ID: 919845372

View in Genome Browser
Species Human (GRCh38)
Location 1:201639124-201639146
Sequence CAGAGCAAAGCAAAGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 385}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919845372 Original CRISPR CAGAGCAAAGCAAAGGTGCA GGG Intronic
901320320 1:8335940-8335962 CAGAGCAAGACAAAGTTGGAAGG - Intronic
901551023 1:9996455-9996477 CAGAGAAAAGCAAAGGAGAAGGG - Intergenic
901633380 1:10658667-10658689 CAGAGCAGAGCAGAGGGGCTGGG - Intronic
901978387 1:13013340-13013362 CAGGGCAAAGCAATTGTTCAGGG + Intronic
902003696 1:13215598-13215620 CAGGGCAAAGCAATTGTTCAGGG - Intergenic
902022921 1:13361342-13361364 CAGGGCAAAGCAATTGTTCAGGG - Intergenic
902207049 1:14876414-14876436 CAGAGCAAAGAACAGATGCTTGG + Intronic
902614956 1:17618672-17618694 CAGAGCAAGGTACAGGTGCCGGG - Intronic
902829029 1:18997721-18997743 CAGAGAGAAACAGAGGTGCAGGG - Intergenic
902919062 1:19655880-19655902 CAGGGAAAAGAACAGGTGCAAGG - Intronic
902981261 1:20125003-20125025 CAGAGGGAAGCAAAGGAGAAGGG + Intergenic
903057836 1:20648764-20648786 CGGAGGAAAGCAAAGTGGCAGGG - Intronic
903599471 1:24525008-24525030 CAGTCCAAAGCAAAGGTGTGTGG + Intronic
903812170 1:26040789-26040811 CATAAGAAAGCCAAGGTGCAGGG + Intronic
904899960 1:33849159-33849181 CAGAACAGAGTAAAGCTGCATGG - Intronic
905263964 1:36738524-36738546 CAGGACAAAGCAAAGCTGGAGGG + Intergenic
905273423 1:36801790-36801812 CAGAGGAAAGCAAAGGAGATTGG - Exonic
906048039 1:42847404-42847426 CAGAGAGAAGCAACGGTGGAAGG - Intronic
907790483 1:57658859-57658881 AAGAGCAAAGCAAAGAGGCTGGG - Intronic
908189180 1:61683801-61683823 CAGAGCTAAGCAAGGAGGCAGGG - Intronic
908238801 1:62171868-62171890 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
908492440 1:64659645-64659667 CATGGCAGAGCAGAGGTGCATGG - Intronic
909075270 1:71045643-71045665 CAGAGCAATGCAGAGGAGCAAGG - Intronic
911084996 1:93968924-93968946 CAGAGCAGAGTAAAGGGGCTGGG + Intergenic
912335535 1:108859025-108859047 CAAAGCACAGCAAAGGTCCGTGG - Intronic
912800050 1:112714836-112714858 CAGAGGATAGCAAAGGTCCACGG + Intronic
913187676 1:116384370-116384392 CAGAGAAAAGCAAAGACTCATGG - Intronic
913522717 1:119661042-119661064 TAGAGCAAAGCAGAGGTACTGGG + Intronic
914678041 1:149918648-149918670 AAGAGCAAAGGAAAGATGAAGGG - Intergenic
915118747 1:153615724-153615746 CAGGGCAAGGCCAAGGTGAAGGG + Intronic
915326766 1:155084843-155084865 CAGAGGGTAGCAAAGGCGCAGGG - Intronic
916558825 1:165915422-165915444 CAGAGGAAAGCAAAGCTGTGTGG + Intergenic
918195213 1:182214577-182214599 CACTGCAAAGAAAAAGTGCAGGG + Intergenic
918411090 1:184258796-184258818 GAGAGCGATGCAAAGGTTCAGGG - Intergenic
918588073 1:186210545-186210567 CAAAGCAACCCAAAGGTGAAGGG + Intergenic
919660912 1:200245549-200245571 CAGAACAAAGCAAAAGTACATGG - Intergenic
919845372 1:201639124-201639146 CAGAGCAAAGCAAAGGTGCAGGG + Intronic
920558006 1:206918329-206918351 CAGAGAAAAGAACAGGTCCAAGG - Intronic
920991756 1:210946412-210946434 CAGAGTAAAGCAAATGGGAAAGG - Intronic
921821237 1:219619468-219619490 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
922081797 1:222304829-222304851 CACAGCTAAGCCAAGATGCAGGG - Intergenic
923568644 1:235095134-235095156 CAGAGAAATCCAAAGGTTCATGG + Intergenic
924953698 1:248907804-248907826 CAGGGCAAAGCAATTGTTCAAGG + Intronic
1062965763 10:1606598-1606620 AAGAGGGAAGAAAAGGTGCAGGG + Intronic
1063407771 10:5813284-5813306 CCGAGCAAGGAAAAGGCGCAGGG + Exonic
1063982504 10:11466007-11466029 CTGGGCAAAGCAAATGTGGAAGG + Intronic
1064328143 10:14369954-14369976 CAGAGCAATCCAAAGGAGAATGG - Intronic
1065481944 10:26204295-26204317 CAGTGAAAAGCAAATGGGCAGGG - Intronic
1065720431 10:28623816-28623838 CAGAGGAAAGCAAACCTGCAAGG - Intergenic
1066286459 10:33971205-33971227 GAGAGAAAACCAAAGGAGCATGG - Intergenic
1070072058 10:73099378-73099400 CATTGCAAAACAAAGGTGCAGGG + Intergenic
