201609453-201609475 CCTGTCCCGGCACCAAGGACCCT No data
Right 919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG No data
919841016_919841024 -9 Left 919841016 1:201609480-201609502 CCCTTGCCCCAGACCAGTGGCCC No data
Right 919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG No data
919841017_919841024 -10 Left 919841017 1:201609481-201609503 CCTTGCCCCAGACCAGTGGCCCT No data
Right 919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919841024 Original CRISPR CAGTGGCCCTGGAAGTATGT GGG Intergenic
No off target data available for this crispr