ID: 919846933

View in Genome Browser
Species Human (GRCh38)
Location 1:201648409-201648431
Sequence AAGCCGGGGAGCGATAGGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919846933_919846941 0 Left 919846933 1:201648409-201648431 CCCGCCCTATCGCTCCCCGGCTT 0: 1
1: 0
2: 0
3: 4
4: 117
Right 919846941 1:201648432-201648454 CCCTGCTCTTTCCTTTTTCCCGG 0: 1
1: 0
2: 4
3: 51
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919846933 Original CRISPR AAGCCGGGGAGCGATAGGGC GGG (reversed) Exonic