1070604326 10:77888204-77888226 CAGAGCAAATGCAAAGTGCAGGG + Intronic
1070727014 10:78799345-78799367 CAGAGGAAAGAAAAGGTAGAAGG - Intergenic
1071387303 10:85134318-85134340 GTGAACAAAACAAAGGTGCAAGG - Intergenic
1072619364 10:97069330-97069352 CAGAGCTAACCACAGGTGCATGG + Intronic
1073553873 10:104428994-104429016 CAGAGAAAAGGAAAGGATCAAGG + Intronic
1073639785 10:105240114-105240136 CAGGGCCCAGCAAGGGTGCAGGG - Intronic
1073765331 10:106676064-106676086 CAGAGCAAAGAAAAGGTCCTCGG - Intronic
1074163356 10:110852741-110852763 CTGAGCACAGCAAGGGTGCAGGG + Intergenic
1074753711 10:116609649-116609671 CAGAGGCAGGCACAGGTGCAGGG + Intergenic
1075687505 10:124374846-124374868 CTCAGCAAAGCATAGTTGCACGG + Intergenic
1075974699 10:126685341-126685363 GAGAGCGAAGCAGAGGTTCAGGG - Intergenic
1076357152 10:129861509-129861531 GATAGAAAAGCAAAGGTGCCTGG + Intronic
1076380612 10:130022545-130022567 CAGGGCAACCCAACGGTGCAGGG - Intergenic
1076607107 10:131696141-131696163 CAGAGCAAAGCACCGGAACACGG + Intergenic
1076843714 10:133058836-133058858 CAAAACACAGAAAAGGTGCATGG - Intergenic
1077703315 11:4461372-4461394 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
1077724596 11:4661513-4661535 CAGAGCACAGCCAAGGTGATGGG + Intergenic
1080082872 11:28241562-28241584 CAGAGAAAAGCAAAGGGGATTGG + Intronic
1081619532 11:44611164-44611186 TAGTGCAAAGCAAAAATGCAGGG - Intronic
1081789746 11:45774443-45774465 CAGAGGACAGCAGAGGTGCCTGG + Intergenic
1081863874 11:46348966-46348988 CAGAGCAAAGCTAAGGGGCGGGG - Intronic
1082724459 11:56718740-56718762 CAGGGCAAAGCAATTGTTCAGGG - Intergenic
1082982480 11:59136372-59136394 CAGGGCAAAGCAATTGTTCAGGG - Intergenic
1083375373 11:62216028-62216050 CAGGGCAAAGCAATTGTTCAGGG - Intergenic
1083578795 11:63812048-63812070 CAGAGCAGAGCAGAGGGGCACGG + Intergenic
1083655934 11:64229698-64229720 CAGTGCAAGGGAAAGGTCCAGGG + Intronic
1083661641 11:64254236-64254258 CAGAACAAAGCCAAGGTCCTAGG - Intronic
1083797280 11:65024428-65024450 CAGGGCAAAGCAATTGTTCAGGG + Intronic
1084799663 11:71534785-71534807 CAGGGCAAAGCAATTGTTCAGGG - Intronic
1086156842 11:83676648-83676670 CAAAGGAAAGCAAGGGTGCAAGG + Intronic
1086156908 11:83677520-83677542 CTAAGGAAAGCAAAGTTGCAAGG + Intronic
1086227977 11:84535551-84535573 CAGAGAAAAAAAAAGGTTCAGGG + Intronic
1087012696 11:93528870-93528892 CAGAGCCCAGCAAAGATGCCAGG + Intronic
1087635505 11:100697069-100697091 CAGAGTAAAGCCAAGATTCAGGG - Intronic
1088184251 11:107146873-107146895 CACATCAAAGCACATGTGCATGG + Intergenic
1091296913 11:134480405-134480427 CCAACCAAAGCAAAGGAGCAGGG - Intergenic
1094371474 12:29742928-29742950 CACAGCAAAGAAAAGGTGAATGG + Intronic
1095456091 12:42387801-42387823 CAGGGCAAAGCAATTGTTCAGGG - Intronic
1096284333 12:50284944-50284966 CAAAACAAACAAAAGGTGCAAGG + Intergenic
1096993940 12:55827519-55827541 CAGAGTCAAGCAACGCTGCAAGG + Exonic
1097307412 12:58084899-58084921 CAGAGCAAAGCAGAGCTGCATGG - Intergenic
1097507038 12:60486514-60486536 AAGAGTACAGCAAAGGTGCAAGG + Intergenic
1099137139 12:78919506-78919528 CAAAGCAAAGCAAAAATGTAAGG - Intronic
1100454405 12:94738281-94738303 CAGAGCAAAGCACTGGTGATTGG + Intergenic
1100973615 12:100098245-100098267 CAGAGAAAAGCAAAGTTAAAAGG + Intronic
1101187330 12:102292713-102292735 CACATAAAAGAAAAGGTGCAGGG - Intergenic
1101805937 12:108063751-108063773 AAGAGCAATGCATAGGTGGATGG + Intergenic
1101919804 12:108923218-108923240 CAGAGTACAGCAAAGGTGACAGG + Intronic
1102007068 12:109595843-109595865 CAGTGCAAAGCAGAGGGGAAAGG - Intronic
1104165849 12:126229107-126229129 CAGAGGGAAGAACAGGTGCAAGG + Intergenic
1104238136 12:126959560-126959582 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
1104481210 12:129109961-129109983 CCGAGCATGGCCAAGGTGCAGGG + Intronic
1104586262 12:130050424-130050446 AAAAGCAAAGCTAAGGTGGAAGG - Intergenic
1104962203 12:132493642-132493664 CAGGGCACAGAAAAGGGGCAGGG - Intronic
1105615047 13:22004190-22004212 CAGTGCAAAGCACAGCTGGAAGG + Intergenic
1106071942 13:26420847-26420869 CAGATCAAAGCTAAGGTGGCTGG - Intergenic
1107075089 13:36315121-36315143 CAAAGCAAAGCAAAGGGCTAGGG - Intronic
1108314951 13:49227779-49227801 AAGATCAAAGCAGAGGTGCAGGG + Intergenic
1109778315 13:67073246-67073268 CAGAGCAAAGCTAAGGTGAATGG + Intronic
1110710593 13:78646884-78646906 CAGGGCAAAGCAATTGTTCAGGG - Intronic
1111245920 13:85540870-85540892 CATTGCATAGCAAAGGTGAAGGG + Intergenic
1114604133 14:23982385-23982407 CAGGGCAAAGCAATTGTTCAGGG + Intronic
1114609155 14:24025182-24025204 CAGGGCAAAGCAATAGTTCAGGG + Intergenic
1115423136 14:33221297-33221319 CAGACCAAAGTCAAGGGGCAGGG + Intronic
1116236584 14:42286017-42286039 GAGAGCAAACCAAAGGCACATGG + Intergenic
1116799257 14:49426170-49426192 CAGAACTAGCCAAAGGTGCAGGG + Intergenic
1117000062 14:51363386-51363408 CATAGGAAGGCAAGGGTGCAAGG + Intergenic
1117046930 14:51822351-51822373 CAAAGCAAAGCAGAGGTCCTTGG - Intergenic
1117118848 14:52547282-52547304 CAGGGCAAAGCCAAGGACCACGG + Intronic
1117359799 14:54961527-54961549 GTCAGCAAGGCAAAGGTGCATGG - Intronic
1118437009 14:65780642-65780664 CAGGGCAAAGCAGTGGTGGAAGG + Intergenic
1119281158 14:73409290-73409312 GAGAGGAAGGCAAAGGTGCATGG - Intronic
1119387272 14:74265573-74265595 CAGCACAAAGGAAAGGTGGAGGG + Intergenic
1119782216 14:77284122-77284144 CAGTGAAAAGCAATGGTGCTGGG - Intronic
1121264945 14:92595526-92595548 CAGAGCAAAGCAAATCTGGGAGG - Intronic
1121295794 14:92820874-92820896 CAGGGCAAAGCAATTGTTCAGGG + Intronic
1121506576 14:94482288-94482310 CAGGGCAAAGCAATTGTTCAGGG - Intergenic
1123035024 14:105468483-105468505 CAGAGCTAAGCAAACTGGCAGGG + Intronic
1123390438 15:19866182-19866204 CAGGGCAAAGCAATTGTTCAAGG - Intergenic
1124240832 15:28026597-28026619 CTGAGCCAAGCCAAGGGGCAGGG - Intronic
1127196048 15:56587003-56587025 AAGATCAAAGTAAAGGAGCAGGG - Intergenic
1127360995 15:58245201-58245223 CACAGCAAAGCATCGGTGCTGGG - Intronic
1129150146 15:73683650-73683672 CAGATCCAAGAACAGGTGCAGGG + Intergenic
1129406714 15:75324160-75324182 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
1129456481 15:75678696-75678718 CAAAGAGAAGCAAAGGGGCAGGG - Intronic
1130022273 15:80241574-80241596 CAGAGCAAAGCAAAGGAGAATGG - Intergenic
1130866207 15:87935257-87935279 CTGAGCCCAGCAAAGGTGCCAGG + Intronic
1131017322 15:89068617-89068639 GAAAGCAAAGCACAAGTGCATGG + Intergenic
1131797550 15:96034922-96034944 CAGAGCAAAGGGAACGTGCAAGG - Intergenic
1132738619 16:1399563-1399585 CAGAGGAGACCAAAGGTGGAAGG + Intronic
1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG + Intronic
1133695254 16:8257065-8257087 CAGAGCAAAGCAACTCTGAAAGG - Intergenic
1134853791 16:17503041-17503063 CAGAGCTAAGGAAAGGAGAAAGG + Intergenic
1135960790 16:26993120-26993142 CAGAGCTCATCAATGGTGCATGG + Intergenic
1136670122 16:31849246-31849268 CAGAGGAAAGAAAAGCTGCGGGG + Intergenic
1138964322 16:62066022-62066044 CAGAGTCAAGAAAATGTGCATGG - Intergenic
1139083404 16:63554308-63554330 CTGAGCCATGCAAAGGTCCAGGG + Intergenic
1139439195 16:66956299-66956321 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
1139612375 16:68068292-68068314 CAGAGCAAAGCAGAGTTGCTTGG + Intronic
1140715580 16:77722780-77722802 CAGAGCAGTGCAAAGGTTCGGGG - Intronic
1141729084 16:85809837-85809859 CAGAGCCAGGCAAAGGGTCAGGG - Intergenic
1142757440 17:2024537-2024559 CCCAGCAAAGCAAAGGTCCCAGG + Intronic
1143159629 17:4860689-4860711 CTGAGCAGAGCAAAGAAGCAAGG + Intronic
1143348674 17:6270433-6270455 CCGTGCAAAGCATAGGGGCAAGG + Intergenic
1143770976 17:9168689-9168711 CACAGCAAAGCAAAGTTCCTGGG + Intronic
1144325821 17:14178653-14178675 CAGAGAAAAGCAGAGATGAATGG - Intronic
1144474695 17:15575541-15575563 CAGAGAAAAGCAGAGATGAATGG - Intronic
1145017598 17:19409346-19409368 CAGGGCAAACCACAGGTACAGGG - Intergenic
1145234103 17:21196635-21196657 CAGAGTAATGAAAGGGTGCATGG - Intergenic
1147237921 17:39071444-39071466 CAGAGCAGAGCAAAGGGGATGGG - Intronic
1147380035 17:40049306-40049328 CAGAGAAAAGCATATGTACACGG - Intronic
1147915692 17:43883871-43883893 CAGAGCAACAAATAGGTGCAGGG - Intronic
1148085370 17:44990613-44990635 CAGAGCCAAGATAAGGTGCTGGG - Intergenic
1149182229 17:53952912-53952934 AAGAGCAAAGAAAAGGAGCCAGG + Intergenic
1150636640 17:66917857-66917879 CATAGCAAGCCAAAGGTGCAGGG + Intergenic
1150647922 17:66991449-66991471 CTGAGCAAAGCAGTGGGGCAGGG + Intronic
1151877118 17:76873116-76873138 CAGACCAGAGCCAAAGTGCATGG - Intronic
1152866444 17:82726577-82726599 CAGAGCAGACCAAAGCTGGAGGG - Exonic
1152883588 17:82834617-82834639 AAGAGAAAACCAAACGTGCATGG + Intronic
1153558218 18:6340568-6340590 GAGAGCATGGCAAAGGGGCAGGG + Intronic
1154024805 18:10697094-10697116 CAGAGCAAAGCATAGATAAAAGG - Intronic
1154040419 18:10849512-10849534 CTGAGCAAAGCAAAGGAGCCGGG - Intronic
1156404384 18:36770491-36770513 CAGATCATAGGAAAGGAGCAGGG - Intronic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156794632 18:41028709-41028731 CTGAGAAATGCAGAGGTGCAGGG - Intergenic
1158284133 18:55860320-55860342 CAGGGAAAAGCACAGATGCAGGG + Intergenic
1160088244 18:75800640-75800662 CACAGAAAAGCCGAGGTGCAAGG - Intergenic
1160506608 18:79430718-79430740 CATAGCAAAAGATAGGTGCAAGG + Intronic
1161709458 19:5839658-5839680 CAGTGCAAAGCAGAAGTCCAGGG + Exonic
1163465799 19:17467960-17467982 CAGAGCACAAGAAAGGTGGAGGG + Intergenic
1163628146 19:18402550-18402572 CAGGGCAAAGCAATTGTTCAGGG - Intergenic
1164489541 19:28694065-28694087 CAGAGGAAAGAAACAGTGCATGG + Intergenic
1164825954 19:31284961-31284983 CAGTGCAAAGCAGATGTGCTGGG + Intronic
1166309741 19:41956324-41956346 CAGCCAAAAGGAAAGGTGCATGG - Intergenic
1166476527 19:43130747-43130769 CTGGCCAAAGCAAAGGAGCAGGG - Intronic
1166490032 19:43250783-43250805 CAGAGAAAAGCAGAGATGTAGGG - Intronic
1166590317 19:43991994-43992016 CAGAGCAATGCAAATGGGCATGG - Intronic
1167134993 19:47610424-47610446 CAAAGCAAAACAAAGGGGCGCGG - Intronic
1167569501 19:50278075-50278097 CACACCAGGGCAAAGGTGCATGG + Exonic
1167723323 19:51193911-51193933 TACAGCTAAGGAAAGGTGCATGG - Intergenic
1167942090 19:52956043-52956065 AAGAGCAAAGAAAAGGAGCCAGG - Exonic
1167944980 19:52980907-52980929 AAGAGCAAAGAAAAGGAGCCAGG - Intergenic
1168138665 19:54369517-54369539 TAGAGGAATGCAAAGGTGGAGGG - Intronic
1168159411 19:54499266-54499288 TAGAGGAATGCAAAGGTGGAGGG + Intronic
1168485636 19:56759891-56759913 CAGACCAGAGCCCAGGTGCAGGG + Intergenic
925084529 2:1097558-1097580 CACAGCAAAACATAGGTGCATGG + Intronic
925266485 2:2570005-2570027 CACAGCAAAGCAAAGCAGCATGG - Intergenic
925570077 2:5300699-5300721 CAGGGCAAAGCAAAGGTCTCTGG + Intergenic
925837768 2:7962655-7962677 CAGAGGAAAGCCAAGGTTCAAGG - Intergenic
927749266 2:25652028-25652050 CAGAGCAAAACAATCCTGCAAGG + Intronic
929442447 2:41974856-41974878 CAGATCAAAGGACATGTGCATGG + Intergenic
930033833 2:47073618-47073640 CTGGGCCAAGCACAGGTGCACGG - Intronic
931209427 2:60178556-60178578 CAGAGCAAAGCACAGGAGTGGGG + Intergenic
932600373 2:73120085-73120107 CAGAGCAAAACAATTGTTCAGGG + Intronic
932863904 2:75321740-75321762 CAGAGCAAGGAAAGGCTGCAGGG - Intergenic
933161119 2:79026213-79026235 CAGAGCCAAGAAAAGGAGGAAGG + Intronic
933392851 2:81694105-81694127 CAAAGGAAAACAAAGCTGCATGG - Intergenic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
934849320 2:97687432-97687454 CAAAGCAAAGCCAAGGCCCAAGG + Intergenic
935132319 2:100269855-100269877 CAGGGCAAAGCAATTGTTCAGGG - Intergenic
935691296 2:105734604-105734626 CAAGGCAAAGCAAGGGTGCCAGG + Intergenic
938047820 2:128139016-128139038 AAGGGCAAAGCAAAGTGGCAGGG + Intronic
938530057 2:132175938-132175960 CAGGGCAAAGCAATTGTTCAAGG + Intronic
938653747 2:133410035-133410057 CTCAGCAAAGCAAAGGCTCAAGG + Intronic
938882565 2:135606290-135606312 GAAAGCCAAGCAAAGCTGCAAGG + Intronic
939259211 2:139785042-139785064 TAGAGCAAAGAAGAGGAGCATGG - Intergenic
940358377 2:152769968-152769990 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
941519159 2:166517170-166517192 GAGAGAAAAGGAAAGGAGCAAGG - Intergenic
943086005 2:183312041-183312063 GTGAGCAAGTCAAAGGTGCAAGG - Intergenic
943554373 2:189383912-189383934 CAGAGGATAGGAAAGGTGAATGG - Intergenic
944461503 2:199955230-199955252 TAGACCAAGGGAAAGGTGCACGG - Intronic
944910225 2:204303712-204303734 CAGTCCAAAGCCAAGGGGCAAGG - Intergenic
944939218 2:204605107-204605129 GAGAGCCAAGCAGAGCTGCAAGG + Intronic
945201095 2:207282268-207282290 CAGAGCCAAGCAAAGGTCAATGG + Intergenic
946024263 2:216662287-216662309 CCGATCAAAGCAAAGATGCTTGG - Intronic
947633384 2:231667513-231667535 CACAGCAACGCAAGGCTGCATGG + Intergenic
948077868 2:235180434-235180456 AAATGCAAAGCAAAGCTGCATGG + Intergenic
948338215 2:237227985-237228007 AAGAGCAAAGCTAAGGAACAGGG - Intergenic
948889468 2:240900018-240900040 AGGAGCAAAGCAAAGAAGCAGGG + Intergenic
1169313180 20:4565510-4565532 CAGAGCAAAGCCAAGAGCCATGG + Intergenic
1169470931 20:5885088-5885110 CAGGGCAAAGCAATTGTTCAGGG - Intergenic
1169843853 20:9968412-9968434 CAGAAGAAAGCCAAGGTGCAAGG + Intergenic
1171295148 20:24010969-24010991 CAGAGCAATGCACACCTGCATGG + Intergenic
1171940632 20:31325588-31325610 CAAAAGAAAGCAAGGGTGCAAGG + Intergenic
1172013389 20:31859434-31859456 CAGTGCTGTGCAAAGGTGCAGGG - Intronic
1172060790 20:32186015-32186037 GAGAGCAAAGCAGAAGTGGATGG + Intergenic
1173116926 20:40253024-40253046 AAGTGCAGAGCAAAGGGGCAGGG - Intergenic
1173395869 20:42678759-42678781 CAGAACACAGCAAAGCTGCTGGG + Intronic
1173526166 20:43734567-43734589 CTGAGTGAAGCAAAGGTTCATGG - Intergenic
1177335377 21:19718271-19718293 GAGATCAAAGCAAAGCTGCTTGG - Intergenic
1178175166 21:30088755-30088777 AAGAGCAAAGGAAAAGTGCGGGG - Intergenic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1179427480 21:41293281-41293303 AAGGGAAAAGCAAAAGTGCAAGG - Intergenic
1179465408 21:41568377-41568399 CTGGGCAAGGCAAAGGTGCCAGG - Intergenic
1179540571 21:42081051-42081073 CAGAGCACAGCTAAGATGCTGGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180513577 22:16118255-16118277 CAGGGCAAAGCAATTGTTCAAGG - Intergenic
1180706045 22:17810584-17810606 CAGAGCAGAGCAGAGGTAGACGG - Intronic
1180752799 22:18136748-18136770 GAGAGCAAAGCAAAGGGGCTTGG + Intronic
1180997835 22:19974229-19974251 CAGCTCAAAGCCTAGGTGCAGGG + Exonic
1181363233 22:22354719-22354741 GAAAGCAGAGCAAGGGTGCAGGG + Intergenic
1184244758 22:43230350-43230372 GAGTGCCAAGCAAAGGAGCATGG + Intronic
1184729379 22:46364504-46364526 CAGAGCAGAGGAAAGGTGCCTGG - Exonic
1184825961 22:46951148-46951170 CAGAGAGAAGAAAAGCTGCAAGG - Intronic
1185197927 22:49483938-49483960 GAGAGGAAAGCACAGGTCCATGG - Intronic
949128179 3:471098-471120 CAGTGCAAAGCAGAAGTGTAGGG + Intergenic
949515883 3:4806558-4806580 TAAAGAAAAACAAAGGTGCATGG - Intronic
950566443 3:13772403-13772425 AAGAGCCAGGCAAAGGTGTAGGG + Intergenic
950756288 3:15175548-15175570 CAGAGAGAAGGAAAGGTACAGGG - Intergenic
950986256 3:17371412-17371434 CAGTGCAAAAGAAAGATGCAAGG - Intronic
952125257 3:30292248-30292270 GAGAGGAAAGGAAAGGTGAAAGG - Intergenic
952252433 3:31667397-31667419 TACAGCAAAGCAAAGGTTCCAGG + Intronic
952670976 3:35967829-35967851 CAGATGAAAGCACAGGGGCATGG + Intergenic
953109455 3:39919467-39919489 CAGGGCAAGGCAAGGCTGCATGG - Intronic
953139442 3:40213879-40213901 CGAAGCAAAGCAAAGGAGCTGGG - Intronic
953409821 3:42684421-42684443 CAGACCATAGACAAGGTGCAGGG + Intergenic
954108310 3:48420779-48420801 CAGAGCACAGCCATGGGGCAAGG + Intronic
954372450 3:50175993-50176015 CAGAGGGAAGGAAAGGGGCAAGG - Intronic
954903214 3:54037972-54037994 TAAAGCAAAGCAAAGATGTATGG - Intergenic
954998243 3:54901661-54901683 CAGAGCAAGGCCAAGAAGCAAGG + Intronic
955021376 3:55124951-55124973 CAGAGCACACCAAGGGTCCATGG + Intergenic
955296420 3:57739496-57739518 CAGAGCAAAATAAAAATGCAGGG + Intergenic
955499849 3:59572931-59572953 CGGAGCCTTGCAAAGGTGCAGGG - Intergenic
955636778 3:61038825-61038847 CAGAGCAAAATAAAAATGCAGGG + Intronic
956004505 3:64763977-64763999 CAGACCATAGCAAAGGTAGAAGG - Intergenic
956345919 3:68278670-68278692 CTGTGCTAAGAAAAGGTGCAAGG - Intronic
956412880 3:68996658-68996680 CACAGCACAGCTCAGGTGCAAGG - Intronic
956748528 3:72328670-72328692 CAAAGCAAAGCAAAGGCCAAAGG + Intergenic
956791511 3:72683638-72683660 CAATTCAAAGCAAAGGTGCTAGG + Intergenic
957405331 3:79767804-79767826 CAGTGCACAGCAAAGTTGCAGGG - Exonic
957687735 3:83524566-83524588 AAGAGCAAAGCAGAGGGGGATGG - Intergenic
960204866 3:114884577-114884599 CATAGCTAAGCAAAGATGTATGG - Intronic
961558607 3:127713532-127713554 CAGAGCCAAGAAAAGGCCCAGGG + Intronic
961659002 3:128458479-128458501 CAGAGCTCAGCAGAGGGGCAGGG - Intergenic
961828000 3:129608519-129608541 CAGAGCCCAGCAGGGGTGCATGG + Intergenic
962349904 3:134649084-134649106 CAGAGAAGAGGAAAAGTGCATGG - Intronic
964417546 3:156463383-156463405 CATAGCAAAGTAAAGGTGAGTGG - Intronic
964435254 3:156644310-156644332 CAGAGCAGAGCAAGGGAGGAGGG - Intergenic
965127056 3:164644402-164644424 CATAGGAAACTAAAGGTGCAAGG - Intergenic
966300449 3:178473578-178473600 AAAAACAAAGCAAAGGTGGATGG + Intronic
966851505 3:184167788-184167810 CAGATCAAAGGAAGGGTCCAAGG - Intronic
969118060 4:4886361-4886383 CATCAGAAAGCAAAGGTGCAGGG - Intergenic
969636770 4:8373983-8374005 CAGAGTGAAGCAGGGGTGCATGG + Intronic
970429376 4:15974789-15974811 CAGTGCAAAGAGAAGGTGCTAGG - Intronic
970558755 4:17261735-17261757 CAGAGCCAAGAAAAGGTGAGTGG + Intergenic
970665749 4:18334173-18334195 GAGAGCAAAGCAAGGGTTGAGGG - Intergenic
971240869 4:24887674-24887696 CAGAGCAAAACAGAGGTTCCAGG - Intronic
971420099 4:26466893-26466915 CAGACCAAAGCAATATTGCAAGG - Intergenic
971487807 4:27178235-27178257 CAGAGCTAAGCAGAAGGGCAAGG - Intergenic
971971883 4:33631458-33631480 AAGAGCACCGCAAAGTTGCATGG - Intergenic
972998831 4:44919254-44919276 CAGAGCGAAGTAGGGGTGCAGGG - Intergenic
974454038 4:62103025-62103047 CTGAGTAAAGCAAAGGTGATGGG - Intergenic
975709071 4:77141024-77141046 CAGAGCTAAGCACAGGGCCATGG - Intergenic
976258045 4:83119265-83119287 CAGAGGAAACCAGAAGTGCAAGG - Intronic
976854309 4:89584676-89584698 CAGAGCAAATCAAAAGTATAAGG - Intergenic
978599796 4:110415922-110415944 AAGAGCAAAGAAAAGGAGCCAGG + Intronic
979521506 4:121672854-121672876 CAAAGCACGGCAATGGTGCAAGG + Intronic
980972476 4:139579951-139579973 CAGAGCAAACCAAGAGAGCAAGG - Intronic
983698734 4:170565618-170565640 CTGAGCAAGGCAAAGGGGCTTGG + Intergenic
983870658 4:172821912-172821934 CAGAGCCAAGCAATGGGGGAGGG - Intronic
984388696 4:179099364-179099386 CAGGGCAATGAAAAAGTGCAAGG + Intergenic
985196846 4:187440007-187440029 AAGAGCAAAGAAAATGGGCATGG + Intergenic
985876962 5:2607215-2607237 CAGAGCAAGGCAGAGGTGAGTGG + Intergenic
986166099 5:5272687-5272709 CAGTGCAAAACAAATGTGCCAGG - Intronic
986446948 5:7829747-7829769 CAGAGCAAAGGAAAGATGAATGG - Exonic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
987525834 5:19047790-19047812 CTGAGCAAAGGAAAGGAGCTAGG - Intergenic
987609368 5:20182015-20182037 CAGAACAAAGAAAATGTGCATGG + Intronic
992492362 5:77257939-77257961 CAGGGCAAAAGAAAAGTGCAAGG + Intronic
992655902 5:78909449-78909471 CAGGGCAAAGCAATTGTTCAGGG - Intronic
992881501 5:81114735-81114757 CAGAGGAAAGAACAAGTGCAAGG - Intronic
993598723 5:89892470-89892492 AAGAGCAAGGAAAAGGGGCAGGG + Intergenic
995734288 5:115282346-115282368 CTGAGCAAAGCAAAGATAGATGG - Intronic
995822965 5:116258817-116258839 CAGACAAAAGCAGAGGTGCAGGG - Intronic
995932490 5:117464631-117464653 CAGAGAAAACCACAAGTGCATGG - Intergenic
997149192 5:131473908-131473930 CAGAGAAAAGCAAAGAGACATGG + Intronic
998058603 5:139101007-139101029 CAGAGAAGAGCAGAGGTCCAAGG + Intronic
999259896 5:150231760-150231782 CATGGCAAAGCAAAGGTGGTAGG - Intronic
999361692 5:150991369-150991391 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
1001196534 5:169678114-169678136 CAGAGTTAAGTAAATGTGCATGG + Intronic
1001906170 5:175475358-175475380 CTGAGCATAGCAAAAGTTCAGGG - Intergenic
1002268951 5:178056911-178056933 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
1002765423 6:234911-234933 CTGAGGGAAGCAAAGGTGCATGG + Intergenic
1003523468 6:6878864-6878886 CACAGCAGGGCAAAGGAGCAGGG - Intergenic
1005430298 6:25749374-25749396 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
1005618444 6:27597601-27597623 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
1005988018 6:30886099-30886121 CAGAGCCAAGCAGAGGAACACGG - Intronic
1006081394 6:31569430-31569452 CAGAGAAAAAGAAAGGAGCAGGG + Intergenic
1006826142 6:36937716-36937738 CAGAGCAGAGCAAAGCATCAAGG + Intergenic
1007015028 6:38457044-38457066 AAGAGCAAAGCAAAAGCGCTAGG + Intronic
1007257827 6:40541061-40541083 CAGAGCCAGGCACAGGTGCAGGG + Intronic
1007427943 6:41759362-41759384 GAGAACAAGGCAAAGGAGCATGG - Intergenic
1007795513 6:44343608-44343630 CTGAGCAAAGGAAAGATGAAAGG - Intronic
1009555170 6:65154312-65154334 AGGAGCAAAGAAAAGGTGGAAGG + Intronic
1010423906 6:75704991-75705013 CAGGGCAAAGCAATTGTTCAGGG + Intronic
1010979434 6:82354207-82354229 CATACTAAAGCCAAGGTGCATGG - Intergenic
1011027252 6:82882504-82882526 CAAAACAAAGCATAGGTGGAAGG - Intergenic
1011971620 6:93231512-93231534 CAGAGCAAAGCATAGATTCTAGG - Intergenic
1012408927 6:98933588-98933610 AAGAGCAGAGGAAAGGTGCATGG - Intronic
1013070535 6:106725027-106725049 CAGAGCACGGCAGAAGTGCAAGG + Intergenic
1013996114 6:116310268-116310290 CAGAGAAAAGCAGAGGACCACGG - Intronic
1016051418 6:139534326-139534348 CAGAGCCATGCAAAGCTGGAAGG + Intergenic
1017321131 6:153094476-153094498 TAGAGAAAAGCAAAGGTACAAGG - Intronic
1017450559 6:154551050-154551072 CAAAGCAAAGCAATGGTTTAAGG - Intergenic
1018003333 6:159598613-159598635 CAGAGCCAAGCAAGGGTGTGAGG + Intergenic
1018003930 6:159603029-159603051 CAGAGCACAGCAACGCGGCATGG + Intergenic
1018720230 6:166566529-166566551 CAGAGCTCTGCACAGGTGCAGGG + Intronic
1019632990 7:2059489-2059511 CAGAGGAGAGGAAAGGTGCGGGG + Intronic
1020671984 7:11127518-11127540 AGTAGCAAAGCAAAGATGCATGG - Intronic
1021613920 7:22483010-22483032 CAGAGCAAACCAAAGTTGGTGGG - Intronic
1022477059 7:30718200-30718222 CAGGGCAAAGCAATTGTTCAGGG - Intronic
1022477227 7:30719485-30719507 CAGGGCAAAGCAATTGTTCAAGG + Intronic
1024063672 7:45716350-45716372 GAGAGGAAAGCACAGGAGCAGGG - Exonic
1025932317 7:66005572-66005594 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
1026433761 7:70375027-70375049 AAGAGCTGAACAAAGGTGCAGGG - Intronic
1027184329 7:75961463-75961485 AGGAGCAAAGCACAGGTGCAGGG - Intronic
1027717086 7:81686235-81686257 GAGAGCCAAGCAAAGGGGGAAGG + Intergenic
1027990441 7:85353384-85353406 CAGTGCAAAGCAAAGCATCAGGG + Intergenic
1028605990 7:92656315-92656337 CAGCGCAAAACAAAAGAGCAAGG + Intronic
1028714070 7:93943984-93944006 CAGAGGCAAGCAGAGGAGCATGG - Intergenic
1029386250 7:100245530-100245552 CTGAGCAAGGCAGAGGGGCAGGG - Intronic
1029475520 7:100781404-100781426 AGGAGCAAAGCAGAGGTGCAGGG + Intronic
1029790515 7:102838589-102838611 CAGGGCAAAGCAATTGTTCAGGG - Intronic
1030086797 7:105822734-105822756 CATAGCTAAGCAATGGTGGATGG + Intronic
1030188342 7:106785911-106785933 CAGCATAAACCAAAGGTGCAGGG - Intergenic
1030626783 7:111853624-111853646 CAGAGGAAAGCAACAGTGGAGGG + Intronic
1031036890 7:116797302-116797324 TAGAGCAAAGAAAGGGTGGATGG + Intronic
1032315448 7:130834216-130834238 CACAGCAAAGCAACGGAACAGGG - Intergenic
1033229365 7:139584355-139584377 CAGAGCTCAGCAGAGCTGCAGGG + Intronic
1033715464 7:143997035-143997057 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
1033790845 7:144790899-144790921 CAGAGCCAATCAAGGGTGAAGGG + Intronic
1033938237 7:146616229-146616251 GTGAGCAAAGCAAAGGATCACGG + Intronic
1036688514 8:10927001-10927023 AAGGGGAAAGCAAAGGTGAAGGG + Intronic
1036700134 8:11007947-11007969 CAGAGCAGAGCAAAGCAGCATGG + Intronic
1038153641 8:24965992-24966014 CAGAGCTATCCAAAGGTGGAAGG + Intergenic
1038209372 8:25501523-25501545 GACAGCACAGCACAGGTGCAGGG - Intronic
1039009057 8:33073382-33073404 CAGTGGAAAGCAGATGTGCAGGG - Intergenic
1039454818 8:37699414-37699436 CAGAGCAAGGTAGAGGAGCAAGG - Exonic
1039744225 8:40409359-40409381 CAGAGCAAAGCAATGAAGAAGGG + Intergenic
1042500259 8:69500934-69500956 CAGAGCAAAGCAAAGGACCTGGG + Intronic
1043943855 8:86228101-86228123 AAGAGCACAGTAAAAGTGCAAGG + Intronic
1044611652 8:94097947-94097969 AAGAACAGAGCAAATGTGCACGG - Intergenic
1048344274 8:133565322-133565344 CAGAGGAGAGCAAGGTTGCAGGG + Intronic
1048443978 8:134479600-134479622 AAGAGGAAAGCAAAGGGGCCTGG + Intronic
1048854451 8:138674359-138674381 CTGAGCTAAGCAAAGGTGTGTGG - Intronic
1049387944 8:142353729-142353751 AAGAGCCAAGCAGAGCTGCAAGG + Intronic
1050385279 9:5082895-5082917 CAGGGCAAAGCAATTGTTCAGGG + Intronic
1051187913 9:14480069-14480091 CAGAGATAATCAAAGGTGTAGGG + Intergenic
1051322218 9:15918142-15918164 CAGAGCAAAACACAGGAGCTTGG - Intronic
1053033488 9:34803476-34803498 CAGAGAAAAGCAAAGGGGTGAGG + Intergenic
1053433165 9:38057536-38057558 CAGAGCACAGCCAACTTGCAAGG + Intronic
1055242755 9:74203676-74203698 CAGAGGAAAGAAAACCTGCAGGG - Intergenic
1055954231 9:81759222-81759244 CAGAGGAAAGAAAAGGGGAAAGG - Intergenic
1056464164 9:86837771-86837793 CAGAGCAGAGGAAAGGGTCATGG - Intergenic
1057054783 9:91951714-91951736 AAGTGGAAAGCAAAGGTGCTGGG - Intergenic
1057230151 9:93317082-93317104 CTGGGCAAAGCAAGTGTGCAGGG - Intronic
1057517340 9:95733074-95733096 TGGAGCAAAGCAAAAGTTCAAGG + Intergenic
1058252450 9:102716886-102716908 CAAAGCAAAGGAAAAGTGTATGG + Intergenic
1059309743 9:113379953-113379975 CAGGGCAAAGCAATTGTTCAGGG + Intergenic
1059641082 9:116217739-116217761 CAAAACACAGCCAAGGTGCAGGG - Intronic
1060017897 9:120102971-120102993 CAGAGCATATCAAAGCTGGAAGG - Intergenic
1061137366 9:128742587-128742609 CAGGGCATTGCACAGGTGCACGG + Exonic
1061237139 9:129349802-129349824 CAGAGCAAAGCAGCGCTGCCAGG - Intergenic
1061446761 9:130643113-130643135 CAGAGCCAGGCACATGTGCAAGG + Intergenic
1062091535 9:134681037-134681059 GGGAGCAAAGCAAAGGGGCAGGG - Intronic
1062672939 9:137722604-137722626 CAGAGCACACCGCAGGTGCAGGG - Intronic
1187683673 X:21794923-21794945 CAGAGCAAAGAAAATGACCAGGG + Intergenic
1188555533 X:31408213-31408235 CAGAGCACAGCAAAGCTGCATGG + Intronic
1188849937 X:35119596-35119618 CAGAGTGAAGCAATGGGGCATGG + Intergenic
1188852226 X:35145884-35145906 CAGAAAAAAGCAAAGCTGAACGG + Intergenic
1190627401 X:52350018-52350040 CTTAGCAAAGAAAAGGTGTATGG - Intergenic
1192116583 X:68417444-68417466 GAGCAAAAAGCAAAGGTGCAAGG + Intronic
1192216038 X:69158782-69158804 CGGAGCACAGCAAAGGTTAATGG + Intergenic
1194978670 X:100417769-100417791 CAGAGCAAAACAAAGGAGCAGGG + Intergenic
1196516871 X:116624348-116624370 CAGGGCAAAGCAATTGTTCAGGG - Intergenic
1197571465 X:128156047-128156069 CAGAGCAAAGTAAAGGTGAGTGG + Intergenic
1198113531 X:133523504-133523526 CACAGCCAAGCCCAGGTGCAAGG + Intergenic
1198593923 X:138215632-138215654 CTGGGCAAAGCAAAAGTTCAGGG + Intergenic
1200707938 Y:6458690-6458712 CAGAGCTAAGCAAAGGAAAATGG + Intergenic
1201026174 Y:9706018-9706040 CAGAGCTAAGCAAAGGAAAATGG - Intergenic
1201578372 Y:15484808-15484830 CAGAGCAAAGCTAATTTTCATGG - Intergenic